ID: 1168375614

View in Genome Browser
Species Human (GRCh38)
Location 19:55876866-55876888
Sequence CTGTGGATATGGAGGACTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168375611_1168375614 -10 Left 1168375611 19:55876853-55876875 CCACTAGTTGAATCTGTGGATAT 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG 0: 1
1: 1
2: 3
3: 27
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168375614 Original CRISPR CTGTGGATATGGAGGACTGA CGG Intronic
900800862 1:4736203-4736225 CTGTGGTTTAGGAGAACTGATGG - Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
900964160 1:5945926-5945948 GTGTGGATATGCGGGACGGAGGG - Intronic
901285831 1:8077984-8078006 CTGTGGATATAGATTACTGTAGG + Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
907835154 1:58101851-58101873 GTGTGGAGAGGGAGGACTGCTGG - Intronic
908325072 1:63015778-63015800 ATGTTGATATGAAAGACTGAAGG - Intergenic
908806172 1:67935738-67935760 GTGTGGATATGCTGGACTGAGGG - Intergenic
910700590 1:90069894-90069916 GTGTTGATATGGAGGAGTAATGG + Intergenic
914678259 1:149920338-149920360 CCATGGATATGGAGGACTGATGG - Intergenic
917129677 1:171728207-171728229 ATGTGGATATGCAGGACAAAGGG - Intronic
917535591 1:175872191-175872213 CTGGGGAACTGGGGGACTGAGGG + Intergenic
918175591 1:182041404-182041426 GTGTGAATATTTAGGACTGAAGG - Intergenic
919480605 1:198084408-198084430 CTGTGTATATGCAGGACTTTGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064433088 10:15287928-15287950 CAGTGGATTTGGAGGACTCAGGG - Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1070393447 10:75990833-75990855 CTGTGGGTGTGGAGGACTTCTGG + Intronic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073799851 10:107029465-107029487 CTGTGGTTATGGAGAATTGCAGG - Intronic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1077251556 11:1563081-1563103 CAGAGGATATGGGGGACTGTGGG - Intronic
1077742704 11:4864769-4864791 CTGTAGACATGGAGGAGTCAAGG - Intronic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1079265861 11:18932190-18932212 CAATGGATCTGGAGGACTGAGGG + Intergenic
1079848781 11:25502794-25502816 CAGTGGATATGGAGGCCTACTGG - Intergenic
1080250535 11:30228480-30228502 TTGTGGATGGGGAGGAGTGATGG - Intergenic
1080890287 11:36403151-36403173 CTGAGGAAATGGAGGATGGATGG + Intronic
1082030356 11:47599115-47599137 AAGTGGAGATGGAGGAGTGAGGG + Intergenic
1083473193 11:62898121-62898143 CTGTGAATAGGAAGGTCTGAGGG - Intergenic
1085152135 11:74260811-74260833 ATGTGCATATGGAGGTGTGAAGG - Intronic
1089281847 11:117380229-117380251 CTGTGGATTTGGGGTACTCATGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093023124 12:14221092-14221114 CTGTTGAAAGGGGGGACTGAGGG + Intergenic
1093282486 12:17211431-17211453 CTGTGTGTATGCTGGACTGACGG + Intergenic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1096332174 12:50723259-50723281 CTGAGCATGTGGAGGTCTGACGG - Exonic
1096912241 12:54996268-54996290 GTGTGGATTTAGAGGAGTGAGGG + Intergenic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097209143 12:57351451-57351473 CTGTGGATGGTGAGTACTGAGGG + Intronic
1098614193 12:72502856-72502878 ATGTGAATATGGAGAAATGAGGG + Intronic
1102352028 12:112200091-112200113 CTGTGATTTGGGAGGACTGATGG - Intronic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1104509256 12:129361057-129361079 CTTTGAATATGGAGGACTCAAGG - Intronic
1106571697 13:30933537-30933559 CAGTGGCTATGGAGCAGTGAAGG + Intronic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1107568580 13:41632061-41632083 CCTTGGCTATGGAGGTCTGATGG - Intronic
1109269073 13:60234210-60234232 GTGTGGATATGGTGGACAAAGGG + Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1110213808 13:73004075-73004097 CTGTGGTTTTGGAGGACTCTAGG + Intronic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1111668124 13:91295647-91295669 CTGTGGGTATCCAGGCCTGAGGG - Intergenic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1114499390 14:23156812-23156834 CCCTGGAAATGGAGGAATGAGGG - Intronic
1114529182 14:23384794-23384816 CTGTGGATTTGAGGGCCTGATGG - Intronic
1115668237 14:35578041-35578063 AGGTGGATATGGAGGAGGGAAGG - Intronic
1117102933 14:52369102-52369124 ATGTGGATGTGAAAGACTGAGGG + Intergenic
1119076636 14:71646695-71646717 CTGTTCATATGAAGCACTGAGGG - Intronic
1119150176 14:72351901-72351923 CTGGGTATAGGGAGGTCTGAAGG - Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1121045129 14:90782185-90782207 CAGTGGACAAGCAGGACTGATGG + Intronic
1121851105 14:97221807-97221829 CTATGAATATGGAGGAGCGATGG + Intergenic
1122440715 14:101730020-101730042 CAGTGGTTATGGATGAGTGATGG + Intergenic
1123020517 14:105395834-105395856 CTGGGGAGAAGCAGGACTGAGGG - Exonic
1126114902 15:45199471-45199493 CTCTGCATAGGGAGGATTGATGG - Intronic
1128469685 15:67941744-67941766 CTGTGGATATGGAGTGGTCAGGG + Intergenic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1139791192 16:69436876-69436898 CTATGGAAATAGGGGACTGATGG - Intronic
1140046653 16:71443936-71443958 CTGTGGATGTGGGGGTCTGTGGG + Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1142016372 16:87750320-87750342 CTGTGGAGATGCAGCACTGAGGG - Intronic
1142575444 17:903967-903989 CTGTGGACAAGGAGGAGTTAAGG + Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1144341173 17:14311449-14311471 CTGTGCATGTGTAGGACTGATGG - Intronic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1146307473 17:31741633-31741655 CTTTGGATATGGAGGGCTCTGGG + Intergenic
1146558674 17:33849400-33849422 CTGTGGAGACTGAGGAATGAGGG + Intronic
1148814553 17:50318122-50318144 CTGGGGATGTGCAGGAATGATGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1153371331 18:4319859-4319881 ATGTGTATATGAAGGAATGAGGG - Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1158763983 18:60425491-60425513 CTGGAAATATGGAGGACAGAAGG + Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159368757 18:67504803-67504825 CTTTGGATCTGGAGGTCTCAGGG + Intergenic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161645897 19:5453241-5453263 CTGAGGATATGGTGGATGGAAGG + Intergenic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1167419726 19:49395705-49395727 CTGTGGCTGGTGAGGACTGAGGG + Intronic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
927489193 2:23509431-23509453 CTGTGGATCTGGGAGAGTGAGGG + Intronic
927622098 2:24672037-24672059 CCATGGATGTGGAGGACTAATGG + Intronic
929038017 2:37713455-37713477 CTGTGGATATGCTGGACAAAGGG + Intronic
935156090 2:100484867-100484889 TTGTTGTTATTGAGGACTGAGGG + Intergenic
935989241 2:108704714-108704736 CTGGGGATATGGGGGACAGGTGG - Intergenic
938312623 2:130302796-130302818 CTGGGGATCTGGAGCACTGCAGG + Intergenic
938677734 2:133655825-133655847 CTGAGCAGATGGAGGTCTGAAGG + Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
947210531 2:227704491-227704513 ATGGGGAAATGGAGGACTAAAGG + Intronic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1172137591 20:32697661-32697683 CAGTGGAGATGGAGCACTGGAGG + Intergenic
1174110536 20:48195006-48195028 CAGTGGGTATGAAGGACGGAGGG - Intergenic
1174339587 20:49887488-49887510 CTGAGGAGATGGAGGCCTAAGGG + Intronic
1175101216 20:56580112-56580134 CTGTAGAAATGGAGGAGGGAAGG + Intergenic
1175509241 20:59511206-59511228 CAGTGGACTTGGAGGACTCAGGG - Intergenic
1175878232 20:62240891-62240913 GTGTGAAGAGGGAGGACTGAGGG + Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181638886 22:24186722-24186744 CAGTGGCTTTTGAGGACTGAGGG - Intronic
949769093 3:7559261-7559283 GTGTGCATGTTGAGGACTGAAGG + Intronic
953486499 3:43302574-43302596 CTGGGGATATTGAGGAGAGAAGG + Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
960519939 3:118643101-118643123 CTGTAGGCATGGAGGTCTGAGGG - Intergenic
961106076 3:124242761-124242783 CTGTGGATATGCAGGACAACAGG + Intronic
961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG + Exonic
961618435 3:128203549-128203571 CTGAGGAGATGGAGGTCTGTAGG + Intronic
964193265 3:154031213-154031235 ATGGGGATTTGGAGGACTGGTGG + Intergenic
964731566 3:159872315-159872337 CTTTGGTTCAGGAGGACTGAAGG + Intronic
967684235 3:192400741-192400763 TTGTGGAGATGGAGGAATGCTGG - Intronic
968869517 4:3234565-3234587 CTGTGGGCATGGAGGACTCAGGG + Intronic
970143019 4:13003215-13003237 CTTTGGAGATGGAGGAATGAAGG - Intergenic
970647730 4:18142051-18142073 CTGTCAATAGGGAGCACTGAAGG + Intergenic
971498371 4:27292071-27292093 GTGTGGATTTGGAAGACTCAGGG + Intergenic
971561525 4:28084457-28084479 CTGTGGATATGAAGAAGTCAAGG - Intergenic
974839044 4:67281073-67281095 CTCTGGAGTTGGAAGACTGATGG + Intergenic
978345797 4:107767845-107767867 CTTTAAATAAGGAGGACTGATGG - Intergenic
978445471 4:108776149-108776171 CTCTGGAGATGGAGGGCTCAAGG + Intergenic
979834951 4:125354681-125354703 GTGTGGAAATGGAAGAATGAAGG + Intronic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
981943372 4:150311540-150311562 CTGGGGACACAGAGGACTGATGG + Intronic
983085165 4:163434308-163434330 CCATGGATATGGAAGGCTGATGG - Intergenic
983464734 4:168073261-168073283 CAGTGAATAGGGAGGCCTGAGGG + Intergenic
988324577 5:29746201-29746223 CTGTGGACATGGACTGCTGATGG - Intergenic
988617505 5:32789606-32789628 CTGTGAATAGGGAGAAGTGAGGG - Exonic
992407031 5:76469306-76469328 CTGTGTATTAGGAGGACTTAAGG + Intronic
993604693 5:89974569-89974591 CTGTGGAAATGGACTACTAAAGG - Intergenic
995547748 5:113249804-113249826 CAGTGGATAAGGGGGCCTGAAGG - Intronic
998435626 5:142106005-142106027 ATGTGGATATGAAAGACAGAAGG + Intergenic
999675553 5:153998199-153998221 CTGTGGATATGCTGGACAAAGGG - Intronic
999943471 5:156569743-156569765 AGGTGGATATGGAGGACAGAGGG + Intronic
1000267527 5:159652066-159652088 CTGTGGATATGCAGAACTGGGGG - Intergenic
1000376180 5:160584192-160584214 CTGTGGATTGGGAAGACTGTGGG + Intronic
1004406538 6:15338476-15338498 CTGTAGACATTGAGGACAGATGG + Intronic
1005361529 6:25035786-25035808 TTGTGCAGATGGAGGACTGTGGG + Intronic
1006311471 6:33264204-33264226 CTGTGGGTAGGAGGGACTGAAGG - Intronic
1006516154 6:34546813-34546835 CTGGGGATGTGGGGGACAGAGGG + Intronic
1006634174 6:35450422-35450444 CTGGGGACATGGAGGAATGGGGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1008302070 6:49853504-49853526 GTGAGGATAAAGAGGACTGAAGG - Intronic
1008888232 6:56454631-56454653 CTTTTGATATGAAGGACTGGAGG - Intergenic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010453083 6:76025649-76025671 CTCTGGATATGCAGGCTTGAGGG - Intronic
1011310170 6:85972728-85972750 CTGTTGAGAGGGAGGACTGAGGG - Intergenic
1013451341 6:110284599-110284621 CTGTGAATATGAAGAAGTGAAGG + Intronic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015499286 6:133915285-133915307 TTGTGGATATGGAGGGCTGGTGG - Intergenic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016811326 6:148263841-148263863 TGGTGGAAATGGAAGACTGAGGG + Intergenic
1017329432 6:153178353-153178375 CTATGGAAATGAAGGGCTGATGG - Intergenic
1017628369 6:156370976-156370998 CTATGGATACAGAGGGCTGATGG - Intergenic
1018038641 6:159902987-159903009 CTGTGGAAAAGAAGGGCTGAGGG - Intergenic
1021267070 7:18537929-18537951 CTGAGGTTATGAAGGACTGAAGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022757386 7:33307830-33307852 CTATGAATATAGAGGGCTGATGG + Intronic
1024145603 7:46513535-46513557 GTGAGGATGTGGAGGAATGAGGG - Intergenic
1024855924 7:53779151-53779173 CTGTGGAAATGGGGGACAGTGGG - Intergenic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1030627534 7:111860194-111860216 CTGTGGACTTAGGGGACTGATGG - Intronic
1031349838 7:120717315-120717337 GTGTGGATACGCAGGACAGAAGG + Intronic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1034955927 7:155334743-155334765 CTGAGGACAATGAGGACTGAGGG - Intergenic
1035881148 8:3245220-3245242 CTGTGGACAGGGAGGACTCAAGG - Intronic
1035982472 8:4388530-4388552 CAGTGGATTTTGGGGACTGAGGG + Intronic
1037607991 8:20453633-20453655 CTGTGGATCAGGAGCACTGGCGG - Intergenic
1039596315 8:38792913-38792935 GTGTGTTTATGGAGGACTTAGGG + Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1041521536 8:58762207-58762229 ATGTAAATAAGGAGGACTGACGG - Intergenic
1042144831 8:65716884-65716906 GTGTGGGTATAGAGGTCTGAGGG - Intronic
1042381458 8:68119026-68119048 ATGTGGATGTTGAGGATTGAGGG + Intronic
1046291442 8:112167236-112167258 CTATGGATATGGGGCTCTGAGGG + Intergenic
1048300415 8:133247370-133247392 CTGGGGAGATGGAAGACTTAGGG - Intronic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1050102050 9:2129510-2129532 CTGATGAGCTGGAGGACTGATGG - Intronic
1051392584 9:16581842-16581864 CTGTGGGCATGAAGGACTGCAGG + Intronic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1052692522 9:31833537-31833559 CTGTGGATATGGATAAATGGAGG - Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054772950 9:69100088-69100110 CTGTGGATATGTATCAGTGAAGG + Intronic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1056254672 9:84786791-84786813 CTGTGGACATGTAAGAGTGAAGG + Intronic
1057312304 9:93950035-93950057 CTGTGGAAAGGGAGGCCTGAGGG - Intergenic
1060733237 9:126050786-126050808 GTGTGGAGATGGAGGACGGCGGG + Intergenic
1185506889 X:638448-638470 CAGTGGAGGTGGAGGTCTGAAGG + Intronic
1186340625 X:8642340-8642362 TAGTGGATATGTAGGACTGAAGG + Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1193423302 X:81310290-81310312 CAGTGGATTTTGAGGACTCAGGG - Intergenic
1196109168 X:111927574-111927596 CCGGGGCTGTGGAGGACTGAAGG + Intronic
1196305935 X:114103271-114103293 GTGTGGCTATGAAGCACTGATGG + Intergenic
1197739191 X:129876313-129876335 CTGTGGATATCCAGGCTTGAGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198720551 X:139614155-139614177 CTCTGGATATGGATGGCTCAGGG - Intronic
1202124620 Y:21557074-21557096 CTGTGGATAGAGGGGACTGCAGG + Intergenic
1202154388 Y:21872306-21872328 CTGTGGATAGAGGGGACTGCAGG - Intergenic