ID: 1168375929

View in Genome Browser
Species Human (GRCh38)
Location 19:55879235-55879257
Sequence TCCTTGGATCTCTGCGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168375929_1168375932 21 Left 1168375929 19:55879235-55879257 CCAAGGACGCAGAGATCCAAGGA 0: 1
1: 0
2: 0
3: 18
4: 261
Right 1168375932 19:55879279-55879301 GTTAAGAGCAGAAGTTTAATAGG 0: 14
1: 51
2: 135
3: 333
4: 984
1168375929_1168375931 -1 Left 1168375929 19:55879235-55879257 CCAAGGACGCAGAGATCCAAGGA 0: 1
1: 0
2: 0
3: 18
4: 261
Right 1168375931 19:55879257-55879279 ACGCAGATACACAAAGAGTGAGG 0: 1
1: 3
2: 21
3: 55
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168375929 Original CRISPR TCCTTGGATCTCTGCGTCCT TGG (reversed) Intronic
900530143 1:3149049-3149071 TCCTTGGTTCTCTGCCTCTGTGG + Intronic
903275389 1:22218212-22218234 TCCTTGGTGCTCAGCTTCCTGGG + Intergenic
904317310 1:29673796-29673818 TCCTGGGATCTCTGCTCCCCTGG + Intergenic
904358289 1:29955619-29955641 TCATTGGATCTCGGAGTCTTCGG - Intergenic
904621727 1:31779475-31779497 TACTTCAATCTCTGCCTCCTGGG + Intergenic
904692861 1:32307733-32307755 TCTTTGGAACTTTGAGTCCTGGG + Intronic
906918897 1:50042096-50042118 TCCTTCTATCTCTGCCTTCTGGG - Intergenic
907383869 1:54113075-54113097 TCCTTGTGCCTCTACGTCCTTGG + Intergenic
907505939 1:54918313-54918335 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
907602823 1:55787712-55787734 TCCTGTGATCCCTGCCTCCTAGG - Intergenic
909151657 1:72013328-72013350 TCCTTGCATGTCTGCTTTCTAGG + Intronic
910590630 1:88925390-88925412 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
911513069 1:98831697-98831719 TGCTTGAATTTCTGCCTCCTGGG + Intergenic
911623950 1:100099482-100099504 TCCTGGGCTCCCTGGGTCCTAGG - Intronic
912746490 1:112249561-112249583 TCCTTGGATCTCTGAGCATTTGG + Intergenic
914218817 1:145658851-145658873 CACTTCGATCTCTGCCTCCTGGG + Intronic
915527167 1:156483051-156483073 CTCTTGGAGCTCTGCGTCCCTGG - Intronic
915891689 1:159779692-159779714 GGCTTGGATCACTGTGTCCTTGG + Intergenic
916452513 1:164934556-164934578 TCCTTGCATCTCTACATTCTGGG + Intergenic
920425947 1:205875321-205875343 TCCTCCGATCCCTGCCTCCTAGG - Intergenic
920658356 1:207893346-207893368 TCCTAGAATCTCAGCGTTCTAGG - Intronic
922484496 1:225962693-225962715 TCCTTTGACCTCTCTGTCCTCGG - Intergenic
1063939182 10:11109379-11109401 TCCTTGCATCACTGCTTTCTTGG - Intronic
1064969231 10:21047329-21047351 TCCTGGGAGCTCTGTGCCCTAGG + Intronic
1065216333 10:23452352-23452374 TCCTTGGCTCTCTTGGTTCTAGG - Intergenic
1065502051 10:26392144-26392166 TACCTGGGTCTCTGCTTCCTGGG - Intergenic
1068116290 10:52740720-52740742 TCTCTGGATCTCAGGGTCCTGGG - Intergenic
1071682208 10:87717668-87717690 TCCTTCCACCTCTGCCTCCTGGG + Intronic
1072026064 10:91458558-91458580 TCCTTGTATCTCTTCCTCCATGG - Intronic
1072378420 10:94840528-94840550 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1073123289 10:101134696-101134718 TCCAGGGATCTGTGAGTCCTGGG + Intronic
1073177580 10:101565757-101565779 TCCTTGTATCTGAGAGTCCTGGG + Intergenic
1074603394 10:114937000-114937022 TCCCTGGCTCTCTGCTTCCATGG + Intergenic
1076896767 10:133316997-133317019 TCTTTCCATCTCTGTGTCCTGGG - Intronic
1076896800 10:133317130-133317152 TCTTTCCATCTCTGTGTCCTTGG - Intronic
1076896817 10:133317195-133317217 TCTTTCCATCTCTGTGTCCTGGG - Intronic
1076896858 10:133317331-133317353 TCTTTCCATCTCTGTGTCCTGGG - Intronic
1076896871 10:133317369-133317391 TCTTTCCATCTCTGTGTCCTGGG - Intronic
1076896880 10:133317401-133317423 TCTTTCCATCTCTGTGTCCTGGG - Intronic
1076896891 10:133317439-133317461 TCTTTCCATCTCTGTGTCCTGGG - Intronic
1076896902 10:133317477-133317499 TCTTTCCATCTCTGTGTCCTGGG - Intronic
1076897171 10:133318422-133318444 TCTTTCCATCTCTGTGTCCTCGG - Intronic
1076897194 10:133318500-133318522 TCTTTCCATCTCTGCGTCCGGGG - Intronic
1077058748 11:608580-608602 GCCTTGGACCGCTGCCTCCTGGG - Exonic
1077060991 11:617801-617823 TCCCTGGGTCTCTGCAGCCTTGG + Intronic
1077212937 11:1381906-1381928 TCCTTGGGTGTCTGGCTCCTGGG + Intergenic
1079290694 11:19185307-19185329 TCCTTGGATCTTTTTGGCCTGGG - Intronic
1079501778 11:21108785-21108807 TCCGTGCATCACTGCTTCCTTGG - Intronic
1079601604 11:22317109-22317131 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1079919931 11:26420427-26420449 TCCTTAGATATCTGCTTCCTGGG - Intronic
1079934096 11:26596667-26596689 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1083204239 11:61138496-61138518 TCCTGGGGTATCTGGGTCCTGGG + Intronic
1084114143 11:67031963-67031985 TCCATGGATCTCTTTGTCATGGG + Intronic
1085274674 11:75290656-75290678 TGCTTCAATCTCTGCCTCCTGGG + Intronic
1086955299 11:92929403-92929425 TCTTTGGATCTCAGTCTCCTTGG - Intergenic
1088895215 11:114073234-114073256 TCCTTGGATCCATGCGGCCTGGG - Intronic
1090276983 11:125427182-125427204 TCCTTGCCTCTCTGCCCCCTGGG + Intronic
1090799545 11:130161682-130161704 TCATTTGCTCTCTGCGCCCTTGG + Intronic
1092293767 12:7182115-7182137 GCCTTTGATCCCTGCCTCCTAGG + Intergenic
1092469789 12:8767478-8767500 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1095212457 12:39509944-39509966 TCCTTGGCTCTCTTTGTCCCAGG - Intergenic
1095749907 12:45698348-45698370 TTTTTGGATCTCTGCCTACTGGG + Intergenic
1096352411 12:50911354-50911376 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1097377620 12:58858550-58858572 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1097807321 12:63980158-63980180 TCCTTGCACCTCAGCCTCCTGGG + Intronic
1098035314 12:66295717-66295739 TACTGCGATCTCTGCCTCCTGGG + Intergenic
1102529660 12:113536858-113536880 TCCTTGCATCCCTGCAGCCTTGG - Intergenic
1103401205 12:120644127-120644149 ACTTTCGATCTCTGTGTCCTTGG + Intronic
1104364722 12:128166480-128166502 TCCTTAGATCTCAGAGGCCTTGG - Intergenic
1104939021 12:132386262-132386284 GTCTTTGATCTCTGCGTTCTGGG - Intergenic
1108876345 13:55054892-55054914 TCCTCTGATCCTTGCGTCCTAGG + Intergenic
1109265298 13:60191969-60191991 TTCTTTCATCTCTGTGTCCTAGG + Intergenic
1113011564 13:105773428-105773450 TCCTTTGATCTCAGTGTGCTTGG + Intergenic
1114383989 14:22237571-22237593 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
1115643428 14:35350212-35350234 TCCTTGGGGCCCTGCCTCCTGGG + Intergenic
1116117336 14:40671742-40671764 TCCTTGAGTCTCTGTGTCTTTGG - Intergenic
1118216832 14:63816822-63816844 TCCTCGTGTCTCAGCGTCCTGGG + Intergenic
1118736236 14:68703578-68703600 GCCTTGTATCTCTGCTTCCTGGG + Intronic
1119033331 14:71209722-71209744 TCCTTGGATTTTGGTGTCCTGGG + Intergenic
1120916949 14:89718931-89718953 TCTTTAGATCTCTGCATCCTAGG + Intergenic
1122379284 14:101290061-101290083 TCGTTCCATCTCTGCGCCCTGGG - Intergenic
1122745319 14:103894288-103894310 TACTTGGCTCCCTGCCTCCTTGG + Intergenic
1123634887 15:22294433-22294455 TCATTGCACCTCTGCCTCCTGGG + Intergenic
1125731340 15:41894218-41894240 TCCATGGGCCTCTGCGTCCTGGG - Intergenic
1127031307 15:54866720-54866742 TCCTTCGATCTCAGCGTCTAGGG - Intergenic
1127839815 15:62821384-62821406 TCCTAGTATATCTGGGTCCTTGG - Intronic
1127910026 15:63409153-63409175 TCCTTGGATATCAGTGTTCTTGG - Intergenic
1128302615 15:66576146-66576168 TCACTGCATCTCTGCCTCCTGGG + Intergenic
1128362960 15:66975634-66975656 TCCTCCGATCCCTGCCTCCTGGG - Intergenic
1129103680 15:73290026-73290048 TCCTTCCATCTCAGCCTCCTGGG - Intronic
1129235311 15:74220206-74220228 TCCCTGGGTCCCTGCGTCCTTGG - Intergenic
1130102947 15:80907484-80907506 TCCCTGAACCTCTGCCTCCTGGG - Intronic
1130129546 15:81127697-81127719 TCCTTTGAGCTCTGCTTCCATGG - Intronic
1131420264 15:92299134-92299156 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
1132211293 15:100024555-100024577 TGCTTGGATCTCTCCGTGATGGG + Intronic
1132790501 16:1683917-1683939 TCCTTGGATTTTGGCATCCTGGG - Intronic
1133499236 16:6349842-6349864 TCCTTGGACCTCTGAATTCTTGG - Intronic
1134268115 16:12709162-12709184 TCATTGAAGCTCTGTGTCCTTGG - Intronic
1137660932 16:50205664-50205686 TGCTGTGATCTCTGCCTCCTGGG + Intronic
1138300862 16:55928883-55928905 ACCTGGGACCTCTGAGTCCTGGG - Intronic
1142320034 16:89375896-89375918 TCCTGGGAGCTCTGCTTCTTGGG - Intronic
1142654777 17:1384266-1384288 TCCTCCCACCTCTGCGTCCTGGG - Intronic
1143613464 17:8034774-8034796 CACTGGAATCTCTGCGTCCTGGG + Intergenic
1144032560 17:11335573-11335595 TCCATGGATCTCTTTTTCCTTGG + Intronic
1144808259 17:17981770-17981792 TCACTGCATCTCTGCCTCCTGGG + Intronic
1144948166 17:18980397-18980419 TCCTTGGGTCTCAGCTCCCTTGG - Intronic
1145946174 17:28776299-28776321 TCATTGCAACTCTGCTTCCTGGG - Intronic
1146662729 17:34675322-34675344 TCCTGGGATCCCTGCCTCCCTGG - Intergenic
1147678133 17:42221210-42221232 ACCTTGGATCTGTCCGTCCCTGG - Intronic
1148827457 17:50404487-50404509 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1149274417 17:55017509-55017531 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1149609939 17:57952922-57952944 TTCTTGGCTCACTGGGTCCTGGG - Intronic
1152925812 17:83087311-83087333 TCCCTGCATGTCTGCTTCCTCGG - Intronic
1153400908 18:4682891-4682913 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
1154190436 18:12226446-12226468 TCCTGGGAACTCTGCCTCCCGGG + Intergenic
1156626300 18:38913775-38913797 TCCTTGGAACTCTGCCTAATGGG - Intergenic
1157121737 18:44917753-44917775 GCCCTGGAGCTCTGTGTCCTTGG + Intronic
1157599759 18:48886758-48886780 TCCTTAGATCTCAGCGGTCTAGG - Intergenic
1158454049 18:57591250-57591272 TCCAGGGTTCTCTGCTTCCTGGG + Intergenic
1158544676 18:58386013-58386035 TCCCTGGATCACTGCTGCCTGGG + Intronic
1158937550 18:62378515-62378537 TTCATGAATCTCTGTGTCCTTGG + Intronic
1161812595 19:6479210-6479232 TCCCTGAATCTCTGGGTCCCTGG + Intronic
1161812643 19:6479409-6479431 TCCTTGAGTCTCTGAGTCCCTGG + Intronic
1162044240 19:7988124-7988146 TCCTTGGCTCTCATCCTCCTGGG - Intronic
1164057025 19:21630351-21630373 TCCTCTGATCTCTGCCTCCTAGG + Intergenic
1164173304 19:22746362-22746384 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
1164921816 19:32093959-32093981 TCCTTGGATCCCTGGGTGGTAGG + Intergenic
1165018489 19:32902670-32902692 CTCTTGGATCTCTGGCTCCTGGG - Intronic
1167376481 19:49114782-49114804 TCCTTGCTTCTCTGCGTCTCGGG + Intronic
1168375926 19:55879219-55879241 TCCTTGGATCTCCACGGCCCTGG - Intronic
1168375929 19:55879235-55879257 TCCTTGGATCTCTGCGTCCTTGG - Intronic
1168375930 19:55879251-55879273 TCTTTGTGTATCTGCGTCCTTGG - Intronic
1168537806 19:57185965-57185987 TACTTCAATCTCTGCCTCCTGGG + Intergenic
926864128 2:17340159-17340181 TCCTCTGATCCCTGCCTCCTGGG + Intergenic
927493840 2:23539164-23539186 ACCCTGGATCCCTGAGTCCTGGG + Intronic
928339409 2:30428765-30428787 TTCCTGAATCTCTGCGTGCTGGG + Intergenic
928476163 2:31629843-31629865 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
930631282 2:53757560-53757582 TCCTCCGATCCCTGCCTCCTAGG + Intronic
932917324 2:75872923-75872945 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
934672289 2:96222332-96222354 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
936840026 2:116757934-116757956 TCCTTGCATCCCTGAGTCCTGGG - Intergenic
939115195 2:138052824-138052846 TCCTTTGATCCCTGTGTCCTTGG + Intergenic
939826135 2:147017593-147017615 TCCTTGAATTTCTGGGGCCTAGG - Intergenic
940235532 2:151507515-151507537 TCCTAGTATCTCTGTGTCTTTGG - Intronic
941748609 2:169112442-169112464 TCTTGGCATCTCTGGGTCCTTGG - Intergenic
945142260 2:206699323-206699345 TCCTTGCAGCTCAGCCTCCTGGG - Intronic
946229510 2:218282745-218282767 TCCCTGGATCCCTTCCTCCTCGG - Intronic
946829186 2:223710850-223710872 TCCTTGGATCTAAGCTTCTTGGG - Intergenic
1169227679 20:3866359-3866381 TCCTTGGCTTTCTGGGTCCTGGG + Exonic
1171970740 20:31563397-31563419 TCATTGGAGCTCCGCCTCCTGGG + Intronic
1172234169 20:33358681-33358703 TCCTTCAGTCTCTGCCTCCTAGG + Intergenic
1172988144 20:39009688-39009710 TCTTGGGATCTCTGTGTCTTAGG + Intronic
1174363853 20:50044408-50044430 TCCTTGGATTTCTCCATTCTGGG + Intergenic
1174590333 20:51640008-51640030 TCACTGCATCTCTGCCTCCTGGG - Intronic
1176142184 20:63549656-63549678 TCCCTGGGGCTCTGCGGCCTTGG - Intronic
1176724024 21:10414964-10414986 TGCTTGAACCTCTGCCTCCTGGG + Intergenic
1177263834 21:18759319-18759341 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1179259463 21:39745417-39745439 TCCTCTGATCCCTGCCTCCTAGG - Exonic
1179498585 21:41791322-41791344 TCCATTGTTCTCTGTGTCCTTGG + Intergenic
1181852052 22:25756374-25756396 TCCTTGGATTTTTGGATCCTGGG + Intronic
1181905239 22:26189708-26189730 TCCGTGGATCTTGGCATCCTGGG + Intronic
1182295609 22:29309931-29309953 TTCTTGGCTCTCTGGGTCCAGGG - Intronic
1182714697 22:32348278-32348300 GCCTTGGCTCTCTGGGTCTTTGG - Intergenic
1184246750 22:43239705-43239727 CCCTTGGGTCTCTGCCACCTGGG + Intronic
1184592855 22:45496796-45496818 CCCTTTGATCCCTGGGTCCTGGG - Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950610796 3:14125410-14125432 TCCTTGGCTCGCCTCGTCCTCGG + Intronic
950992997 3:17461577-17461599 GCCCTTGATCTCTGCCTCCTTGG - Intronic
951201036 3:19875639-19875661 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
952922555 3:38296057-38296079 TCCTCCGATCCCTGCCTCCTAGG - Intronic
953373210 3:42407220-42407242 TCCGTGGTTCTCTCCCTCCTTGG - Exonic
953669123 3:44947922-44947944 TCCTGGGAACTCTGCCTGCTTGG + Intronic
953973096 3:47362223-47362245 ACCTCGGATCACTGCGACCTCGG - Intergenic
954364832 3:50140190-50140212 TCCGTGCAGCTCTGCTTCCTGGG + Intergenic
958016599 3:87945373-87945395 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
959297136 3:104550735-104550757 TCCTAGGATATTTGAGTCCTTGG - Intergenic
960138555 3:114129980-114130002 TTCTGGGTTCTCTGCCTCCTGGG - Intronic
961098519 3:124177887-124177909 TCCATGGATCTCTGGGTAATAGG + Intronic
961769094 3:129235492-129235514 TCCAGTGATCTCTGCCTCCTGGG + Intergenic
963915461 3:150855242-150855264 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
964799416 3:160538522-160538544 TCCTTGGACCTTTCCTTCCTTGG - Intronic
967106284 3:186257287-186257309 TACCTGGATCTGTGGGTCCTCGG - Intronic
967623257 3:191659776-191659798 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
968391480 4:196471-196493 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
969644807 4:8421596-8421618 TCCTCTGATCCCTGCCTCCTAGG + Intronic
969685892 4:8674051-8674073 TCCTTGGATTTGAGTGTCCTTGG + Intergenic
970756561 4:19434158-19434180 TTCTTGGATCTCTGAGTTTTCGG + Intergenic
976831697 4:89322292-89322314 TCCTTTCATCTCAGCCTCCTGGG - Intergenic
977607362 4:98996033-98996055 TCCTGGGGTCCCTGGGTCCTCGG + Intronic
978909172 4:114045369-114045391 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
979703232 4:123690965-123690987 TCCTAGGATCTCTGAGTTTTGGG + Intergenic
983646036 4:169992338-169992360 TCATGGGAGCTCTGTGTCCTTGG - Intronic
983667294 4:170196106-170196128 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
984653590 4:182293997-182294019 TCCTGCGCTCCCTGCGTCCTAGG + Intronic
987686887 5:21216418-21216440 TCCAGTGATCTCTGCATCCTGGG + Intergenic
988740400 5:34063807-34063829 TCCTCCGATCCCTGCCTCCTAGG - Intronic
989024450 5:37050386-37050408 TCCTGGGTTCTCTGCTTCCTGGG - Intronic
990176201 5:53110769-53110791 TCCTTGGAGCTCACAGTCCTGGG + Intergenic
990677519 5:58204348-58204370 TCATTGGAACTCTGCCTCTTGGG - Intergenic
990891963 5:60659751-60659773 TCCTTTGATCCCTGCCTTCTAGG + Intronic
990981538 5:61606611-61606633 TCCTTGGTTCTTTGTGTCCTTGG - Intergenic
991142455 5:63260489-63260511 CCCTTGTATCTCTGGGTCCCAGG - Intergenic
994181179 5:96768157-96768179 TACTGCGATCTCTGCTTCCTGGG + Intronic
995180553 5:109226754-109226776 TCCTTGGTTCTCTGTCTCCCAGG - Intergenic
995465311 5:112444923-112444945 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
996030560 5:118699807-118699829 TCCTTGGGTCCTTGGGTCCTTGG - Intergenic
997448080 5:133957285-133957307 TACTGTGATCTCTGCCTCCTGGG - Intronic
998396538 5:141822228-141822250 TCCTGGGAGCTCTGGGGCCTTGG + Intergenic
1001291930 5:170469792-170469814 TCCATTGATCTCTCTGTCCTTGG + Intronic
1002277281 5:178112363-178112385 TCATTGCAACTCTGCCTCCTGGG + Intergenic
1004088543 6:12475310-12475332 TCATTGCAACTCTGCCTCCTAGG - Intergenic
1004236496 6:13879307-13879329 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
1004785360 6:18962307-18962329 TCCTTTGCTCTCTGCATCCTTGG - Intergenic
1005323991 6:24681806-24681828 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1008582632 6:52920669-52920691 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1008681040 6:53872821-53872843 TTCTTGGATCACTGCAACCTTGG + Intronic
1009544465 6:65005953-65005975 TCCTCTGATCCCTGCCTCCTAGG + Intronic
1010799096 6:80153227-80153249 TCTTTGGATGTGTGCCTCCTTGG + Intronic
1010893173 6:81338218-81338240 TCCTCTGATTTCTGCCTCCTGGG + Intergenic
1011076531 6:83444729-83444751 TCCTCTGATCCCTGCCTCCTAGG + Intergenic
1011109809 6:83824732-83824754 TCCTATGATCTCTGCCTCCCAGG + Intergenic
1011312587 6:85996701-85996723 TTCTAGAATCTCTGAGTCCTGGG + Intergenic
1011540236 6:88420491-88420513 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1012201076 6:96406713-96406735 TACTTGGATCTTTGCATGCTTGG + Intergenic
1012383506 6:98649439-98649461 ACCTTGGATCTCTGGATCCTTGG + Intergenic
1013021906 6:106229121-106229143 TCCTCTGATCCCTGCCTCCTAGG + Intronic
1013480311 6:110547205-110547227 TACTGCGATCTCTGCCTCCTGGG - Intergenic
1013631251 6:111988177-111988199 TCTTTGTGTGTCTGCGTCCTTGG + Intergenic
1013981111 6:116130569-116130591 TGCCTGGATGTCTGGGTCCTAGG + Intronic
1016343520 6:143086717-143086739 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1017541228 6:155405142-155405164 TCCTTGCATTTCTGCCTCGTGGG - Intronic
1017773700 6:157663333-157663355 CACTAGGAGCTCTGCGTCCTGGG - Intronic
1018760712 6:166892129-166892151 TCCTCTGATCCCTGCCTCCTAGG + Intronic
1019487489 7:1296065-1296087 TCCTTGGCTCTCTGCTGCCCCGG + Intergenic
1022254984 7:28647126-28647148 TACTCTGATCTCTGCGTCTTTGG - Intronic
1023439643 7:40172515-40172537 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1026239069 7:68556107-68556129 TCCTGAGATCCCTGGGTCCTTGG + Intergenic
1026635366 7:72077347-72077369 CACTTGAATCTCTGCCTCCTGGG + Intronic
1026830943 7:73609745-73609767 TACTTCGATCTCCGCCTCCTGGG + Intronic
1027636014 7:80675464-80675486 TCCTTGGATGTCAGATTCCTTGG + Intronic
1028588941 7:92476932-92476954 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1029318733 7:99738298-99738320 TCCTTGCATCACTGAGTCCCTGG - Intergenic
1029415771 7:100442270-100442292 TCCCTGGATCTCTTCCTTCTGGG - Intergenic
1030336970 7:108338301-108338323 TCCTCTGATCCCTGCCTCCTAGG + Intronic
1030843848 7:114385292-114385314 TCCTCTGATCCCTGCCTCCTAGG - Intronic
1031908201 7:127485112-127485134 TCCTTGGTTCTTGGCGTGCTCGG - Intergenic
1032581097 7:133104164-133104186 TCCCTCAATCTCTGCCTCCTGGG - Intergenic
1032725476 7:134586668-134586690 TCCTCCGATCCCTGCCTCCTAGG + Intergenic
1035747448 8:1972587-1972609 CACTGCGATCTCTGCGTCCTGGG - Intergenic
1036077810 8:5520916-5520938 ACCTTGGATCCCTGAGTCCAGGG - Intergenic
1038345108 8:26725412-26725434 TCCCTGGCTCTCCGAGTCCTGGG + Intergenic
1040733871 8:50482680-50482702 TCCTTGCATCTATGTGTCCTCGG - Intronic
1040943717 8:52858943-52858965 TCCATGGCTCTCTGCTTCCATGG + Intergenic
1042055798 8:64763926-64763948 TCCTCCGATCCCTGCCTCCTAGG + Intronic
1043278523 8:78432910-78432932 TCACTGGAACTCTGCCTCCTGGG - Intergenic
1043617003 8:82138110-82138132 TCATTGCAACTCTGCTTCCTGGG - Intergenic
1044241411 8:89892823-89892845 TCTTTGGAGCTCTGCTGCCTGGG - Intergenic
1044942366 8:97356402-97356424 TTTTTGGAGCTCTGCTTCCTGGG - Intergenic
1048385959 8:133912735-133912757 GCCTTGGCTGTCTGCCTCCTGGG - Intergenic
1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG + Intronic
1049213971 8:141399309-141399331 TCCTTTAATCTCCCCGTCCTGGG + Intronic
1049926137 9:409241-409263 CCCTTGGATCTCTGACACCTGGG + Intronic
1056855969 9:90129952-90129974 TCCATGGATCTCTGTTTCGTGGG - Intergenic
1057054922 9:91952862-91952884 TCCTGGGATATCTGAGACCTGGG + Intergenic
1057469903 9:95348328-95348350 TCCCTGCACCTCTGCCTCCTGGG - Intergenic
1057776384 9:98013779-98013801 TCACTGAATCTCTGCCTCCTGGG - Intronic
1059183912 9:112247124-112247146 TCCTTGTACCTCAGCCTCCTGGG - Intronic
1059183918 9:112247156-112247178 TCCTTGTACCTCAGCCTCCTGGG - Intronic
1060393671 9:123300606-123300628 GCCTTGGATCCCTGCCTCCCTGG - Intergenic
1060885965 9:127152546-127152568 GCCTTGGATCACTGTGTCTTGGG + Intronic
1061296779 9:129681193-129681215 TGCTTGGACCTCAGTGTCCTAGG - Intronic
1061759290 9:132839017-132839039 TCATTGCAACTCTGCCTCCTGGG + Intronic
1186124424 X:6397724-6397746 TCAAAGGATCTCTGAGTCCTGGG + Intergenic
1186254388 X:7703055-7703077 TCCTCTGATCCCTGCCTCCTAGG - Intergenic
1192773861 X:74221733-74221755 TCCTTCCACCTCTGCCTCCTGGG - Intergenic
1193306389 X:79956905-79956927 TCCTCTGATCTCTGTCTCCTAGG + Intergenic
1195584744 X:106552216-106552238 TCCTCGGATCCCTGCCTCCTAGG + Intergenic
1196146008 X:112317541-112317563 TCCCTGGAACTCTGCCTCCTGGG + Intergenic
1197013024 X:121590144-121590166 TCCATGGATATCTGTGTCATAGG + Intergenic
1200326718 X:155248318-155248340 TCCTTTTAACTCTGCCTCCTTGG + Intergenic