ID: 1168379076

View in Genome Browser
Species Human (GRCh38)
Location 19:55905113-55905135
Sequence CTGTGGAAGGTGCAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 605}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168379069_1168379076 15 Left 1168379069 19:55905075-55905097 CCTGACAGCTGGCTGCCGACAAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG 0: 1
1: 0
2: 4
3: 54
4: 605
1168379070_1168379076 0 Left 1168379070 19:55905090-55905112 CCGACAAGTTGCATTTCTCCAGG 0: 1
1: 0
2: 2
3: 23
4: 195
Right 1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG 0: 1
1: 0
2: 4
3: 54
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168379076 Original CRISPR CTGTGGAAGGTGCAGGTGCA AGG Intronic
900160651 1:1221872-1221894 CCCTGGAAGGTACAGCTGCAGGG + Intronic
900659953 1:3777305-3777327 CGGTGGCAGGTGGAGCTGCATGG + Intergenic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
900919424 1:5661342-5661364 ATGTGGCAGGTGCTGGTGCGTGG - Intergenic
901182063 1:7348508-7348530 CCTTGGAAGGTGCAGGAACATGG + Intronic
901238400 1:7679635-7679657 CTGTGTATCCTGCAGGTGCAGGG - Intronic
901774951 1:11554117-11554139 ATGTGGAAAGTACAGGTGCTAGG - Intergenic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902764765 1:18606898-18606920 AGGTGCCAGGTGCAGGTGCACGG - Intergenic
902826067 1:18975152-18975174 CTGCGGAAGGTGAAGCTACAGGG - Intergenic
903260871 1:22131339-22131361 TTGTTGAAGGTGGAGGTGCCTGG + Intronic
903506775 1:23841751-23841773 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
903772867 1:25775072-25775094 GTCTGGAAGGTGCAGGTGCCAGG + Intronic
904310588 1:29626938-29626960 CGGTAGAAAGTGCAGGAGCAGGG - Intergenic
904497096 1:30893150-30893172 GTGGGGAAGGTGCAGGGTCAGGG + Intronic
905132326 1:35770148-35770170 CTGGGGGAGCTGGAGGTGCACGG + Intergenic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905665609 1:39761399-39761421 TGGTGGAAGGTGGAGGAGCAGGG - Intronic
905849273 1:41261183-41261205 CTGTGGAAGGCTCACCTGCAAGG + Intergenic
906082301 1:43101355-43101377 CTGTGGCAGGTCCAGGTGCATGG + Intergenic
906253923 1:44332830-44332852 CTTTGGAAGGAGGAGGGGCAAGG + Intronic
906986313 1:50687070-50687092 CTTTGGAAGGCTCAGGTGGACGG - Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909922822 1:81402732-81402754 CTGTGGACAGTGCAGTTTCAAGG - Intronic
911090093 1:94011159-94011181 CTGTGGCAGGGGCTGGTGCTAGG - Intronic
911155040 1:94628526-94628548 CTGGGGTAGGGGCAGGGGCAGGG + Intergenic
913238463 1:116806030-116806052 TTTTGGAAGGTGCAAGTCCAGGG + Intergenic
913553877 1:119944290-119944312 CTTTGGGAGGTCCAGGTGGACGG + Intronic
913668031 1:121068428-121068450 CTTTGGAAGGCCCAGGTGAATGG + Intergenic
914019721 1:143855558-143855580 CTTTGGAAGGCCCAGGTGAATGG + Intergenic
914658273 1:149763774-149763796 CTTTGGAAGGCCCAGGTGAATGG + Intergenic
916624480 1:166540234-166540256 CTGTAGAAGGTGCAAGAGAAAGG + Intergenic
916998673 1:170330643-170330665 CTTTAGAAGGTGCAGTTTCATGG - Intergenic
917123640 1:171666300-171666322 CTGACCAAGGTGCAGGAGCAAGG - Intergenic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
917979280 1:180259424-180259446 CTGTGTCTGGTGGAGGTGCATGG + Intronic
918614230 1:186525987-186526009 CTGTGGGAGGAGCAGGGGAAGGG - Intergenic
919004329 1:191875442-191875464 CTGTGGAAGATGCAGCAACAAGG - Intergenic
920044531 1:203124822-203124844 GTGGGGAGGCTGCAGGTGCAAGG + Intronic
920295973 1:204956656-204956678 CTGTGCTAGGTGCTGGTGAAAGG - Intronic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
920851082 1:209628103-209628125 GTGTGCAAGGAGCATGTGCAGGG - Exonic
921263015 1:213400526-213400548 CTCTGGAAGGGGCAGGGACAGGG - Intergenic
921879776 1:220243017-220243039 ATGTTGAAGGTGCATGTGGAAGG - Intronic
921998875 1:221453625-221453647 CTTTGGGAGGTCGAGGTGCAGGG - Intergenic
922067010 1:222154146-222154168 CTGAGGACAGTGCAGGAGCACGG - Intergenic
922414059 1:225403973-225403995 CTGTGGGAGCTGGAGGTGCTTGG - Intronic
922824067 1:228505014-228505036 CTGTGGAAGCTGCAGGGTCGTGG - Intergenic
922844795 1:228676212-228676234 CTTTGGAAGGTCAAGGTGAAAGG - Intergenic
922976876 1:229792452-229792474 CTGAGGACAGTGCAGGTGAATGG + Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
924041831 1:239991661-239991683 CTGTAGATAGTGAAGGTGCAAGG + Intergenic
924064829 1:240210224-240210246 CTGTGGAATGTGTAGGTGGCAGG + Intronic
924175523 1:241387646-241387668 TTGGGCAAGGTGCAGGTGAAAGG - Intergenic
924732723 1:246726479-246726501 CTTTGGAAGGTCAAGGTGCAAGG - Intronic
1063042901 10:2360814-2360836 CTGTGGTAGGTGGAGGTGGGTGG + Intergenic
1063243614 10:4195537-4195559 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1063337399 10:5229176-5229198 CTGAGGCAGGTCCAGGTGAAGGG + Intergenic
1064203377 10:13302421-13302443 CTGGGGCGGGTGCAGGTGGAGGG + Intergenic
1064381239 10:14843484-14843506 CTGCGGTTGGTGCTGGTGCAGGG - Intronic
1064744136 10:18462496-18462518 CTTTGGGAGGTCCAGGTGGAAGG - Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1067061358 10:43079575-43079597 CTGTGGGAGGTTGAGGTGCAGGG - Intronic
1067707515 10:48620898-48620920 CTGAGGAAGGTGAAGCAGCAAGG - Intronic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069694197 10:70374763-70374785 CTGTAGAAAGTGCATTTGCAAGG + Intronic
1070108652 10:73461201-73461223 CTTTGGGAGGTCGAGGTGCATGG + Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070987360 10:80700258-80700280 GTGTGGCAGTTGCAGGTACAGGG + Intergenic
1071100040 10:82025939-82025961 ATGTGGATGGAGCAGGGGCAGGG - Intronic
1071260539 10:83915226-83915248 CTGTGGCAAGTGCAGGAGCCAGG + Intergenic
1072254981 10:93612921-93612943 CTGTGGACCGTGCAGGAGGAGGG + Exonic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1073058958 10:100721881-100721903 CTGTGGAAGGTGCAGGTATGGGG - Intergenic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1075464671 10:122642578-122642600 GTGTGGAACGTACAGCTGCATGG + Intronic
1075499562 10:122960512-122960534 CTGTGGAAGGCCCAGGTGGGTGG - Intronic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1076481865 10:130789922-130789944 GTGAGGAAGGTACAGGCGCAAGG + Intergenic
1077141297 11:1026073-1026095 CCGTAGAGGGTGCAGGTGGATGG + Exonic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077257038 11:1590281-1590303 CTGTGGAAGCTGGAGCTGCCTGG + Intergenic
1077262319 11:1629381-1629403 CTGTGGACCGTGAAGGTGTAGGG + Intergenic
1077509503 11:2949530-2949552 CTCTGGAAGGTGCATGTGACAGG + Intronic
1077918712 11:6627225-6627247 CAGTGGATGGTGCAGCTGCTGGG - Exonic
1078106755 11:8362748-8362770 CTGAGGAAGGGGCAGCTTCAGGG - Intergenic
1078356619 11:10636901-10636923 GTGTAGCTGGTGCAGGTGCATGG + Intronic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1079156678 11:17954442-17954464 CTGTGGAAAGTGTAGGGGCCTGG + Intronic
1080359750 11:31499119-31499141 CTTTGGAAGGCCAAGGTGCACGG + Intronic
1080896015 11:36449293-36449315 CTGTGGAAAGTGCATGTCTAGGG - Intronic
1081369737 11:42284907-42284929 CTTTGGGAGGTCGAGGTGCATGG + Intergenic
1081675009 11:44963544-44963566 CAGTGGAGGCTGCAGGTGCCAGG - Intergenic
1082800788 11:57413547-57413569 GTGTGGGAGAAGCAGGTGCATGG + Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083742839 11:64720289-64720311 GTGTGGAAGGGGCAGGGGCGAGG + Intronic
1083795918 11:65016606-65016628 CTGGGGGAGGAGCAGGTTCAGGG + Intronic
1084182658 11:67454508-67454530 GGGTGGAAGGAGCAGGAGCAGGG + Intronic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084545242 11:69812120-69812142 AGGTGGAAGCAGCAGGTGCAAGG + Intronic
1084590363 11:70086595-70086617 GTGGGGAAGGTGCAAGCGCAGGG + Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085254014 11:75162182-75162204 CTGGGGCAGGTGCAGGGTCAAGG - Intronic
1087052826 11:93903828-93903850 CAGGAGGAGGTGCAGGTGCAGGG - Intergenic
1087464374 11:98486385-98486407 ATGTGGAACCTGCAGATGCAGGG + Intergenic
1088583159 11:111334652-111334674 CTGTGAAAGATGCAGGAGCCTGG + Intergenic
1088594795 11:111432933-111432955 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089416999 11:118300514-118300536 CTGGGGAAGATGCACGTGTATGG + Intergenic
1089799995 11:121019790-121019812 CTTTGGAAGGTCAAGGTGGAAGG + Intergenic
1089898733 11:121959324-121959346 CAGTGGAAAGTGCCGGTGCCTGG + Intergenic
1089922802 11:122226817-122226839 CTGTGGGAGGAGCCAGTGCATGG + Intergenic
1090499803 11:127250422-127250444 ATGTGAAAGGTGCAGCTGCTGGG + Intergenic
1090751063 11:129746970-129746992 CTGTGGAAGTTGCAGATGGTGGG - Intergenic
1091052163 11:132382450-132382472 CTGTGGAAGGAAGAGGTGCATGG + Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091535398 12:1403277-1403299 CCGTGCCAGGTGCATGTGCAGGG - Intronic
1091587265 12:1823341-1823363 AAATGGAAGGGGCAGGTGCATGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092534612 12:9376449-9376471 CTGGGGTAGGAGCAGGTGCTGGG + Intergenic
1093007195 12:14063523-14063545 CGGTGGATGGTGCAGGAGCTAGG - Intergenic
1093520611 12:20045956-20045978 CTTTGGGAGGTGCAGGTGGGCGG + Intergenic
1094150428 12:27276533-27276555 TTGTGCAAGGTGGAAGTGCAAGG + Intronic
1094523776 12:31218734-31218756 GTGTGGAGGGGGCAGATGCAGGG + Intergenic
1095639276 12:44468213-44468235 CTGTGGCTGTTCCAGGTGCAGGG - Intergenic
1095745007 12:45648289-45648311 CTGTTGATGGCACAGGTGCAGGG + Intergenic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1098262362 12:68684398-68684420 ATGAGGAATCTGCAGGTGCAGGG + Intergenic
1099390708 12:82075218-82075240 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1099936426 12:89131100-89131122 CTGTGGAATGTGCATGTGTGTGG - Intergenic
1100277360 12:93083219-93083241 CTTTGGAAGGTGTAGGTGGGTGG - Intergenic
1102423538 12:112823010-112823032 CTTTTGAAGTTGCAGCTGCAGGG + Intronic
1102902494 12:116649077-116649099 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
1103394487 12:120597393-120597415 CTGTGGGAGGTACAGGGCCAGGG + Intergenic
1104874973 12:132027330-132027352 CTGTGGAGTGTGCTGGTGGAGGG + Intronic
1105666853 13:22569160-22569182 CTTTGGAAGGTGGAGGCGGACGG - Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106234275 13:27848522-27848544 TTGTGGAAGGTCCAGCTGGAAGG + Intergenic
1106282764 13:28290436-28290458 CTTTGGGAGGCCCAGGTGCACGG + Intronic
1106981293 13:35285184-35285206 CTTTGGGAGGTCCAGGTGGATGG + Intronic
1108002477 13:45916877-45916899 CTATGGAAGGAGCCTGTGCAAGG + Intergenic
1108338131 13:49467152-49467174 CTTTGGGAGGCCCAGGTGCACGG + Intronic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1110903787 13:80860230-80860252 CTGTGGGAGGAGCAGGTGAGAGG - Intergenic
1111221365 13:85208806-85208828 CTGTGGCATTTCCAGGTGCATGG - Intergenic
1112561524 13:100519556-100519578 CTGTCAAAGGAGCACGTGCAAGG - Intronic
1112610216 13:100948100-100948122 CTGTGGAAGCCCCAGGAGCAAGG - Intergenic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1113974150 13:114213594-114213616 CTGTGGAAGCTCCAGGACCACGG + Intergenic
1114447247 14:22798422-22798444 CTTTGGAAGGCACTGGTGCATGG - Intronic
1116210692 14:41939205-41939227 CTTTGGGAGGTCGAGGTGCATGG - Intergenic
1116265209 14:42679566-42679588 CTGTGGAAGGCTGAGGTGTAAGG - Intergenic
1118082525 14:62377743-62377765 CTGGGGAAGGGACAGGTACAGGG - Intergenic
1118382774 14:65230964-65230986 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1118917214 14:70117705-70117727 ATATGAAAGGTGCACGTGCAGGG - Intronic
1119441353 14:74630900-74630922 CTGTGGAGGGGCCAGGTGTAGGG + Intergenic
1121172377 14:91865802-91865824 ATGTGGTAGGTGCAGTAGCAGGG - Intronic
1121231975 14:92364961-92364983 CAGTGGAAAGGGCAGGGGCAAGG - Intronic
1122323099 14:100867194-100867216 CTGGGGACTGTGCAGGAGCAGGG - Intergenic
1122539017 14:102486543-102486565 CTGTGGAAGGGGCAGTTTCATGG - Intronic
1122589541 14:102837380-102837402 CTTTGGAAGGTCAAGGTGGAAGG - Intronic
1123012795 14:105357411-105357433 CTTTGGAAGCCACAGGTGCAGGG - Intronic
1123102059 14:105811019-105811041 TGGTGGAAGGTGAAGGTGAAGGG + Intergenic
1123172784 14:106390186-106390208 CTGGGGAAGGTGCCGCTCCATGG + Intergenic
1202854869 14_GL000225v1_random:43825-43847 GCGTGGCAGGTGCAGATGCACGG + Intergenic
1202860549 14_GL000225v1_random:79015-79037 ATGTGGCAGGGGCAGATGCAAGG - Intergenic
1123405507 15:20017660-20017682 CAGTGGAAGGTGCTGCAGCAGGG + Intergenic
1123433356 15:20236872-20236894 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1123514839 15:21024308-21024330 CAGTGGAAGGTGCTGCAGCAGGG + Intergenic
1124226251 15:27897510-27897532 CTGTTGAGCCTGCAGGTGCATGG + Intronic
1124349251 15:28943422-28943444 CTTTGGAAGTCGCAGATGCAGGG - Intronic
1125050635 15:35294500-35294522 CTGTTGAAGTTGAAGTTGCAAGG - Intronic
1125236144 15:37515823-37515845 ATGTGGAAGGCTGAGGTGCAAGG - Intergenic
1125597440 15:40895886-40895908 CTGTGGAAGAGACAGGTGAAGGG - Intronic
1125615441 15:41007928-41007950 CTGTGGAAGGTCGAGGTGGGTGG + Intronic
1126030807 15:44495688-44495710 CTTTGGGAGGTTGAGGTGCACGG + Intronic
1126105444 15:45144138-45144160 CTGTGGAGGCTGCAGCTGGATGG - Exonic
1126143775 15:45457697-45457719 CTGTGGAAGGCTCAGACGCAAGG + Intergenic
1126308505 15:47288798-47288820 CTGTGGAGTGTACAGGTGGAAGG - Intronic
1126369165 15:47927405-47927427 CTGTGGAAGGCTCAGAGGCAGGG - Intergenic
1127373580 15:58362297-58362319 CTGTGGAAGATGGAGCAGCAAGG - Intronic
1127850397 15:62907135-62907157 CTGTGGTAGGAGCTGGTGCCTGG - Intergenic
1129077909 15:73013281-73013303 CTTTGGTAGGTGGAGGCGCAAGG + Intergenic
1130084627 15:80767048-80767070 CTTTGGAAGGCCGAGGTGCATGG + Intergenic
1130112876 15:80980690-80980712 CTTTGGGAGGTTGAGGTGCAAGG + Intronic
1130784790 15:87084184-87084206 CTATTGATGGTGCAGGTTCATGG - Intergenic
1131095560 15:89652493-89652515 CTGTGGAAGGTGGGGATGCTGGG - Intronic
1131723867 15:95201744-95201766 CTGTGGCTTTTGCAGGTGCAAGG - Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132888774 16:2194302-2194324 CTGGGGGAGATGCCGGTGCAGGG - Intronic
1132941691 16:2511672-2511694 CAGTGGAAGGTGGTGGTGAAGGG + Intronic
1133102013 16:3485525-3485547 CTGGGGACGGTGCATGCGCAGGG - Exonic
1134035126 16:11024172-11024194 CTGTGGACGGTGCCAATGCATGG - Intronic
1134357836 16:13500900-13500922 CTCTGGAAGTTGCAGGAGGATGG + Intergenic
1134376573 16:13681181-13681203 CTGTGGAAGGCTCAGGTTGATGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135490017 16:22900951-22900973 CTGTCGCAGGAGCAGGTGAAGGG + Intronic
1135809678 16:25576021-25576043 CTGGGGAAGTTGCAGGGACAAGG - Intergenic
1136060268 16:27721576-27721598 GGGTGGAAGGGGCAGGTCCACGG - Exonic
1136598178 16:31265955-31265977 TTGTGGAGGGTGGAGGTGCTGGG + Intronic
1136689465 16:32018586-32018608 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1136790054 16:32962128-32962150 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136879759 16:33891808-33891830 CTTTGGAAGGTGGAAGTGGAAGG - Intergenic
1137670125 16:50273922-50273944 CTGTGGGAGGTGCAGGCCCTGGG + Intronic
1138008861 16:53359945-53359967 CTGAGGAGGGAGGAGGTGCAGGG + Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138778119 16:59749837-59749859 CTGTGGGAAGAGCAGCTGCAGGG + Intronic
1139477404 16:67209634-67209656 CTGAGGAAGGTGCTGGGGCGGGG - Intronic
1140041649 16:71412294-71412316 CTGTGCCAGGTGCAGGGTCAAGG - Intergenic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140183197 16:72741408-72741430 CTTTGGGAGGTGTAGGTGGAAGG - Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140597294 16:76431434-76431456 CTTTGGAAGGTGGAGGTGGGGGG + Intronic
1140814486 16:78608606-78608628 CTGTGGAAGGGTCAAGTGCAGGG + Intronic
1140966236 16:79968814-79968836 CTGTGGAAAGTGCACCTGAAGGG - Intergenic
1141061207 16:80872764-80872786 CTCTGGAAGGTGGAGGTGGGAGG + Intergenic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1203092258 16_KI270728v1_random:1223591-1223613 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1203146850 16_KI270728v1_random:1808439-1808461 CTGTGGCAGGGCCAGGTCCAGGG + Intergenic
1143618784 17:8069375-8069397 ATGTGGAAGGTGCAGAAGAAAGG - Intergenic
1144521094 17:15952759-15952781 CCGAGGAAGGTGCAGGTGGGAGG - Intronic
1144745124 17:17608995-17609017 GCCGGGAAGGTGCAGGTGCATGG + Intergenic
1144872456 17:18379531-18379553 CAGTGGGAGCTGCAGGTGCTGGG - Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1145795982 17:27655584-27655606 CTGGGGGAGGTGCTGGTGCCTGG - Intergenic
1145810433 17:27760909-27760931 CTGGGGGAGGTGCTGGTGCCTGG - Intronic
1146023719 17:29301297-29301319 CTTTGGGAGGTGGAGGTGGATGG - Intergenic
1146711740 17:35047993-35048015 CTGTGGAAGGCCAAGGTGAATGG - Intronic
1146929666 17:36768365-36768387 CTGTGGGAGGTGCAGCTTCCTGG + Intergenic
1147316073 17:39621052-39621074 CTTTGGAACTTGCAGATGCAAGG + Intergenic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147683081 17:42266629-42266651 CTGTGGAAGGTTGAGGTGGGAGG + Intronic
1147961150 17:44168407-44168429 CTGGGCAAGGTGCTGCTGCAGGG + Intergenic
1148045084 17:44738535-44738557 CTCAGGAAGATGAAGGTGCAGGG - Intronic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148587691 17:48792431-48792453 GTGTGGAAGGAGGAGGTGCAGGG + Intronic
1148674617 17:49438262-49438284 CTTTGTGAGGTGCTGGTGCAGGG + Intronic
1148901134 17:50878102-50878124 CTGTGGATGGTGTAGGCACAGGG - Intergenic
1149206320 17:54252802-54252824 CCATGGAAGGTGCAGGTGGCAGG + Intergenic
1149340554 17:55681636-55681658 CTGTGGAAGCTGCAGGGACCTGG + Intergenic
1149531907 17:57402298-57402320 CTGTGGAAATGGCAGGTTCAAGG + Intronic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150225892 17:63524249-63524271 GTGAGGAAGTCGCAGGTGCAGGG - Exonic
1151499880 17:74481829-74481851 CTGTGGTAAGTGCAGGAGCCCGG + Exonic
1151536852 17:74744060-74744082 CTATGGAAGATCCAGATGCATGG - Intronic
1151717742 17:75840051-75840073 CTGCAGGAGGTGGAGGTGCACGG + Exonic
1151748802 17:76025491-76025513 CAGTGGGAGCTGCAGGTGCTGGG + Intronic
1152657644 17:81527407-81527429 CTGAGGCAGGTGCAGGAGCCAGG + Intergenic
1152683264 17:81680976-81680998 CTGTGGCAGATGCAGGGTCAGGG + Intergenic
1152830930 17:82496725-82496747 CTGTGGAAGGCGCAGGGGCCAGG + Intergenic
1153337365 18:3938479-3938501 CCGAGGGAAGTGCAGGTGCAAGG + Intronic
1153400361 18:4678474-4678496 CAGTGGGAGGTGCATGTTCAGGG - Intergenic
1153575070 18:6511957-6511979 CTGTGGGAGGTGGAGAAGCATGG - Intronic
1154218524 18:12432976-12432998 CCGTGGAATGTGCATGTGCACGG + Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155053080 18:22165092-22165114 CTGGGGAAGGTGGAGGTCCCCGG - Intergenic
1155875894 18:31088144-31088166 GTTTGAAAGGTTCAGGTGCATGG + Intronic
1156049519 18:32915366-32915388 CTTTGGAAGGTGAAAGTGTAGGG + Intergenic
1156994388 18:43448228-43448250 CTTTGGTAGTAGCAGGTGCAGGG - Intergenic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1157294305 18:46431520-46431542 CTGTGGAGGGTGCAGGGGAGGGG + Intronic
1157327911 18:46682116-46682138 CTGGGGAGGGTGCAGGGGGAGGG + Intronic
1157384038 18:47247426-47247448 CTGTGGCAGCTGCCGGGGCAGGG - Intronic
1157717359 18:49897203-49897225 CTGTGACACCTGCAGGTGCAAGG - Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159002663 18:62987743-62987765 GTGTGGAAGGGACAAGTGCAAGG - Intergenic
1159282874 18:66310225-66310247 CTGTGGATTTTTCAGGTGCATGG + Intergenic
1159438698 18:68449823-68449845 CTGGGGAAGGTGAAGTTTCATGG + Intergenic
1159904100 18:74075089-74075111 CTGAGGATGGTGCAGCTGCATGG - Intronic
1159996582 18:74970712-74970734 CTGTGGCATTTCCAGGTGCACGG + Intronic
1160719654 19:591594-591616 GTGTGGAGGGTGCAGGTGGAGGG + Intronic
1160821691 19:1062014-1062036 GTGTGGGAGGTAGAGGTGCAGGG - Intronic
1161124085 19:2546299-2546321 CTGGAGAGGCTGCAGGTGCAGGG - Intronic
1161519479 19:4715733-4715755 ATGTGGGAGGTGCAGGTGAAAGG + Intronic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162141044 19:8585780-8585802 GTGTGGAATGTGGAGGTGCCTGG - Intronic
1162928827 19:13945409-13945431 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1163722746 19:18905989-18906011 CTGCTGCAGGTGCAGGTGCAGGG - Intronic
1164584116 19:29455219-29455241 CTGTGGTAGATAAAGGTGCAGGG + Intergenic
1164602735 19:29574182-29574204 CCATGGCAGGTGGAGGTGCAGGG - Intergenic
1164837774 19:31369025-31369047 CTGTGGACAGTGCAGGTCTAGGG + Intergenic
1165476830 19:36035487-36035509 CTGTGGCAGGTGCAGGGTCCTGG + Exonic
1165573024 19:36791477-36791499 CGGAGGAGGGGGCAGGTGCAGGG - Intergenic
1165579218 19:36847903-36847925 CTGTGGAGGATGCAGCAGCAAGG + Intronic
1165724292 19:38101807-38101829 CTGTCTAATGTGCACGTGCATGG + Intronic
1166920726 19:46227291-46227313 CTTAGGAAGGTGCAGGGACAGGG + Intergenic
1166968625 19:46547020-46547042 CTTTGGAAGGCCCAGGTGAATGG - Intronic
1166983856 19:46648593-46648615 CTGGGGGTGGAGCAGGTGCAGGG - Exonic
1167793352 19:51693772-51693794 CTGGGGAAGGTGCAGAGGGAGGG + Intergenic
1168345522 19:55648613-55648635 CTAAGGAAGAGGCAGGTGCAGGG - Exonic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925069638 2:956268-956290 CAGGGGGAGGTGCAGGGGCAGGG - Intronic
925352128 2:3208820-3208842 CCGTGGCAGGTGCAGGTGTCTGG + Intronic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG + Intronic
926212028 2:10878436-10878458 CTGTGGAAGGTGCTGGCAGAGGG + Intergenic
926767125 2:16331194-16331216 CTGTGGCAGGTCTGGGTGCATGG - Intergenic
926840959 2:17079879-17079901 CTGTGGATTTTCCAGGTGCACGG - Intergenic
927839177 2:26427357-26427379 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
930842165 2:55859555-55859577 CCTTGGAAGGGGCTGGTGCAAGG + Intergenic
931977340 2:67657143-67657165 CCGTGGAAGGTTCAGTTGGAAGG + Intergenic
932366072 2:71154364-71154386 CTGAGGAGGGAGGAGGTGCAGGG - Intergenic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932667580 2:73709326-73709348 TTTTGTAAGGTGCTGGTGCAGGG - Intergenic
932912857 2:75822511-75822533 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936817032 2:116472368-116472390 CTTTGGGAGGTCGAGGTGCATGG + Intergenic
937001036 2:118467855-118467877 ATGTGGAAGGTGCCACTGCATGG + Intergenic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937315528 2:120929863-120929885 CTCTGGAAGGTGCATGTGTTTGG + Intronic
937496713 2:122428206-122428228 GTGTGGAAGGTGGAGTTGCTGGG - Intergenic
937584186 2:123525968-123525990 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939086626 2:137726942-137726964 ATGTTGAAGGTGGAGGAGCATGG - Intergenic
939183606 2:138833284-138833306 CTGTAGTGGGTGCAGGTGAAGGG + Intergenic
939605610 2:144251950-144251972 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
940041521 2:149366578-149366600 CTGGGGGAGGTGCACTTGCAGGG + Intronic
940311580 2:152284881-152284903 ATGTGCAAGGTGCAAGTGCCAGG - Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941001692 2:160209006-160209028 CTGTGGGAAGAGCAAGTGCAAGG + Intronic
941666395 2:168247391-168247413 CTGGGGAAGCTGGACGTGCACGG + Exonic
941904478 2:170707621-170707643 CTTTGGGAGGTGGAGGTGGACGG - Intergenic
944925218 2:204457208-204457230 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945158646 2:206865403-206865425 ATGTGCAAGGTGCAGGAGCATGG + Intergenic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948682143 2:239642308-239642330 GTGGGGATTGTGCAGGTGCATGG + Intergenic
948682259 2:239643249-239643271 GTGGGGATTGTGCAGGTGCATGG + Intergenic
948795553 2:240400493-240400515 CTCTGGGACGGGCAGGTGCAGGG + Intergenic
948818130 2:240523921-240523943 TTGTCGAAGCTGCTGGTGCACGG + Exonic
949061237 2:241958908-241958930 CTGTGGAAGTTGCTGATGCCAGG + Intergenic
1169287445 20:4321486-4321508 CTGTGGGGGGTGCAGGTTCATGG + Intergenic
1169411914 20:5378094-5378116 CTTTGGGAGGTCCAGGTGGAAGG - Intergenic
1169753808 20:9022820-9022842 CTGTGGATGGAGCAGGTTCAGGG - Intergenic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1170020903 20:11835618-11835640 TTGTGGAAGCTGCTGGTCCAAGG + Intergenic
1170902389 20:20477829-20477851 CTGTGGGAGGCTGAGGTGCATGG - Intronic
1172136830 20:32692227-32692249 CTTTGGGAGGTGCAGGTGGGAGG - Intergenic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1172953474 20:38738114-38738136 CTTTGGGAGGTTGAGGTGCAAGG - Intergenic
1173738543 20:45378986-45379008 CTGTGGGAGGTGGAGGTGGGCGG - Intronic
1173932826 20:46835921-46835943 ATTTGGAAAGTGCAGGAGCAGGG + Intergenic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174883327 20:54304490-54304512 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1175415250 20:58796725-58796747 GTGTGGAAGGGGCAGGTGTCTGG - Intergenic
1175726105 20:61319700-61319722 CTTTGGGAGGTGGAGGTGGATGG + Intronic
1176093214 20:63328163-63328185 GTGTGGTAGGCACAGGTGCAGGG - Intronic
1176113534 20:63421451-63421473 CAGGGGGAGGTGCAGCTGCACGG - Intronic
1178170993 21:30039721-30039743 CTGTGGAAAGTTGGGGTGCAGGG + Intergenic
1178711146 21:34917885-34917907 CTTTGGGAGGTCCAGGTGGATGG + Intronic
1179173070 21:38988053-38988075 CTGTGGCAGGGGCCTGTGCAGGG - Intergenic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1180702207 22:17787591-17787613 AGGTGGATGGTGTAGGTGCAAGG - Intergenic
1180904894 22:19402860-19402882 CTTTGGAAGATGCAGGTGGGAGG + Intronic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181035950 22:20169807-20169829 CTGAGGAGGGGGCAGGGGCAAGG - Intergenic
1181442205 22:22942377-22942399 CTGAGGAAGGAACACGTGCAGGG - Intergenic
1181928743 22:26381720-26381742 AGGTGGAGGGTGCGGGTGCATGG + Intronic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1182848341 22:33450153-33450175 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1183369194 22:37423010-37423032 TTGTGGAAAGGGCAGGGGCAGGG - Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183867220 22:40713369-40713391 CTGTGGAAGGTAGTGGTGAAGGG + Intergenic
1183963419 22:41426661-41426683 CTTTGGGAGGCTCAGGTGCATGG - Intergenic
1184047371 22:41979781-41979803 CGGTGGAAGGACCAGGTGGAGGG + Intronic
1184150575 22:42635969-42635991 CTTTGGGAGGTGGAGGTGCGGGG + Intronic
1184176618 22:42792753-42792775 CGGTGGAAGGTGCAGCAGGACGG + Intergenic
1184198601 22:42949047-42949069 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1184241595 22:43213993-43214015 CTGTCGAAGGCCCAGGTGCCTGG - Intronic
1184493452 22:44823833-44823855 CTCTGGAATGTGCAGGTGGCTGG + Intronic
1184642252 22:45878928-45878950 CTGTGGAATGGGCCGGGGCAGGG + Intergenic
1184965137 22:47966020-47966042 CTGGGGGAGGTGCAGGAGCCTGG - Intergenic
1185074062 22:48673728-48673750 GGGTGGAAGGTGAAGGTGCATGG + Intronic
1185290076 22:50019576-50019598 CTGTGGAAGGTCCACGTGGGAGG + Intronic
949928608 3:9060857-9060879 AGGTGCAAGGTGCAGGTGTAAGG - Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
951382081 3:21996037-21996059 CTCAGGGATGTGCAGGTGCAGGG + Intronic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952914702 3:38226002-38226024 CTGTGGAATGTCCAGGTTGAAGG - Intronic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953676606 3:45007590-45007612 CTGAGGAAGGTGCAGGGACCTGG + Intronic
954524381 3:51256836-51256858 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
955837639 3:63074557-63074579 GTGTGGTAGGTACTGGTGCAAGG - Intergenic
956121978 3:65975510-65975532 CTTTGGAAGGTGGAGGTGGGCGG + Intronic
957187977 3:76967448-76967470 CTTTGGGAGGTGGAGGTGGATGG - Intronic
958192730 3:90204212-90204234 CTGAGGAAGCTGCAGGACCAGGG - Intergenic
958416148 3:93876142-93876164 CTGAGGAAGCTGCAGGACCAGGG - Intronic
958518646 3:95156165-95156187 CTGTGGATTTTCCAGGTGCAAGG + Intergenic
958554395 3:95655750-95655772 CTGTGGAAGGTGCGAGAGCGCGG + Intergenic
959478406 3:106839824-106839846 CTCTGGAAGGTGCATTTACAGGG + Intergenic
959495699 3:107048851-107048873 ATGTGGATGTTACAGGTGCAGGG + Intergenic
960054979 3:113270778-113270800 CTGTGGAAAGGGCAGGGCCAGGG - Intronic
960158753 3:114325988-114326010 CTGGGGTTGGGGCAGGTGCAGGG + Intergenic
960916667 3:122702124-122702146 CTGAGGAAGTTACAGGTGCCAGG + Intronic
961087702 3:124083323-124083345 ATGTGGTGGGTGCAGATGCAGGG + Intronic
961449006 3:126994072-126994094 CTCTGTAGGGTGCAGGCGCATGG - Intronic
961531318 3:127542143-127542165 CTGTGGAAGGGCCAGGTGCTGGG - Intergenic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
962325826 3:134431331-134431353 ATCTGGAAGGTGCAGGTGCAAGG + Intergenic
962662361 3:137616285-137616307 CTTTGGAAGGTAGAGGTGCGAGG + Intergenic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965266662 3:166552296-166552318 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
966940891 3:184746378-184746400 CTGAGTCAGGTGCAGCTGCAGGG + Intergenic
966947294 3:184785775-184785797 AGGTGGAAGGTGTGGGTGCAGGG + Intergenic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968387551 4:155341-155363 CTGTGGATTTTACAGGTGCATGG - Intronic
968453562 4:686369-686391 CAGTGGGAGGTCCAGGTGCTCGG - Intronic
968567614 4:1322489-1322511 CTCCGGAAGATGAAGGTGCACGG + Exonic
968641994 4:1719684-1719706 CTGGGGAGGGTGCAGCTGGAAGG + Intronic
969193463 4:5542555-5542577 CTGAGGAGGATGCAGGTTCATGG + Intergenic
969268849 4:6085238-6085260 CTGTGTGAGGTGCCGGTGCGTGG - Intronic
969462089 4:7334281-7334303 CTGGGGAAGGAGGAGGTCCAAGG - Intronic
969462822 4:7337806-7337828 AGGGGGAAGGTGCAGGTGGAAGG - Intronic
969491016 4:7499351-7499373 CTATGGAAGGTGCTTGAGCAGGG + Intronic
970005868 4:11410227-11410249 ATGTGGAAGATGCACGTGGAAGG + Intronic
970027341 4:11637338-11637360 GTGGGGAAGGTGCTGGTGGAAGG - Intergenic
970573442 4:17404901-17404923 CTGGGGCAGGGGCAGCTGCATGG - Intergenic
971369291 4:26003007-26003029 CTGTGAGAGGTGGTGGTGCAGGG - Intergenic
972247175 4:37257235-37257257 CTGCCCAAGGTGCAGGTGCAAGG + Intronic
972346852 4:38199578-38199600 CAGATGAGGGTGCAGGTGCAAGG - Intergenic
972695283 4:41439340-41439362 CTTTGGAAGGCCAAGGTGCATGG + Intronic
972836747 4:42880292-42880314 CTGTGGAACGTGAGGGGGCATGG - Intergenic
973059509 4:45703295-45703317 CTTTGGGAGGTGGAGGTGCGTGG - Intergenic
974276665 4:59729255-59729277 CTGTTCAAGGTGGTGGTGCAAGG + Intergenic
975477407 4:74839651-74839673 CTGTGCAGGGTGCAGGTCCTGGG - Intergenic
976051528 4:81016353-81016375 CTGTGGCTGTTCCAGGTGCATGG + Intergenic
978840702 4:113208744-113208766 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
979973087 4:127161805-127161827 CTCTGGAAAGTGCAGGTTGAAGG + Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981577253 4:146218199-146218221 CTCAGGAAGATGCAGGGGCAGGG + Intergenic
981812111 4:148787875-148787897 CTGTGGAAGGCTCAAGAGCAAGG + Intergenic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982208162 4:153012877-153012899 ATCTGGAGGCTGCAGGTGCACGG + Intergenic
982329542 4:154165739-154165761 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
982419387 4:155176829-155176851 CTCTGGAAGATGCAGCAGCAAGG - Intergenic
982436571 4:155387727-155387749 CTGTGTAACGTACATGTGCAGGG + Intergenic
983421242 4:167520159-167520181 CTTTGGAAGGAGCCTGTGCAGGG + Intergenic
983908234 4:173206721-173206743 CTGTGGAGGGTGCAGACTCAAGG - Intronic
984140742 4:176001781-176001803 CAGAGGAAGGTGCTGGTGCAGGG - Intronic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
984565435 4:181324481-181324503 CAGTGGAAATTGCAGGGGCAGGG - Intergenic
985672039 5:1211838-1211860 GTGTGGGGTGTGCAGGTGCATGG + Intronic
985672048 5:1212059-1212081 GTGTGGGGTGTGCAGGTGCATGG + Intronic
985682582 5:1264344-1264366 CTGGGGCAGGTGCTGCTGCAGGG - Intronic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790976 5:1926635-1926657 CTGGGGCAGGCGCAGGGGCAGGG - Intergenic
985817861 5:2139786-2139808 CTGAGTAAGCTGCAGATGCAGGG - Intergenic
986075356 5:4331099-4331121 CTGAGGAAGGTCTAGGTGCTAGG + Intergenic
986161631 5:5234626-5234648 CTTTGGGAGGTTGAGGTGCACGG + Intronic
988109958 5:26807502-26807524 CTTTGGAACCTGCAGGAGCAAGG - Intergenic
988136788 5:27183117-27183139 TTCTAGAAGATGCAGGTGCAAGG - Intergenic
988816904 5:34843049-34843071 CTCTGGAAGGCCGAGGTGCATGG - Intronic
988980654 5:36564779-36564801 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
991024919 5:62019098-62019120 CTGTGGAAGGTGCCTGGGCTTGG + Intergenic
991696109 5:69274389-69274411 CTTTGGGAGGTGAAGGAGCAAGG + Intronic
992666798 5:79018280-79018302 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
993260574 5:85653991-85654013 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
993260889 5:85656479-85656501 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
995591061 5:113699941-113699963 CTGTGGGAGAAGCAGGTGCAGGG - Intergenic
995924343 5:117352523-117352545 CTGTGGAAAGAGCAGATGCTCGG + Intergenic
997382553 5:133448270-133448292 CTGTGGAAAATAGAGGTGCAGGG - Intronic
997410063 5:133684264-133684286 CAGAGGAAGGTGAGGGTGCAGGG - Intergenic
998174477 5:139893528-139893550 CTGGGGAAGGAGCTGCTGCAGGG - Intronic
998499038 5:142616004-142616026 CTGGAGAAGGTGGAGATGCATGG - Intronic
998869370 5:146537139-146537161 CAGCAGAAGGTGCAGGTGCAGGG + Intergenic
999401288 5:151266233-151266255 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
999409156 5:151335295-151335317 CAGTGGAGTGGGCAGGTGCATGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999760833 5:154699781-154699803 CTGTTGAAGGGGCATGTGCTGGG - Intergenic
1000040922 5:157484709-157484731 CTGGGGAAGGTGGTGGTGAAGGG - Intronic
1000440912 5:161261947-161261969 CTGTGGAAGGTGCAGGAGTGTGG + Intergenic
1000711466 5:164585285-164585307 CTGAGGAAGGTGTAGATGAAAGG + Intergenic
1000812013 5:165874757-165874779 CTGTGGGAGGAACAGGTGTAAGG + Intergenic
1000913062 5:167045527-167045549 CTGAGGAAGGTGCCAGGGCAGGG - Intergenic
1001828707 5:174767428-174767450 CTGTAGAAGGTGCTGCTCCAAGG - Intergenic
1002106222 5:176880603-176880625 CTGGGGGAGGGGCAGGGGCAGGG - Exonic
1003260068 6:4509017-4509039 CTGTGGACTGTGTAGGGGCAGGG - Intergenic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1004261804 6:14114935-14114957 CTTTGGAAGGCCCAGGTGGACGG - Intergenic
1004291353 6:14370260-14370282 CTTTGGAAGGCCGAGGTGCATGG + Intergenic
1005017489 6:21387880-21387902 CTGTTGAGGCTGCAGGTGAAAGG + Intergenic
1006241507 6:32683909-32683931 TGGTGGAAGGTGGAGGGGCAAGG - Intergenic
1006349265 6:33509148-33509170 CTGTGGGAGGAGCAGGTTTATGG - Intergenic
1006579643 6:35069319-35069341 CTGTGGATGGGGCAGGGACAAGG - Intronic
1006648612 6:35532924-35532946 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
1006713100 6:36092855-36092877 CTGTGGAAGGTGCTGGGGACAGG + Intronic
1007232845 6:40360697-40360719 CTATGGAAGGTTCAGTTTCAAGG - Intergenic
1007367307 6:41403965-41403987 ATTTGGAAGGAGCAGGAGCACGG - Intergenic
1007905480 6:45455680-45455702 GGGTGGAAGGTGAAGGAGCAAGG + Intronic
1008661180 6:53669865-53669887 GTGTGAATGGTGCAGGTGTATGG + Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010390639 6:75332736-75332758 CTGTGGGAGGTGTATGTGGAAGG - Intronic
1010602472 6:77847221-77847243 TTGTGGAAGATCCAGGTGTACGG + Intronic
1011281532 6:85682659-85682681 CTTTGGGAGGTCCAGGTGGAAGG - Intergenic
1011634477 6:89358252-89358274 CTTTGGGAGGTGGAGGTGGAGGG + Intergenic
1011779385 6:90770007-90770029 CTTTGGAAGGCCAAGGTGCATGG - Intergenic
1013059070 6:106614263-106614285 CTGAGGAAGGTGAAAGAGCAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013863189 6:114660795-114660817 CTGTGGCTGTTCCAGGTGCAGGG - Intergenic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1015857519 6:137640948-137640970 CTGTGGGAGGCACAGGAGCAGGG - Intergenic
1017025130 6:150174719-150174741 CTTTGGGAGGTGGAGGTGGACGG + Intronic
1017553622 6:155539270-155539292 CTCTGGAAAGTGGAGGTCCAGGG + Intergenic
1018690441 6:166339983-166340005 CTGTGGGAGGAGCAGGTTCAGGG - Intronic
1018824531 6:167399122-167399144 CCGTGGAAGATGCAGGGGCAGGG + Intergenic
1018893440 6:167997599-167997621 GTGAGGAAGGGGCAGGGGCAGGG - Intronic
1019047568 6:169160550-169160572 CTGGGGCAGGTGCATCTGCAGGG + Intergenic
1019640899 7:2103156-2103178 CTTTGTAGGGTGCAGGGGCAGGG - Intronic
1019648400 7:2143114-2143136 CTGTGGACGGTGCTGGCTCAGGG - Intronic
1019872198 7:3774946-3774968 CTGTGGAAGGTGCGTCTGCCGGG + Intronic
1020457996 7:8396121-8396143 CTGTGGCAGTTGAAGGTTCAAGG + Intergenic
1020807382 7:12807511-12807533 CTGTGGGAGGTGGAGGTGGGAGG - Intergenic
1021428698 7:20534678-20534700 CTTTGGAAAGTGCATGTGGATGG + Intergenic
1021613374 7:22478912-22478934 CCGTGGAAGGAAGAGGTGCACGG + Intronic
1022434693 7:30371704-30371726 CTCTGGAGGCGGCAGGTGCACGG + Intronic
1022468145 7:30665188-30665210 CTGTGGGAGGTGCAGGTCAGGGG + Intronic
1022493647 7:30839562-30839584 CTGTGAGTGGTGCAGGTGCTGGG + Intronic
1022641565 7:32190271-32190293 CTGTGAAATGTGCAAGTCCAGGG - Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023485937 7:40686947-40686969 CTGAGGAAGGTGGGTGTGCAGGG - Intronic
1023565277 7:41518136-41518158 CTCTGGAAGGTGCAGCTGTGAGG + Intergenic
1024240743 7:47433677-47433699 CTGTGGAAAGTGCAGGTTCTAGG - Intronic
1025873717 7:65460469-65460491 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1026729014 7:72895069-72895091 CTTTGGAAGGTGGAGGTGGGAGG - Intronic
1026740136 7:72974034-72974056 CTGAGGCAGGTGCAGGACCAGGG + Intergenic
1026797445 7:73375546-73375568 CTGAGGCAGGTGCAGGACCAGGG + Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1027047708 7:75002167-75002189 CTTTGGGAGGTGGAGGTGAATGG - Intronic
1027103597 7:75391036-75391058 CTGAGGCAGGTGCAGGACCAGGG - Intergenic
1027131805 7:75596627-75596649 CTTTGGAAGGTGGAGGCGGATGG - Intronic
1027256646 7:76434997-76435019 CAGTAGGAAGTGCAGGTGCAAGG + Intronic
1028054142 7:86222565-86222587 CTGTGGCTTTTGCAGGTGCATGG + Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029363821 7:100104880-100104902 CTGCTGAAGGTGGATGTGCAGGG + Exonic
1029385288 7:100239481-100239503 CTTTGGGAGGTGGAGGTGAATGG + Intronic
1029465421 7:100721711-100721733 CTGTGGAATGTGCTGGGGAAGGG - Intronic
1029745718 7:102514757-102514779 CTGTGGAAGGAGGAGGACCAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030360380 7:108589349-108589371 CTCTGGGAGGTGGAGATGCAAGG - Intergenic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1032015265 7:128375958-128375980 CTTTGGGAGGTGGAGGTGGATGG + Intergenic
1032076007 7:128836513-128836535 CTATGAACGGTGCAGGTGAAGGG - Intronic
1033047638 7:137977107-137977129 TGGTGGGAGGTGCAGGGGCAGGG - Intronic
1034534200 7:151716854-151716876 CTCTGGAAGCTGAAGGTGCGGGG - Intronic
1034864624 7:154630477-154630499 CTGTGGAAAGACCAGGTACATGG + Intronic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035602072 8:902764-902786 CGGTGGAAAGTGCAGGTGGGCGG + Intergenic
1036825349 8:11971530-11971552 CTTTGGAAGGTCGAGGTGGATGG + Intergenic
1037364087 8:18104061-18104083 CTGTGGATTTTCCAGGTGCAGGG - Intergenic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1037973580 8:23192426-23192448 CTGTGGAAAGTGCAGGGTCTGGG + Intronic
1038077279 8:24090723-24090745 CTTTGGGAGGTAGAGGTGCACGG + Intergenic
1038280825 8:26162813-26162835 CTGAGGAAGATGGAGCTGCATGG - Intergenic
1038433194 8:27516127-27516149 CTGTGGACGGTGGTGGGGCACGG - Intronic
1039315527 8:36367608-36367630 CTTTGGAAGGCCCAGGTGCAAGG + Intergenic
1039521099 8:38172563-38172585 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1039761889 8:40585498-40585520 CTTTGTAAAGTGCAGGTGTATGG - Intronic
1039778533 8:40760804-40760826 CTGTGCAACTTGCAGGTGCATGG - Intronic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1039993123 8:42506887-42506909 CCCTGGAAAGTGCTGGTGCATGG + Intronic
1041016770 8:53599149-53599171 CTGTAGAAGGTCCAGGTTCCAGG + Intergenic
1041545109 8:59034022-59034044 TTATGGATGGTGCATGTGCAAGG - Intronic
1044205828 8:89491027-89491049 CTGTGGATTTTCCAGGTGCATGG - Intergenic
1044998908 8:97863187-97863209 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
1047228922 8:122979576-122979598 CTGGGGAAGGTTCAGGTGCTGGG - Intergenic
1048038068 8:130696385-130696407 ACGTGGCAGGAGCAGGTGCAAGG - Intergenic
1048209818 8:132445446-132445468 TTGGGGATGGGGCAGGTGCATGG - Intronic
1048265720 8:132983936-132983958 CAGTGGGATGTGCAGGAGCAAGG - Intronic
1048370805 8:133774524-133774546 CTCTGGAAGCTGCAGAAGCAAGG + Intergenic
1048848438 8:138621270-138621292 GTGTGGAAGGCCCAAGTGCAGGG + Intronic
1049014226 8:139908247-139908269 TGGAGGAAGGGGCAGGTGCATGG - Intronic
1049222774 8:141435449-141435471 CCGTGGAAGGGGCAGGGCCAGGG - Intergenic
1049227588 8:141464861-141464883 CTGTTGAAGGTTCAGGTGTCTGG - Intergenic
1049308982 8:141923441-141923463 CTGAGGATGGGGCATGTGCATGG - Intergenic
1049359616 8:142206098-142206120 CAGCGGAAGGGGCAGGGGCAGGG + Intergenic
1049486410 8:142866039-142866061 CTGGGGCATGTGCAGGTGCCTGG + Intronic
1049509829 8:143021922-143021944 CTGGGGCAGGTGGAGGTGCAGGG - Exonic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049809016 8:144554973-144554995 CTGTGGGAGATGCAGGGCCAGGG - Intronic
1050428732 9:5539618-5539640 CTGAGGAAGGGGCGGGAGCATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052135055 9:24898847-24898869 ATGTGGTAGGGGCAGGAGCAAGG + Intergenic
1052858117 9:33419581-33419603 CTTTGGAAGGCTGAGGTGCATGG + Intergenic
1053008727 9:34621484-34621506 CTGTGGAGGGTGGGGGTGCAGGG + Exonic
1053556507 9:39143394-39143416 CTGTGGGTGCTGCTGGTGCATGG + Intronic
1053820620 9:41963693-41963715 CTGTGGGTGCTGCTGGTGCATGG + Intronic
1054089485 9:60831821-60831843 CTGTGGGTGCTGCTGGTGCATGG + Intergenic
1054110896 9:61107379-61107401 CTGTGGGTGCTGCTGGTGCATGG + Intergenic
1054609961 9:67223746-67223768 CTGTGGGTGCTGCTGGTGCATGG - Intergenic
1055788639 9:79898211-79898233 TGGTGGGAGGTGCAGGTGGATGG - Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056552409 9:87663159-87663181 CAGTGGAGGGTGCAGGAGTAGGG - Intronic
1056788732 9:89611454-89611476 CTGGGGAGGGTGGAGATGCAAGG + Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1057040505 9:91844353-91844375 CTGTGGAAGGTGCAGGAGCGTGG - Intronic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1058916552 9:109572203-109572225 CTTTGGAAGGCTGAGGTGCAAGG + Intergenic
1059421307 9:114194222-114194244 CTGTGGAAGGTGTTAGAGCAGGG + Intronic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060576286 9:124698394-124698416 CTGTGGAAAGCACAGCTGCAGGG + Intronic
1061325564 9:129861806-129861828 CTGGGGAAGTTGTACGTGCAAGG + Intronic
1061397726 9:130352711-130352733 GTGTGGAAGGTGCAGGAGGTGGG - Intronic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1061735856 9:132658145-132658167 CTGTGGAAGACACAGATGCATGG + Intronic
1061807225 9:133143254-133143276 CTGTGGAAGGCTCAGGGGTATGG - Intronic
1061944668 9:133901942-133901964 GTGTGGTAGGAGGAGGTGCATGG - Intronic
1062096582 9:134706919-134706941 CTGGGGAAGGTGCTGGGACAGGG - Intronic
1062185148 9:135214266-135214288 CAGAGGAAGGTGCTGGTGCAGGG + Intergenic
1062197669 9:135283140-135283162 CTGGGGAAGGGGCAGGGTCAGGG + Intergenic
1062511148 9:136906926-136906948 CTGTGAGAGGTGCAGCTGCCAGG + Intronic
1062697233 9:137881621-137881643 CTGAGGGAGCTGCATGTGCAGGG - Intronic
1185653883 X:1668911-1668933 CTGTGGGAGGTCCAGGTGGGTGG - Intergenic
1185926938 X:4157543-4157565 TGGTGCAAGGTGAAGGTGCAAGG - Intergenic
1186846794 X:13538970-13538992 CTTTGGGAGGTGCAGGTGGGAGG - Intergenic
1187128219 X:16474469-16474491 ATGTGGTAGATGCAGGTGGAGGG + Intergenic
1187362520 X:18641678-18641700 CTGTGAAAGGTGCAGTCTCAGGG - Exonic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1190357200 X:49616979-49617001 CTGTGAATGGTGCAGGTGTCTGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1190895428 X:54613804-54613826 CTGTGGAGGTGGCAGGGGCAGGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1194409799 X:93543713-93543735 CTGTGGATTGTCCAGGTACATGG + Intergenic
1194952676 X:100145363-100145385 CTGTGGCATTTCCAGGTGCACGG - Intergenic
1195823596 X:108973006-108973028 CTGTGGATTTTCCAGGTGCATGG - Intergenic
1198865890 X:141122468-141122490 CTCTGGAAGATGCAGTTACAGGG - Intergenic
1198886544 X:141344439-141344461 CTGTGGCAGGTACTGCTGCAGGG + Intergenic
1198970770 X:142276864-142276886 ACGTGGAAAGTGCAGGTTCAGGG - Intergenic
1200062381 X:153489313-153489335 CTGAAGGAGGGGCAGGTGCAGGG - Intronic
1201015928 Y:9601316-9601338 CTCTGGAAGATGCAGTTACAGGG - Intergenic