ID: 1168382168

View in Genome Browser
Species Human (GRCh38)
Location 19:55933159-55933181
Sequence CAGGTTCTATGGGGGAATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168382168_1168382175 -5 Left 1168382168 19:55933159-55933181 CCACTATTCCCCCATAGAACCTG No data
Right 1168382175 19:55933177-55933199 ACCTGGTCCGGCATGTATGCTGG No data
1168382168_1168382179 14 Left 1168382168 19:55933159-55933181 CCACTATTCCCCCATAGAACCTG No data
Right 1168382179 19:55933196-55933218 CTGGGTCATGTCAAAATACCAGG No data
1168382168_1168382180 26 Left 1168382168 19:55933159-55933181 CCACTATTCCCCCATAGAACCTG No data
Right 1168382180 19:55933208-55933230 AAAATACCAGGTAGTATTGAAGG No data
1168382168_1168382177 -4 Left 1168382168 19:55933159-55933181 CCACTATTCCCCCATAGAACCTG No data
Right 1168382177 19:55933178-55933200 CCTGGTCCGGCATGTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168382168 Original CRISPR CAGGTTCTATGGGGGAATAG TGG (reversed) Intergenic
No off target data available for this crispr