ID: 1168386066

View in Genome Browser
Species Human (GRCh38)
Location 19:55964146-55964168
Sequence GCCAGGGGCCATGTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 12, 3: 27, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168386066 Original CRISPR GCCAGGGGCCATGTGATGCC TGG (reversed) Intronic
900109009 1:997868-997890 GCCAGGGGCCAGGGGTGGCCTGG + Intergenic
900351904 1:2238971-2238993 GCCAGGGACCATGCCAGGCCGGG - Intronic
900488202 1:2933466-2933488 GCCAGGTTCCATGTTAAGCCAGG - Intergenic
900541127 1:3203456-3203478 GCAAGGTGCCATGTGCTGCATGG + Intronic
900547461 1:3236699-3236721 GGCAGGGCCCATGTGAATCCAGG + Intronic
900699045 1:4032659-4032681 GCCAGGGGCCATGGGCTGGGTGG + Intergenic
901491938 1:9601222-9601244 GCCAGGGGCACAGTGGTGCCTGG - Exonic
901704053 1:11060203-11060225 TCCAGGGGCCACGTGGGGCCCGG + Intergenic
903588214 1:24433403-24433425 GCCAGGTGCCATGTGAAGGTTGG + Intronic
903761808 1:25703743-25703765 TCCTCTGGCCATGTGATGCCTGG + Intronic
903974131 1:27138167-27138189 GGCAGGGGCCAGATCATGCCAGG - Intronic
904316648 1:29670299-29670321 GCCAAGAGCCCTGTGATGGCAGG - Intergenic
904492524 1:30869893-30869915 GCCAGGGTCACTGTGGTGCCAGG + Intronic
905023136 1:34831688-34831710 GCCAGGGACCTGGTGAGGCCAGG - Intronic
905369396 1:37474996-37475018 GCCATGGGCCTTGCGCTGCCTGG + Intronic
907410834 1:54282187-54282209 GCCCAGGGCCATATAATGCCAGG - Intronic
912512418 1:110198349-110198371 TCCAGGGGTGATGTGCTGCCGGG - Exonic
914713339 1:150234840-150234862 GGGAGGGGCCATGTGAGGCGGGG - Intronic
915163223 1:153933821-153933843 GCCAGGGCACAGGTGATCCCCGG + Exonic
918388538 1:184036139-184036161 GCCAGGGGAGATGTGCTGTCAGG - Intronic
918528274 1:185488592-185488614 GCCAGGGGCTCTGTGAGGCATGG + Intergenic
919989617 1:202700184-202700206 GCCAGGGGCTAGGTGCTCCCTGG + Intronic
920144744 1:203849891-203849913 GTCAGGTGCCGTGTGATTCCTGG - Exonic
921348609 1:214212537-214212559 GCTAGGGGCCATGTTATGCTGGG - Intergenic
921389211 1:214602885-214602907 GCCAGGGGAACTGTGCTGCCTGG - Intergenic
921820399 1:219610237-219610259 GTCAGGTGCCATGTGATTCCTGG + Intergenic
923103071 1:230832708-230832730 GCCAGGGCCCATGTGGTTTCCGG + Intergenic
923401980 1:233624479-233624501 ACCAGGTGCCAGGTGAGGCCAGG - Intronic
1064991995 10:21264335-21264357 GCAGAGGGCCATGTGCTGCCTGG - Intergenic
1067051304 10:43022897-43022919 GCCAGGGGCCAGGTCATGCCAGG + Intergenic
1067709366 10:48636109-48636131 CCCAGGGGTCCTGTGCTGCCAGG + Intronic
1067800525 10:49355336-49355358 GCCAGGGGCCTTGAGAAGCAGGG - Intergenic
1069720701 10:70547756-70547778 CCCAGGAGCCCTGTGGTGCCAGG + Intronic
1069725050 10:70572034-70572056 GCCAGGGGGCCTGTGGTGTCGGG + Intergenic
1070160385 10:73863308-73863330 GCCTGGGACCAAGGGATGCCAGG - Intronic
1070777542 10:79118601-79118623 GCCAGGGGCTCTGGGAGGCCGGG + Intronic
1070850694 10:79559657-79559679 GCCAGGTGCCAGGTGATGCTTGG - Intronic
1070856526 10:79611630-79611652 GCCAGGTGCCAGGTGATGCTGGG + Exonic
1073217280 10:101843556-101843578 GCCGGGGGCCATGCGGGGCCAGG - Exonic
1073474207 10:103742286-103742308 GCCACGAGCCAAGAGATGCCTGG - Intronic
1074301829 10:112240409-112240431 GCCAGGGACCACCTGAAGCCTGG - Intergenic
1076307688 10:129476519-129476541 CCCAGGAGCCATGGGATTCCTGG - Intronic
1076497135 10:130904624-130904646 GCCAGGGCCCATCTGGTGCAGGG + Intergenic
1076869522 10:133186498-133186520 GACAGGGGCCCTGGGGTGCCCGG + Exonic
1077195188 11:1276326-1276348 GCCAGCGGGCATCTGAAGCCGGG - Exonic
1077437716 11:2550806-2550828 GCCAGGTGCTAGGTGAAGCCTGG - Intronic
1077473392 11:2775335-2775357 GGCTGGGGCCATGTGAGGCAGGG - Intronic
1077537318 11:3130583-3130605 GCCAGGGGCCAGGTGAGGGAGGG - Intronic
1079036032 11:17020903-17020925 TCCAGGGTCTATGTGATTCCAGG - Intergenic
1079128383 11:17734438-17734460 ACCAGGGACCATCTGATCCCTGG - Intergenic
1081871246 11:46383521-46383543 GCCAGGCCCCATGTGACACCAGG - Exonic
1082787730 11:57326078-57326100 AGCAGGGGTCATGTGAGGCCAGG - Exonic
1084376041 11:68778306-68778328 GCCAGGAGCCAGGGGAAGCCAGG + Intronic
1084963154 11:72727736-72727758 CCCAGAGGCCATGTGATGCTGGG - Intronic
1085217114 11:74843001-74843023 GCCAGGCACCAGGTCATGCCTGG + Exonic
1085311457 11:75519335-75519357 GCCAGGGGCCTGGGGTTGCCCGG - Intronic
1086009688 11:82085657-82085679 GCCAGGGACCATCAGAGGCCTGG - Intergenic
1086947069 11:92853908-92853930 GCCAGGGACTATCTGAAGCCTGG - Intronic
1087336586 11:96851850-96851872 GGCAGCGTCCATGTGATGCTGGG + Intergenic
1089366949 11:117926307-117926329 GCCAGGGTCCTTGGGGTGCCTGG + Intronic
1089403929 11:118181821-118181843 GCAAGGGGCCATTAGAAGCCAGG + Intergenic
1089621368 11:119724290-119724312 GCCAGGCCCCAGGTAATGCCAGG + Intronic
1090983778 11:131747961-131747983 GGCAGGTGCTATGTGGTGCCCGG - Intronic
1091283154 11:134393758-134393780 GACCGGCGCCGTGTGATGCCTGG - Intronic
1092230625 12:6773717-6773739 GCCGGGGGCCAGGGGATGGCCGG - Exonic
1094842885 12:34349346-34349368 GCCGGGGACCATGTTATCCCTGG - Intergenic
1095977476 12:47949623-47949645 GCCAGGGGGCGTGGGAGGCCTGG - Intergenic
1096865253 12:54558735-54558757 TCCAGGTGCCATCTGAGGCCTGG + Intronic
1099023268 12:77433072-77433094 GCCAGGGGTCATGAGAATCCTGG + Intergenic
1103674870 12:122647767-122647789 GCCATGAGCCAGGGGATGCCTGG - Intergenic
1104900769 12:132188556-132188578 GCCAGGAGCCGTCTGCTGCCCGG + Intergenic
1105210084 13:18252544-18252566 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1106773966 13:32990693-32990715 GCCAAGAGCCATCAGATGCCAGG - Intergenic
1107609856 13:42102354-42102376 TCCAGGGGCCAGGAGAAGCCTGG + Intronic
1113338783 13:109402113-109402135 GCCAGGGGCCCGGAGATGCCTGG + Intergenic
1113412816 13:110105280-110105302 GACAGGGGCCATGTGGTGGGAGG + Intergenic
1113634747 13:111911990-111912012 TGCAGGGGCCAGGTGCTGCCGGG - Intergenic
1113907229 13:113825343-113825365 GCAAGGGGCCACGTGGAGCCGGG - Intronic
1115178323 14:30591559-30591581 GCCAGCAGCCATGTGAAGCTAGG - Intronic
1115307458 14:31947143-31947165 AGGAGGGGCCATGTGCTGCCGGG - Intronic
1115664916 14:35535167-35535189 GCCAGCGGCGATGGGAGGCCAGG - Exonic
1117611158 14:57484719-57484741 GGCAGGGGCCAGGTCATGCAGGG + Intronic
1118838623 14:69494685-69494707 GCCAGGGGCCACGTCTTCCCAGG - Intronic
1119969022 14:78948538-78948560 GCCAGGCGGCACGTGATGCAGGG + Intronic
1121010733 14:90518664-90518686 GGCTGGCTCCATGTGATGCCTGG + Intergenic
1121466555 14:94119211-94119233 CCCAGGGGCCATCTGGGGCCAGG - Intergenic
1122773133 14:104105971-104105993 GCCAGGCCCCATGTCAGGCCTGG - Intronic
1122986470 14:105213972-105213994 GCCATGGCCGAGGTGATGCCAGG - Intronic
1124328707 15:28789050-28789072 GCCAGGGGACATCTGGAGCCCGG + Intergenic
1125530808 15:40412320-40412342 GCCAGGGGCCCTGTGAAGGCTGG + Intronic
1127642184 15:60926312-60926334 GCCAGGTGTCAGCTGATGCCAGG - Intronic
1128977638 15:72165218-72165240 GTCAGTGGCCATGCTATGCCAGG - Intronic
1128983239 15:72201154-72201176 GCTAGGGGCCATGTGGGGCAGGG - Intronic
1129172040 15:73813905-73813927 GCCTGGGGCCATGGGAGGACTGG + Intergenic
1129683311 15:77670762-77670784 GCCAGGGGCCAGCTGCTGCTGGG + Intronic
1130067705 15:80618471-80618493 GCCAGGGACACTGTGGTGCCTGG - Intergenic
1131399435 15:92112663-92112685 GGCAGGGGACATGTAATGGCAGG + Intronic
1131399660 15:92114112-92114134 GGCAGGGGGCATGTAATGGCAGG + Intronic
1132324942 15:100961162-100961184 GCCCTTTGCCATGTGATGCCCGG - Intronic
1132852125 16:2029517-2029539 GCCACTGCCCATGTGCTGCCCGG + Intronic
1132898971 16:2243241-2243263 GCCTGGGGCCATGTGGTGAGTGG - Intronic
1133015143 16:2936379-2936401 GGCAGGGGCCATGTGGAGCAGGG - Intronic
1134024212 16:10942129-10942151 GCCAGGGGACATCTGGAGCCCGG - Exonic
1134053991 16:11157698-11157720 GACATGGGCCAGGTGAGGCCTGG - Intronic
1135195074 16:20387490-20387512 GCCAGGGGACAGGTGATGTAGGG + Intronic
1135324818 16:21519749-21519771 GCCAGGGGCGTAGTGATGCAAGG + Intergenic
1136071621 16:27791058-27791080 GCCAGTGGCCATGTGTCTCCTGG + Exonic
1136336305 16:29613024-29613046 GCCAGGGGCGTAGTGATGCAAGG + Intergenic
1136737485 16:32477082-32477104 GGGAGGGGCCATGTGCTCCCAGG + Intergenic
1137256338 16:46778275-46778297 GCCAGGAGCCAAGAGAGGCCAGG - Intronic
1137514720 16:49133148-49133170 ACAAAGGGGCATGTGATGCCTGG + Intergenic
1137725318 16:50652874-50652896 GACAGGCGGCATGTGATGCTTGG - Intergenic
1138659662 16:58509661-58509683 GCCAGGGGCCGTGTCCTGCCAGG + Intronic
1139356303 16:66368859-66368881 GCCAGGAGCCCAGTGATACCAGG + Intronic
1139955790 16:70692386-70692408 GGGAGGGGCTATGTGAGGCCTGG + Intronic
1140103490 16:71938494-71938516 GCCAGGGATCATTTGAAGCCTGG + Intronic
1140218736 16:73028440-73028462 GCCCGGGGCAGTGTGATGCTGGG + Intronic
1142037025 16:87868806-87868828 GCCAGGGGCGTAGTGATGCAAGG + Intronic
1203015586 16_KI270728v1_random:352495-352517 GGGAGGGGCCATGTGCTCCCAGG - Intergenic
1203033921 16_KI270728v1_random:625653-625675 GGGAGGGGCCATGTGCTCCCAGG - Intergenic
1142967917 17:3592458-3592480 GCCAAGGGCCCTGTGAAGCAGGG + Intronic
1143174853 17:4949910-4949932 GCCAGGGGTCAGGAGATGGCGGG - Intronic
1143735818 17:8911467-8911489 GCCAGGGGCCACGACATGCACGG - Exonic
1144437227 17:15252846-15252868 GCCAGGGGCCAGGGCAAGCCAGG + Intronic
1144736228 17:17557093-17557115 GCCAGGGGTTAAGGGATGCCAGG - Intronic
1144762482 17:17715194-17715216 GCCAGGGGACATCTGAAGCCAGG + Intronic
1144949125 17:18984653-18984675 GACAAGAGCCATGAGATGCCTGG - Intronic
1145269376 17:21396577-21396599 GCCAGTGGTTATGGGATGCCCGG + Intronic
1146442356 17:32908143-32908165 GACTGGGGCCATGTGATGCAGGG + Intergenic
1147335644 17:39725588-39725610 GCAGGGGGAGATGTGATGCCAGG - Intronic
1150312148 17:64137410-64137432 GCCATGGGGCAAGTGTTGCCTGG + Intergenic
1152127973 17:78458841-78458863 GGCAGGGGCCAGATGGTGCCGGG - Intronic
1152427353 17:80225491-80225513 GCCAGGGGCCATGGGCTGCCTGG - Intronic
1153550658 18:6258508-6258530 GCCAGGGAAAATGTGAAGCCAGG + Intronic
1153874768 18:9359257-9359279 CCCAGCTGCCATGTGAAGCCAGG - Intronic
1155406337 18:25491896-25491918 GTCCGGAGCCATGTGATACCCGG + Intergenic
1159479478 18:68969253-68969275 GCGAGGGCCCCTCTGATGCCTGG - Intronic
1159634107 18:70784448-70784470 TCCATGGGCCATGTGCCGCCAGG - Intergenic
1160328002 18:77968280-77968302 GCCAGGAGCCAAGGAATGCCAGG + Intergenic
1160347514 18:78146003-78146025 GCCTGGAGCCATGTGCAGCCAGG + Intergenic
1160404830 18:78638179-78638201 GCCCGGGGCCAAGTGCTGCTCGG - Intergenic
1160510673 18:79451828-79451850 ACCAGGGGCCATCTGCGGCCTGG + Intronic
1161114932 19:2491316-2491338 GCCAGGGGCCAGGTGGGGCCAGG - Intergenic
1161462702 19:4408165-4408187 GGCAGGGGCTATCTGAAGCCAGG - Intronic
1161468128 19:4443458-4443480 GCCCGGCCCCATGTGGTGCCTGG + Intronic
1162341296 19:10092857-10092879 GGGAGGGGCCAGGGGATGCCTGG - Exonic
1162833474 19:13301381-13301403 GGCAGGGGCCATCGGATGCCAGG - Intronic
1163468446 19:17483343-17483365 TGCATGGGCCATGTGGTGCCTGG + Intronic
1165382100 19:35488867-35488889 GCAGGGGGTCACGTGATGCCAGG + Intronic
1165410110 19:35654685-35654707 GCCAGGGCCCTTGGGATGCTGGG + Intronic
1165471793 19:36008483-36008505 GGCAGGGGCCATGTGAGGGTAGG - Intronic
1165922033 19:39305278-39305300 GCCAGGGGCCCCCTGAGGCCAGG - Intergenic
1166391158 19:42409657-42409679 GCCAGAGGGCACCTGATGCCTGG + Intronic
1166531514 19:43546185-43546207 GGCTGGGGGCATGAGATGCCTGG - Intronic
1166781262 19:45344890-45344912 CCCAGGGTCCATCTGTTGCCTGG + Intronic
1168386066 19:55964146-55964168 GCCAGGGGCCATGTGATGCCTGG - Intronic
1168542334 19:57223488-57223510 GCCATGGGCCTTGTGTTGACTGG + Intergenic
927540298 2:23903984-23904006 GCCAGGGAACAGGTGATGACGGG + Intronic
929297797 2:40268251-40268273 GGCAGGGACCAGGTGATTCCTGG + Intronic
929758626 2:44788129-44788151 CCCAGGGCCGATGTGCTGCCCGG + Intergenic
930020085 2:46996449-46996471 GCCTGGGACCATGCGATGCCAGG + Intronic
930789652 2:55311429-55311451 GCCAGGGCACATGTGAAACCAGG - Intronic
933801047 2:85960767-85960789 ACCAGGGAACATGTGGTGCCTGG + Intergenic
934188616 2:89766195-89766217 GGGAGGGGCCATGTGCTCCCAGG + Intergenic
934307980 2:91841758-91841780 GGGAGGGGCCATGTGCTCCCAGG - Intergenic
934971961 2:98770953-98770975 GACAGGACCCATGTGATGACCGG - Intergenic
935636734 2:105254892-105254914 GAAAGGGGCCATCTGAAGCCAGG + Intergenic
938069606 2:128301347-128301369 CCCAGGGGCCATGTGGCTCCAGG + Intronic
938742847 2:134248972-134248994 GCCAGGAGCCTTCTGAAGCCAGG + Intronic
940238842 2:151541366-151541388 GCCACTGGCCAGGTGAGGCCAGG + Intronic
943180237 2:184531001-184531023 GCCAGGGACAGTGTGAGGCCTGG - Intergenic
947613084 2:231535992-231536014 GCCAGTGTCCACGGGATGCCGGG - Intergenic
947740328 2:232481913-232481935 GCCAGGGGACATCTGGGGCCTGG - Intronic
948334466 2:237196526-237196548 GCTGGGGACCATGTGAAGCCTGG - Intergenic
948542966 2:238703155-238703177 CCCAGTGGTCAGGTGATGCCTGG - Intergenic
948654329 2:239467099-239467121 GCCAGGAGGCAGGTGATGCTTGG + Intergenic
948661582 2:239510209-239510231 GCCAGGGGCCATGTGAAGACGGG - Intergenic
948748554 2:240113340-240113362 GCCAGTAGCCATGTGATCTCAGG - Intergenic
948802109 2:240437602-240437624 GCCGAGGGCCTTGTGCTGCCTGG - Intronic
949065169 2:241985844-241985866 ACCACGGGCCACGTGAGGCCAGG - Intergenic
1169640432 20:7744752-7744774 TCCAGGGTCCATGTGATTCCAGG + Intergenic
1170494935 20:16915243-16915265 GCCAGGAGCCAGGAGAAGCCAGG - Intergenic
1171139533 20:22728993-22729015 GCCATGGGCCAAGGGTTGCCTGG + Intergenic
1171291230 20:23984234-23984256 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1172027285 20:31957076-31957098 GCCATGGGCCATCTGTTGCCTGG - Intergenic
1172038707 20:32028865-32028887 GCCAGGGGCCAGGGTATGCGAGG + Intronic
1174173892 20:48633005-48633027 GGCAGGGGCCATGGGCTACCGGG - Intronic
1175298560 20:57926836-57926858 ACCAGGGGCTATGAGAAGCCTGG + Intergenic
1175952033 20:62588688-62588710 GCCGGGGGCCATCTGAGGGCAGG + Intergenic
1176291331 21:5046540-5046562 GGCAGGGGCCAGGAGGTGCCAGG - Intergenic
1179569726 21:42271341-42271363 GCCAAGGGCCATATGATGGGTGG + Intronic
1179865924 21:44217101-44217123 GGCAGGGGCCAGGAGGTGCCAGG + Intergenic
1180051430 21:45333257-45333279 TCCAGGGGCCCTGTGGTGCATGG + Intergenic
1180070533 21:45433886-45433908 GCCAGGAGCCAGGTGGTGTCAGG + Intronic
1180245054 21:46541432-46541454 GCCTGGAGCCCTGTGAAGCCCGG - Intronic
1180535062 22:16388841-16388863 GGGAGGGGCCATGTGCTCCCAGG - Intergenic
1180766173 22:18346860-18346882 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
1180780140 22:18515518-18515540 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1180812856 22:18772839-18772861 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1181199014 22:21207087-21207109 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1181316529 22:21974284-21974306 GCCAGGGTCCAGTTGAAGCCAGG - Intronic
1181400730 22:22648701-22648723 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
1181488686 22:23247689-23247711 ACCATCGGCCATGTGATGCCTGG - Intronic
1181648661 22:24247177-24247199 GCCAGGGCCCAGGTGAGGCCAGG - Intergenic
1181702710 22:24629799-24629821 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
1182380605 22:29883794-29883816 GTCAGGGGCCATGGGAGCCCCGG + Intronic
1182977391 22:34636188-34636210 GCCCGGGGCCATAAGATGACAGG - Intergenic
1184665098 22:45984237-45984259 GGCAGGGGCCAGAAGATGCCAGG - Intergenic
1184682671 22:46080401-46080423 GCCAGGAGCCATGTGGTGCTGGG - Intronic
1184718385 22:46295010-46295032 GCCATGTGCCAGGTGATGCTGGG - Intergenic
1185170641 22:49291733-49291755 GCCACAGGCCAGGGGATGCCTGG - Intergenic
1185314820 22:50174454-50174476 GCCAGGGGCCTGGTGCTGCTTGG - Intronic
1203227791 22_KI270731v1_random:87751-87773 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
950420306 3:12894920-12894942 GGCAGGGGCCATGTGAAGGATGG + Intergenic
950868756 3:16211119-16211141 TCCAGGAGCCCTGTGGTGCCCGG + Exonic
953495004 3:43378317-43378339 ACCAGGGGTCCTTTGATGCCTGG - Intronic
953604023 3:44396781-44396803 GCAGTGGGCCATGTGATGCTAGG + Exonic
954543145 3:51409424-51409446 ACCTGGGTCCATGTGATGCCTGG - Intronic
954792960 3:53146417-53146439 GCAAGGGGACCTGTGATCCCTGG + Intergenic
957478299 3:80756078-80756100 GGCAGGGGCCAGGTGTTGCAGGG + Intergenic
959576839 3:107943723-107943745 GCAAGGAACCATGTCATGCCAGG + Intergenic
962313428 3:134342179-134342201 GCCAGGAGCCATCAGAAGCCAGG + Intergenic
962812736 3:138973190-138973212 TCGAGAGGCCATGTGATGCCAGG + Intergenic
966400089 3:179538951-179538973 GCGAGGGGCCACGTGGTGACGGG + Intergenic
967529517 3:190532713-190532735 GATAGGGGCCATGGGATGCACGG - Intronic
968005705 3:195241197-195241219 GGCAGGTGCCCTGTGATGTCTGG + Intronic
968940272 4:3634037-3634059 CCCAGTGGCCTGGTGATGCCTGG + Intergenic
969134147 4:5016546-5016568 GCCAGGAGCCAAGTGAGGCAGGG - Intronic
969554476 4:7896876-7896898 GCCAGGCATCATGTGCTGCCGGG - Intronic
971363546 4:25958088-25958110 GCCAGGTGCCTTTTGCTGCCTGG - Intergenic
974118813 4:57613106-57613128 ACCAGGGGCCATATTATGCAGGG + Intergenic
975320998 4:73010854-73010876 GCCTGGGGCCAGGTCATGCCTGG - Intergenic
977022869 4:91777468-91777490 GTCAGGGCCCATGTTATGACTGG + Intergenic
977714302 4:100164307-100164329 TCCAGGGGCAAGGTGGTGCCTGG - Intergenic
985358419 4:189145396-189145418 GCCAGGTGCTCTGTGAGGCCCGG + Intergenic
985928471 5:3035945-3035967 GCCTAGGCCCAGGTGATGCCTGG + Intergenic
988921692 5:35948201-35948223 GGCTGGAGCCTTGTGATGCCTGG - Intergenic
992168278 5:74076553-74076575 CCCAGGGGACAGGTGAAGCCAGG - Intergenic
994061770 5:95486518-95486540 GGCAGGGGCAGAGTGATGCCGGG - Intronic
995079839 5:108036701-108036723 GCCAGTGGCTATGTGATGAATGG - Intronic
996015795 5:118532816-118532838 GCCAGTGGCCATGTGGTACATGG + Intergenic
996880234 5:128288675-128288697 GCCAAGGCCCAAGGGATGCCAGG - Intronic
997464738 5:134079705-134079727 GCCTGGGGCTTTGTGCTGCCAGG - Intergenic
998375347 5:141686983-141687005 GCCAGGAGCCATGGGGAGCCAGG + Intergenic
999454361 5:151702636-151702658 GCCCGGTGCCGTGGGATGCCCGG + Intergenic
999577392 5:152994288-152994310 GCCAGGTGCTATGTGAAGCTAGG + Intergenic
1003062315 6:2873369-2873391 TCCAGAGGCCATCTGATGTCAGG + Intergenic
1006081172 6:31567766-31567788 GGCAGGGGCCAGGTCATGCAGGG - Intergenic
1006300626 6:33192077-33192099 GGAAGGGGCCAGCTGATGCCTGG - Intronic
1007128699 6:39449309-39449331 GCCAGGGACCAGATGACGCCAGG - Intronic
1007724894 6:43909732-43909754 CCCAGAGGCCACGTGAGGCCAGG - Intergenic
1007947166 6:45837069-45837091 TCCAGGGCCCATGTGAGGACAGG + Intergenic
1009565239 6:65304325-65304347 GTCAGGTGCCATGTGATTCCTGG - Intronic
1015508827 6:134017460-134017482 GCCAGGTGCCATGTTAGGCCTGG + Intronic
1016985971 6:149896213-149896235 GCTAGGGCCCTTATGATGCCTGG + Intronic
1017718399 6:157228130-157228152 GTCAGGGGCCATGGCAGGCCTGG + Intergenic
1019166262 6:170099534-170099556 GCCAAGGGCAGTGTGGTGCCTGG - Intergenic
1019262150 7:87711-87733 GCCCAGAGCCATGTGCTGCCTGG + Intergenic
1023683810 7:42715233-42715255 GCTAGGGGCAAGGTGATGCCTGG + Intergenic
1024242065 7:47443291-47443313 GGCAGTGGCCATGCGGTGCCAGG - Intronic
1024334931 7:48197318-48197340 GCCAGGGCCCATCTGAAACCTGG - Intronic
1025959219 7:66205594-66205616 ACAAGGGGCCAAGGGATGCCAGG - Intronic
1026011496 7:66639696-66639718 GCCAGGGGCTATGGGGTGGCTGG - Exonic
1026559254 7:71434488-71434510 GCCAGGGGCCAAGTGAATGCTGG + Intronic
1026805874 7:73429457-73429479 CCCAGGGGCCGTGGGATGCCAGG - Intergenic
1026872067 7:73858846-73858868 GACAAGGGCCAGATGATGCCTGG - Intergenic
1030200344 7:106896629-106896651 TCCAGGGGACAAGTGATGGCTGG + Intronic
1033241441 7:139682921-139682943 GTCTGTGGCCCTGTGATGCCAGG - Intronic
1036207187 8:6814038-6814060 GGGAGGGGCCATGTGATACTTGG - Intronic
1037880907 8:22572960-22572982 GAAAGAGGCCATGTGAAGCCTGG - Intronic
1038054641 8:23846927-23846949 CCCAAGAGCCAGGTGATGCCTGG - Intronic
1038239357 8:25793919-25793941 ACCTGGGGCCATGTGATTCTGGG + Intergenic
1038481795 8:27907084-27907106 GCCAATGCCCATGTGCTGCCTGG + Intronic
1038918379 8:32053151-32053173 GCCAGGGGACATGAATTGCCTGG + Intronic
1042028027 8:64444531-64444553 GCCACAAGCCAAGTGATGCCTGG - Intergenic
1043912237 8:85876319-85876341 GTCAGGAGCCAGATGATGCCTGG - Intergenic
1047017812 8:120742202-120742224 GCCAGGGGCCATAAGATGGCAGG - Intronic
1047185890 8:122633124-122633146 GTCAGTGCCCATGTGATACCCGG + Intergenic
1048203722 8:132398934-132398956 GTCAGAAGTCATGTGATGCCTGG - Intronic
1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG + Intronic
1049829976 8:144694208-144694230 GGCAGGGGCCAGGTGGTGGCAGG + Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1052437137 9:28443866-28443888 GCCAGGGACAATCTGAAGCCTGG + Intronic
1052836575 9:33254615-33254637 GCCACAGGCCATGAGATACCAGG - Exonic
1054450487 9:65401260-65401282 CCCAGTGGCCTGGTGATGCCTGG - Intergenic
1055957643 9:81789097-81789119 GACAAAGGCCATGTGATGCACGG + Intergenic
1056071403 9:82991061-82991083 GCCTGGGGCCACGTGAAGCTGGG - Intronic
1056938193 9:90933724-90933746 GCCAGGGGCCTGGAGATGCCAGG + Intergenic
1057305929 9:93912097-93912119 GCCAGGGCCCATGGGCCGCCTGG + Intergenic
1058704470 9:107627280-107627302 GCCAGGGGCCAGGTCCTGTCAGG - Intergenic
1058800568 9:108541076-108541098 GCCTGGTGCCATGTGGTGGCTGG + Intergenic
1059107773 9:111526012-111526034 ACCAGGGGCCATGAGCTGCGGGG - Intronic
1061941892 9:133888192-133888214 GCCAGGGGCCAGGGGAGGCTGGG + Intronic
1061987205 9:134136507-134136529 GAGAGGGGCGATGTGAGGCCGGG - Intronic
1062267885 9:135695719-135695741 GCCAGGTGCCATGAGAGGCAGGG - Intronic
1062428712 9:136517523-136517545 GCCAGGGGCCACGGGCTGCAGGG - Intronic
1062442914 9:136579107-136579129 ACCAGGGGCCCTGTGATGTGGGG - Intergenic
1203778723 EBV:88618-88640 CCCAGGGTCCATGGGATCCCAGG + Intergenic
1185431660 X:14805-14827 GCTCTGGGCCATGTGCTGCCTGG - Intergenic
1185440984 X:227524-227546 GCTCTGGGCCATGTGCTGCCTGG - Intergenic
1186521277 X:10208931-10208953 GCCGCTGGCCAGGTGATGCCAGG + Intronic
1187225743 X:17374685-17374707 ACAGGGGGCCACGTGATGCCTGG + Intergenic
1188903633 X:35764552-35764574 GTCAGGGGACATGGGTTGCCAGG - Intergenic
1198327314 X:135586593-135586615 GCCAGGGGTCCTGGGGTGCCGGG - Intergenic
1198429868 X:136554456-136554478 GGCAGGGGCCAGGTGGTGCAGGG + Intronic
1198506554 X:137307078-137307100 GGCATGGGCCATATCATGCCAGG - Intergenic
1199140373 X:144304543-144304565 GCCAGGGGCCAGATCATGCAGGG + Intergenic
1199815344 X:151392337-151392359 GCCAGGGGACATGGGATCCTAGG + Intergenic
1200243382 X:154509254-154509276 GCCAGAGGCCAAGGTATGCCTGG + Intronic
1201456553 Y:14173576-14173598 TCCAGGGGACATGAAATGCCAGG - Intergenic