ID: 1168386502

View in Genome Browser
Species Human (GRCh38)
Location 19:55967701-55967723
Sequence GGGTATATACCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168386502 Original CRISPR GGGTATATACCAGTGGTGGA TGG Intronic
904671767 1:32171346-32171368 CGGTATATTCCAGAGGTGGGAGG + Exonic
907030038 1:51162080-51162102 GGGTTTACACCAGTGATGCAGGG + Intergenic
908748706 1:67399598-67399620 GGGTTTTTACTAGTGGTGGGGGG - Intergenic
909042082 1:70666825-70666847 GGCTTTAAACCAGTGGTTGAAGG + Intergenic
909042181 1:70667943-70667965 GGCTTTAAACCAGTGGTTGAAGG + Intergenic
909063274 1:70903703-70903725 GGGAATAAACCAGAGGAGGAGGG + Intronic
911265588 1:95739435-95739457 GGCTTTATACCAGGGGTGCAGGG - Intergenic
913313047 1:117522307-117522329 GGGTTTATCCCAGGTGTGGAGGG + Intronic
921876913 1:220207549-220207571 GGGCATAAACCAGTGGGGAAGGG + Intronic
922077698 1:222264235-222264257 GGGTATCTACCAATGGAGAAAGG - Intergenic
924146304 1:241078903-241078925 GAGTACATACCGGTGGTAGAGGG - Intronic
1064931219 10:20629655-20629677 GAGAAGATACCAATGGTGGAAGG - Intergenic
1068481418 10:57593055-57593077 TGGTAGATACCAGTGTTGCATGG + Intergenic
1068856385 10:61802219-61802241 GGGTTTATACCACTGGCTGATGG - Intergenic
1071194001 10:83135784-83135806 GGGTCTATTCCAGTTGTGCAAGG + Intergenic
1076631617 10:131855397-131855419 GCGTGTTTCCCAGTGGTGGATGG - Intergenic
1079105065 11:17565810-17565832 GTGTATATGCTAGTGGTGGTGGG + Intronic
1081915602 11:46728369-46728391 GGCTATATCCTAGTGTTGGAGGG - Intronic
1084702534 11:70796628-70796650 GGGTGTGGACCAGGGGTGGACGG + Intronic
1088883521 11:113989766-113989788 GGGTACAGCCCAGTGGAGGAGGG + Exonic
1090054084 11:123406956-123406978 GGGTAAATACCACAGGTGCAGGG - Intergenic
1096642393 12:53005046-53005068 GGTTATATTCTAGTGGGGGAAGG - Intergenic
1100275504 12:93068295-93068317 GGGTGTATATGCGTGGTGGAGGG - Intergenic
1101303667 12:103505658-103505680 GGGCATATACCAGGGATGCAGGG + Intergenic
1101438041 12:104680686-104680708 GGGCACATACCAGAGGAGGAGGG - Intronic
1105068049 12:133217087-133217109 GGATCTCTACCAGTGGTTGATGG - Intergenic
1105275011 13:18913373-18913395 GGGTTTATACCAGGGATGCAGGG + Intergenic
1120473588 14:84958485-84958507 GTGTATATGCCAGTGGTAGGGGG + Intergenic
1121308207 14:92920704-92920726 GGGTAGATCCCAGCGGTGGGAGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124076813 15:26454004-26454026 GGGTATATAGCAGTGCTTGGTGG - Intergenic
1125715070 15:41815108-41815130 GGGTATATACCAGTTATGTATGG + Intronic
1126392546 15:48175292-48175314 GGGTGTTTACCAGAGGTGGAGGG + Intronic
1127173927 15:56333328-56333350 GGATTTATCCCAGTGATGGAGGG + Intronic
1144749986 17:17641905-17641927 GGGGAGATACCAGTGTTGCAAGG - Intergenic
1145970891 17:28955853-28955875 TGGTATATACAGGAGGTGGAGGG + Exonic
1149122088 17:53181715-53181737 GGGTTCATACCAGGGATGGAGGG - Intergenic
1155412430 18:25561547-25561569 GTTTACATGCCAGTGGTGGAGGG + Intergenic
1155767780 18:29656993-29657015 GGGTTTATCCCAGTGATGTAAGG + Intergenic
1156011847 18:32505577-32505599 GGGGATAGACCAATGGGGGAGGG - Intergenic
1157503042 18:48204117-48204139 AGGTATAAATCAGAGGTGGAAGG - Intronic
1157738440 18:50071206-50071228 GGGTGAATAACAGTGGAGGAAGG - Intronic
1158406219 18:57161917-57161939 GGGTATAGACAAGAGATGGAGGG + Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1162174352 19:8820251-8820273 GGGCATATACTAGGAGTGGAAGG - Intronic
1165721718 19:38083575-38083597 GGGCAGATCCCAGTGGGGGATGG + Intronic
1168386502 19:55967701-55967723 GGGTATATACCAGTGGTGGATGG + Intronic
925291269 2:2750033-2750055 GGGTGTGTGCCAGTGGTAGATGG + Intergenic
926075479 2:9939561-9939583 GGGAATATACCAGTGGTGGCAGG + Intergenic
929754847 2:44756031-44756053 GGGGAAATCCCAGTTGTGGATGG + Intronic
931521500 2:63102515-63102537 GGATTTATACCAGTGATGCAAGG - Intergenic
937337042 2:121068572-121068594 GGTTAGAGACCAGTCGTGGATGG + Intergenic
938227486 2:129628329-129628351 GGGTTTAGAACAATGGTGGAGGG - Intergenic
941249536 2:163145194-163145216 AGGTTTAAACAAGTGGTGGAAGG + Intergenic
941358288 2:164519184-164519206 GGTTATATATCAGAGATGGAGGG + Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
948877559 2:240837749-240837771 GGGTCTTTGCCAGTGCTGGAGGG - Intergenic
1168973859 20:1949569-1949591 GGGTCTGTGCCAGAGGTGGAGGG - Intergenic
1170610888 20:17912138-17912160 GGGCAGAAACCACTGGTGGATGG + Intergenic
1171153445 20:22848254-22848276 GCTTATACACCATTGGTGGAAGG + Intergenic
1176517253 21:7795181-7795203 GGGTATATAGCATTTTTGGAGGG + Intergenic
1178651281 21:34425193-34425215 GGGTATATAGCATTTTTGGAGGG + Intergenic
949492197 3:4599978-4600000 GGGCATGTACCAGTGTAGGAAGG - Intronic
950738408 3:15030343-15030365 GGATAGACACCAGTGGAGGAGGG + Exonic
950799722 3:15540355-15540377 GGGTATAGACCAGAGGGTGAGGG + Intergenic
957175112 3:76798436-76798458 GGATTCATACCAGTGGTGCAAGG + Intronic
958646816 3:96885052-96885074 GGTTTCATACCAGTGGTGGAGGG - Intronic
958734015 3:97989021-97989043 GGGTATATGGTAGTGGTGGTGGG + Intronic
964252879 3:154740204-154740226 GGGTTTATAACAGGGGTGCAGGG - Intergenic
966664099 3:182451177-182451199 TGGTATTTACAAGTGCTGGATGG + Intergenic
971528769 4:27658060-27658082 GTTTGTATACCATTGGTGGAAGG - Intergenic
971955790 4:33416620-33416642 GGGTACATACCACTGGTAAAGGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974248215 4:59350243-59350265 AGGTAGATACAAGTGGTGAAAGG + Intergenic
974281439 4:59799836-59799858 GGTTTTATACCAGTGATGCAGGG - Intergenic
974784267 4:66597387-66597409 ACATATATACCAGTGGTGGTAGG - Intergenic
976856509 4:89610388-89610410 GGGGAGAAACCAGTGGTGGGCGG - Intergenic
977337650 4:95718658-95718680 GGGTATAAAACAATGGTGGAAGG - Intergenic
980117619 4:128694840-128694862 TGGTGTTTACCAGGGGTGGAGGG + Intergenic
980336841 4:131486307-131486329 GGGTTTATTCCAGTCATGGAAGG - Intergenic
981061032 4:140426035-140426057 TGGAATATACCAGTGTTGGTCGG - Intronic
981115697 4:140988640-140988662 GGGTATATACTTGGGGTGGGGGG - Intronic
983595741 4:169465320-169465342 GGTTAAATTCCAGTGGTGGGGGG - Intronic
988567911 5:32334635-32334657 GGGTATCTACCTATGTTGGAAGG + Intergenic
988983497 5:36595105-36595127 GAGTATAAAGCAGTGGAGGAAGG + Intergenic
990879768 5:60526252-60526274 TGGTGAATACTAGTGGTGGAAGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991039433 5:62160506-62160528 TTGTATATACCAGAGGTGGGAGG + Intergenic
992165712 5:74049224-74049246 GGGTATATAGCGGTGGAGGGAGG - Intergenic
993607019 5:90003909-90003931 GGGTTTATACCAGGGATGTAAGG + Intergenic
1001538468 5:172518274-172518296 GGGTAAATTCCACTGGTGGTGGG - Intergenic
1003829660 6:9993816-9993838 GTGTAAATCCCAGAGGTGGAAGG - Intronic
1004925964 6:20415412-20415434 GGGCAGTTAACAGTGGTGGAGGG + Intronic
1007849057 6:44786128-44786150 GTGTATATGACAGTGGTGGCAGG - Intergenic
1008785789 6:55166153-55166175 GGATTTATCCCAGGGGTGGAAGG - Intronic
1009589380 6:65646337-65646359 GGGTTTATACCAGGGATGCAGGG + Intronic
1012786513 6:103635269-103635291 GGTTTCATACCAGTGGTGCAGGG + Intergenic
1014481747 6:121947614-121947636 GGTTATATACCAGGGATGCAGGG - Intergenic
1021834631 7:24657218-24657240 GAGTATATACCAGGGGTTGAAGG + Intronic
1023076561 7:36488735-36488757 GGGTATATACCAGAGATTGCTGG + Intergenic
1023243352 7:38174234-38174256 GGGTATATCCTAGTAATGGAAGG - Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1023853200 7:44162286-44162308 GGGAACAGGCCAGTGGTGGAAGG - Intronic
1026667548 7:72356477-72356499 GGATATATACCAGTGGGTCAAGG + Intronic
1031019262 7:116609367-116609389 GGGTTTTTAACAGTGGGGGATGG + Intergenic
1031386430 7:121157427-121157449 GGGAAGATACCAGTAGAGGAGGG + Intronic
1038054709 8:23847430-23847452 GGGTAGATTCCAGTGGGGGTGGG - Intronic
1051400795 9:16679874-16679896 CAGTGGATACCAGTGGTGGAAGG - Intronic
1051678632 9:19583737-19583759 GTTTATACTCCAGTGGTGGAAGG + Intronic
1052605812 9:30699325-30699347 TGTTATGTACCAGAGGTGGATGG - Intergenic
1054815124 9:69467159-69467181 GGGAATAAACCAGTTCTGGATGG + Intronic
1055308611 9:74955010-74955032 GGGTATGTGCCAGTGGGGAAGGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1188895054 X:35657327-35657349 GGTTTTATACCAGAGGTGCAGGG - Intergenic
1192993654 X:76488899-76488921 GGTTTTATACCAGTGATGCAGGG - Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1202173744 Y:22078690-22078712 GTGTATATACCTGAGGTGGGGGG - Intronic
1202217617 Y:22507692-22507714 GTGTATATACCTGAGGTGGGGGG + Intronic
1202325568 Y:23688367-23688389 GTGTATATACCTGAGGTGGGGGG - Intergenic
1202545203 Y:25981687-25981709 GTGTATATACCTGAGGTGGGGGG + Intergenic