ID: 1168387110

View in Genome Browser
Species Human (GRCh38)
Location 19:55973463-55973485
Sequence ATGTGGGAATGGTGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 8, 3: 90, 4: 571}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168387110_1168387116 8 Left 1168387110 19:55973463-55973485 CCTTCATCCCACCATTCCCACAT 0: 1
1: 0
2: 8
3: 90
4: 571
Right 1168387116 19:55973494-55973516 CTGTCCTTTCCTTGAAAGCTTGG 0: 1
1: 0
2: 3
3: 27
4: 239
1168387110_1168387119 21 Left 1168387110 19:55973463-55973485 CCTTCATCCCACCATTCCCACAT 0: 1
1: 0
2: 8
3: 90
4: 571
Right 1168387119 19:55973507-55973529 GAAAGCTTGGAAGTCCTGAGTGG 0: 1
1: 0
2: 4
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168387110 Original CRISPR ATGTGGGAATGGTGGGATGA AGG (reversed) Intronic
900088284 1:908809-908831 AGGGGGGAAGGGAGGGATGAGGG + Intergenic
900993191 1:6107192-6107214 ATGGAGGGATGGAGGGATGATGG + Intronic
900993197 1:6107211-6107233 ATGGAGGGATGGAGGGATGATGG + Intronic
900993245 1:6107409-6107431 ATGGAGGGATGGAGGGATGATGG + Intronic
900993250 1:6107428-6107450 ATGGAGGAATGAAGGGATGAGGG + Intronic
900993307 1:6107683-6107705 ATATAGGGATGGAGGGATGATGG + Intronic
900993327 1:6107765-6107787 ATGGAGGGATGGAGGGATGATGG + Intronic
900993346 1:6107851-6107873 ATGGAGGGATGGAGGGATGATGG + Intronic
900993409 1:6108055-6108077 ATGGAGGGATGGAGGGATGATGG + Intronic
900993622 1:6108914-6108936 ATGGAGGGATGGAGGGATGAAGG + Intronic
901040033 1:6358251-6358273 AAGAGGGAAGGGTGGGAGGAAGG + Intronic
901421314 1:9153095-9153117 ATGTGGGTGTGGGGGCATGAAGG + Intergenic
901621208 1:10589281-10589303 ATATGGGAATGAGGTGATGAGGG + Intronic
902343513 1:15799760-15799782 ATGTGGGAAGTGCAGGATGAGGG + Intergenic
902450038 1:16491092-16491114 ATGTGGGGATGGGGAGCTGATGG + Intergenic
902912232 1:19608275-19608297 CCGTGTGACTGGTGGGATGAAGG + Intronic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
905467597 1:38167048-38167070 AGGTGGGAATGGAGTGAGGAGGG + Intergenic
906658274 1:47564513-47564535 ATGAGTGAGTGGGGGGATGAGGG + Intergenic
908148913 1:61279190-61279212 ATGTTGGTATTGTGGGGTGAAGG + Intronic
908206620 1:61856934-61856956 ATTTGGGAATGGTGTCAAGATGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908755991 1:67469222-67469244 ATATGAGAATGATGGGATGGGGG + Intergenic
908796834 1:67838520-67838542 GTGTGGGAAGGGTGTGATGAGGG - Intergenic
908990976 1:70088882-70088904 ATGGGGGAATGATGGCATTAGGG - Intronic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910705168 1:90121987-90122009 GTGTGTGTATAGTGGGATGATGG + Intergenic
910771801 1:90838740-90838762 ATGTGGGAAAGGTGGTCTGTAGG - Intergenic
911754446 1:101536817-101536839 GTGTGGAAAGGGTGGGAAGACGG + Intergenic
912778541 1:112522863-112522885 ATGAGCCAATGGTGGGATTAAGG + Intronic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
915914167 1:159931268-159931290 AGGGGGGAATGGAGGGATGGTGG + Intronic
916620569 1:166492020-166492042 ATGTGAGACAGGTGGGAGGAAGG + Intergenic
917072585 1:171168783-171168805 ATTAGGGAAGGGTGAGATGATGG - Intergenic
917138024 1:171806533-171806555 GGGTGGGAAAAGTGGGATGAAGG - Intronic
917610731 1:176686451-176686473 ATGTGGGGATTATGGGATTATGG + Intronic
917656555 1:177131999-177132021 ATGTGGCAATGTTGGGAGGTGGG - Intronic
917742604 1:177975644-177975666 AAGTGGGAATGATGAGATAATGG + Intronic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
917782339 1:178411720-178411742 CCGTGTGACTGGTGGGATGAAGG + Intronic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
918677776 1:187309665-187309687 ATATGGGGAGGGTGGGGTGAAGG + Intergenic
918782399 1:188718155-188718177 AAGAGGGAAGGGTGGGAGGAGGG - Intergenic
918978903 1:191529007-191529029 ATGGGGGAATGGTTGGTTGATGG - Intergenic
919883807 1:201918227-201918249 ATGTTAGGAAGGTGGGATGAAGG - Intronic
920273177 1:204782548-204782570 ATGTGGCTATGGCTGGATGAAGG - Intergenic
920379301 1:205526541-205526563 GAGTGGGAGTAGTGGGATGAGGG + Intronic
920654608 1:207866518-207866540 AGGTGGGCAGGGTGAGATGATGG - Intergenic
921682568 1:218051753-218051775 ATGTAGGTATGATGGGATAAGGG - Intergenic
922384289 1:225066644-225066666 AGGTGGGAAGGGTGGGAGGGGGG - Intronic
923065597 1:230514415-230514437 ATGTGGCAATGTTGGGAGGTGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924638902 1:245814793-245814815 GTGTGTGCATGGTGGGATAAGGG - Intronic
1063157240 10:3391013-3391035 ATGTGGGGATGGAGGAATGGGGG + Intergenic
1063381517 10:5588952-5588974 ACTTGGGAATGGGGAGATGATGG + Intergenic
1063613438 10:7582392-7582414 ACTTGGTAATGGTGGGATGTTGG - Intronic
1064191923 10:13214148-13214170 ATGGGGGAATGGTTGGTTGATGG - Intergenic
1065161211 10:22924463-22924485 ATGAGGGAAATTTGGGATGATGG + Intergenic
1065777181 10:29131881-29131903 ATGTTGGGATGGTGGGATGAAGG + Intergenic
1065941726 10:30570855-30570877 ATGTTGAAATGGAGTGATGAGGG + Intergenic
1066016355 10:31248116-31248138 ATCTGAGAATGGAGGGAGGAAGG - Intergenic
1066323983 10:34336295-34336317 ATCTGGGAATGGTGGAAGCATGG - Intronic
1067172977 10:43922742-43922764 ATGTAGGAATTGTGGGGTGCAGG - Intergenic
1067377147 10:45738113-45738135 ATGTGGGAACTGGGGGATGGTGG + Intronic
1067884855 10:50078805-50078827 ATGTGGGAACTGGGGGATGGTGG + Intronic
1068634792 10:59336901-59336923 ATGTGGAAAGGATGGGGTGATGG - Intronic
1068840302 10:61605956-61605978 ATGTGGGCATTTGGGGATGATGG + Intergenic
1069273847 10:66565388-66565410 ATGTGGGAACTGAGAGATGAGGG + Intronic
1069595968 10:69670436-69670458 TTGAGTGAATGGTGGCATGAAGG + Intergenic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070763237 10:79038907-79038929 ATGTGGCCATGGTGGGAGGTGGG + Intergenic
1071472240 10:85991851-85991873 ATGTGGAAAATGTGGGAGGAGGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072693101 10:97584363-97584385 AGCTGGGAATTGTGGGAGGAGGG + Exonic
1072798606 10:98375697-98375719 ATGTGACAACGGTGGGATGGAGG - Intergenic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073522586 10:104147778-104147800 ATGTAGGAATGGTGCAAGGAAGG + Intronic
1073753709 10:106558664-106558686 ATATGGGACTGGTCAGATGATGG - Intergenic
1074758278 10:116644197-116644219 ATGTGCGGGTGGAGGGATGATGG - Intronic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1076034080 10:127184456-127184478 ATGGGGGAATGGAGAGCTGAGGG - Intronic
1076297087 10:129394594-129394616 AGGTGGCAATTGTGGGAAGAGGG - Intergenic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1078590952 11:12640817-12640839 ATGTGGTGATGGGGGGATGGTGG - Intergenic
1079140500 11:17806178-17806200 ATGTGCGAATGATGGGAACAAGG - Intronic
1080096083 11:28408456-28408478 AAGTGGAAATGGTGGAGTGAAGG - Intergenic
1080415223 11:32063686-32063708 ATGGAGGAATGGAAGGATGAAGG - Intronic
1081038147 11:38176482-38176504 TTATGGGCATGGTGGGCTGAAGG - Intergenic
1081481325 11:43492153-43492175 ACGTGGCAATGGTGAGATGGGGG + Exonic
1081855274 11:46299416-46299438 ATGTGGGAAGGGAGTGATGCAGG - Intronic
1084410161 11:69002260-69002282 ATGTGGGAAGGGTGGGGTGAAGG - Intergenic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084781886 11:71415141-71415163 ATGGGTGAATGGATGGATGATGG + Intergenic
1085627797 11:78086710-78086732 ATGGTGGAATGGTGGAATGTTGG - Intergenic
1085920994 11:80957109-80957131 ATGGGAGAAGGGTGGGATGATGG - Intergenic
1086193985 11:84115214-84115236 CAGTGAGAATGGTGGGCTGAGGG - Intronic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1086824169 11:91475225-91475247 GTGTGGGAATGGTTGCATGGAGG + Intergenic
1087402578 11:97685894-97685916 ATGTTGCAATGTTGGGATGTGGG + Intergenic
1087542283 11:99534904-99534926 ATGTGTGAAAGGTGGTATGTTGG + Intronic
1089160219 11:116431729-116431751 AGGTGGGTAGGGTGGGATGGGGG - Intergenic
1089685061 11:120141521-120141543 ATGTTGGGGTGGTGGGACGAGGG - Intronic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1089870336 11:121666986-121667008 ATCAGGGTATAGTGGGATGATGG - Intergenic
1091072664 11:132583155-132583177 AGGTGGGAGAGGTGGGAGGATGG - Intronic
1091965566 12:4738244-4738266 ATTTGTGTATGGTGTGATGAGGG - Intronic
1092098769 12:5865806-5865828 ATGATGGTATGGTGGCATGATGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092602061 12:10078031-10078053 TTGTGGAAATGATGGCATGATGG - Intronic
1092762001 12:11818903-11818925 ATGTGGGTAGGGTAGGCTGAGGG - Intronic
1093263667 12:16973311-16973333 GTGTGCACATGGTGGGATGATGG + Intergenic
1094004040 12:25727933-25727955 ATGTTGGAATTATGTGATGAAGG + Intergenic
1094755295 12:33462447-33462469 ATGTGGGATTGCTGGCAAGATGG + Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095464332 12:42475084-42475106 AGGAGGGGATGGTGGGATGGTGG - Intronic
1095943113 12:47739104-47739126 AGGGGGGAATGGAGGGATGGAGG + Intronic
1096814005 12:54190148-54190170 ATGGGGGAATGGTGGGGGAATGG - Intergenic
1097091617 12:56509980-56510002 AAGTGGGACTGTTGGGTTGAAGG + Intergenic
1097508679 12:60507947-60507969 CTGTGGGCATGGTGTGATGGAGG + Intergenic
1098171187 12:67748931-67748953 ATGTGGAAGGGGTGGGGTGAAGG + Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098390902 12:69969015-69969037 ATTTGAGAGTGGTGGGATGGGGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1100382694 12:94076327-94076349 AGGTTGGAATGGTGTGAGGAAGG + Intergenic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1100551986 12:95654615-95654637 ATGATGGGATGTTGGGATGATGG + Intergenic
1100551988 12:95654623-95654645 ATGTTGGGATGATGGGATGATGG + Intergenic
1100551990 12:95654631-95654653 ATGATGGGATGATGGGATGATGG + Intergenic
1100551992 12:95654639-95654661 ATGATGGGATGATGGGATGATGG + Intergenic
1100552000 12:95654679-95654701 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552002 12:95654687-95654709 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552004 12:95654695-95654717 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552006 12:95654703-95654725 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552014 12:95654743-95654765 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552016 12:95654751-95654773 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552018 12:95654759-95654781 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552020 12:95654767-95654789 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552024 12:95654783-95654805 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552026 12:95654791-95654813 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552029 12:95654807-95654829 ATGTTGGAATGTTGGGATGATGG + Intergenic
1100552031 12:95654815-95654837 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552041 12:95654855-95654877 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552046 12:95654879-95654901 ATGTGAGGATGTTGGGATGTTGG + Intergenic
1100552048 12:95654887-95654909 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552050 12:95654895-95654917 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552054 12:95654911-95654933 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552057 12:95654919-95654941 ATGTTGGGATGATGGGATGTGGG + Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552063 12:95654943-95654965 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552067 12:95654959-95654981 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552069 12:95654967-95654989 ATGTTGGGATGATGGGACGATGG + Intergenic
1100552075 12:95654991-95655013 ATGTTGGGATATTGGGATGATGG + Intergenic
1100552079 12:95655007-95655029 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552081 12:95655015-95655037 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552083 12:95655023-95655045 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552085 12:95655031-95655053 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552087 12:95655039-95655061 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552089 12:95655047-95655069 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552096 12:95655079-95655101 ATAATGGAATGTTGGGATGATGG + Intergenic
1100552098 12:95655087-95655109 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552103 12:95655111-95655133 ATGTGAGGATGTTGGGATGTTGG + Intergenic
1100552105 12:95655119-95655141 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552107 12:95655127-95655149 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552111 12:95655143-95655165 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552113 12:95655151-95655173 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552117 12:95655167-95655189 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552120 12:95655175-95655197 ATGTTGGGATGATGGGATGTGGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552126 12:95655199-95655221 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552128 12:95655207-95655229 ATGATGGGATGATGGGATGATGG + Intergenic
1100552132 12:95655223-95655245 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552134 12:95655231-95655253 ATGTTGGGATGATGGGACGATGG + Intergenic
1100552140 12:95655255-95655277 ATGTTGGGATATTGGGATGATGG + Intergenic
1100552144 12:95655271-95655293 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552146 12:95655279-95655301 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552148 12:95655287-95655309 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552150 12:95655295-95655317 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552154 12:95655311-95655333 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552156 12:95655319-95655341 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552159 12:95655335-95655357 ATGATGGCATGTTGGGATGATGG + Intergenic
1100552161 12:95655343-95655365 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552165 12:95655359-95655381 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552167 12:95655367-95655389 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552169 12:95655375-95655397 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552171 12:95655383-95655405 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552181 12:95655423-95655445 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552188 12:95655447-95655469 ATGTGGGGATGTTGGGATGTTGG + Intergenic
1100552190 12:95655455-95655477 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552192 12:95655463-95655485 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552196 12:95655479-95655501 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552198 12:95655487-95655509 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552202 12:95655503-95655525 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552205 12:95655519-95655541 ATGATGGCATGTTGGGATGATGG + Intergenic
1100552207 12:95655527-95655549 ATGTTGGGATGATGGGATGATGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102438883 12:112946527-112946549 ATGGGGGAGTGGTGGGAGGGAGG - Intronic
1102640254 12:114360735-114360757 ATGGGTGAATGGTGGGTGGATGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103812099 12:123623234-123623256 AGCTGGGCATGGTGGGATGGGGG + Intronic
1103971366 12:124674714-124674736 ATGAATGAATGTTGGGATGAAGG - Intergenic
1104356279 12:128089795-128089817 ATGTGGGCATGGTGGAGGGAGGG + Intergenic
1104488480 12:129172935-129172957 ATGGGGGAATGGTGGGTTGGTGG + Intronic
1104896313 12:132166671-132166693 ATGGGTGAATGGATGGATGATGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105324273 13:19355849-19355871 ACGTGGGTATGTGGGGATGAGGG - Intergenic
1105580352 13:21689940-21689962 ATGTGGGAGAGGTGAGAGGAAGG - Intronic
1105888786 13:24666816-24666838 ACGTGGCAAGGGTGAGATGAAGG + Intergenic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1106350831 13:28929166-28929188 GTGGGGGAAGGGTGGGTTGAAGG + Intronic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107421363 13:40249959-40249981 ATGTGGCAATGTTGGGAGGTGGG - Intergenic
1107756595 13:43630087-43630109 TGGTGAGAATGGTGGGATTAGGG - Intronic
1109881074 13:68476951-68476973 AAAGGGGAATGGTGGGATGGAGG + Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112109657 13:96282191-96282213 ATGTGAGAATGTTGGAATGGAGG + Intronic
1112138814 13:96614495-96614517 TGGTGGGGATGGTGGGTTGAAGG + Intronic
1112430514 13:99346609-99346631 ATGTGGGAGGGGTGGGGTGAAGG - Intronic
1112928803 13:104710726-104710748 ATGTGGGGCAGGTGGGAGGAGGG + Intergenic
1113663055 13:112120161-112120183 ATGAGGGAAGGGTGGGAGGCAGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113717882 13:112526569-112526591 ATGTGGTGATGGTGTGATTATGG - Intronic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1114428926 14:22643884-22643906 ATCTGGAAATGGTAGGATGAGGG + Intergenic
1114614032 14:24059014-24059036 ATGGGTGAATGATGGGATGAGGG - Intronic
1114661993 14:24352621-24352643 ATGTGGGAAGGGTGGGAGCGGGG + Intergenic
1114834218 14:26184523-26184545 ATGTGGGAAAGGTGGTACCAGGG - Intergenic
1115309030 14:31961064-31961086 AGCTGGGCATGGTGGCATGATGG - Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1117612139 14:57494820-57494842 ATTTTTGAATGGTGGGATTATGG + Intergenic
1117885913 14:60362618-60362640 ATGAGGGACTGGTGAGTTGAGGG - Intergenic
1118070665 14:62243725-62243747 TTGTGGGAATGTTGGGATTGGGG + Intergenic
1118296967 14:64579112-64579134 AGGTGGGAATGGTAGGAGGAGGG + Intronic
1118445914 14:65851171-65851193 ATTTGGGAAAGTTGGGATGCGGG - Intergenic
1118744054 14:68761489-68761511 AGGTAGGACAGGTGGGATGAGGG - Intergenic
1119889613 14:78173115-78173137 ATGAGAGAATGGTGGGAGAACGG + Intergenic
1120085695 14:80270215-80270237 ATGGGGGAATACTAGGATGAGGG - Intronic
1120718325 14:87864120-87864142 ATGTCTGGATGGTGGGATTAGGG + Intronic
1121124841 14:91399365-91399387 ATGTGGGAATCCAGGGCTGAGGG - Intronic
1121296246 14:92827481-92827503 ATGTGGGAATGGCCAGTTGATGG - Intronic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121627177 14:95394421-95394443 ATGAGTGAATGGAGGGTTGAAGG + Intergenic
1121794981 14:96727340-96727362 ATGTGGGCATGTGGGGATGTGGG + Intergenic
1121903700 14:97719917-97719939 AAATGGTAATGGTGAGATGATGG - Intergenic
1124685433 15:31777949-31777971 AGGTGGAAATGATGGGCTGATGG + Intronic
1124990129 15:34664932-34664954 ATGTGGTAATGGTGGGAGGTGGG + Intergenic
1125666476 15:41434536-41434558 ATGAGAGAATTGAGGGATGATGG + Intronic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1128428139 15:67564352-67564374 ATGTGGAAATGATGGAATCAGGG + Intronic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129889278 15:79060345-79060367 ATGGGACAATGGTGGAATGATGG - Intronic
1129998005 15:80023406-80023428 ATGTGGGAGTGCTGGGAGGGAGG - Intergenic
1130353629 15:83111381-83111403 ATGGGTGAATGGGTGGATGATGG - Intronic
1131063182 15:89416939-89416961 ATGGGGGAAGGGTGGGGTGCGGG - Intergenic
1132761646 16:1511302-1511324 ATGGGGGAATGTGGTGATGAGGG + Intronic
1132803684 16:1766162-1766184 ACGTGGGAATGAGGGGATGGGGG - Intronic
1132819943 16:1859997-1860019 TTGTGGGAGTGGTTGGTTGAGGG - Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133677995 16:8093663-8093685 GTGTGGAAATGGTGGGTTGATGG - Intergenic
1133720053 16:8486311-8486333 ACTTGGGACTGGTGGGTTGATGG + Intergenic
1133910022 16:10057113-10057135 ATGTGTGAATGGATGAATGATGG - Intronic
1134320347 16:13157145-13157167 ATGGGGGGATGGACGGATGATGG - Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135777265 16:25267655-25267677 ATATGGGGAGGGTGGGATGGGGG + Intergenic
1135813939 16:25614877-25614899 AAGTGGAAATCGTGGGATGATGG - Intergenic
1136471916 16:30486580-30486602 ATGTGAGAAAGGTGGAATGAGGG + Intronic
1137054460 16:35736722-35736744 ATGGTGGAATGGTGGAATGTTGG + Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137685795 16:50385951-50385973 ATGTTGGTATGATGGGATGTGGG + Intergenic
1137836020 16:51593562-51593584 ATGTGGGTATGGTGAGCTGGAGG + Intergenic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138277021 16:55742629-55742651 AAGTGGGAAAGGTGGAAAGATGG - Intergenic
1138282917 16:55785806-55785828 AAGTGGGAAAGGTGGAAAGATGG - Intergenic
1138286015 16:55810792-55810814 AAGTGGGAAAGGTGGAAAGATGG + Intronic
1138297176 16:55897039-55897061 ATGCGGGGATGGGGGAATGAGGG - Intronic
1138311854 16:56031757-56031779 AGGGGTTAATGGTGGGATGAAGG - Intergenic
1138544093 16:57705970-57705992 ATGGGAGGATGGTGGGAGGATGG - Intronic
1138544102 16:57705997-57706019 ATGGGAGGATGGTGGGAGGATGG - Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140911571 16:79458061-79458083 ATCTTTGGATGGTGGGATGATGG - Intergenic
1140961455 16:79916857-79916879 ATGCGGACAGGGTGGGATGAAGG + Intergenic
1141105716 16:81232059-81232081 ATGTGGGGAGAATGGGATGAGGG - Intergenic
1142617779 17:1146589-1146611 ATGTGGCAGTGGTGGCATGGTGG - Intronic
1142743823 17:1945140-1945162 AGCTGCGAATGGTGGGGTGAGGG - Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143330797 17:6133588-6133610 ATATGTGAATGGTGTGATAATGG - Intergenic
1143543126 17:7581294-7581316 AGGAGGGAATGGGGGGATGCTGG - Intronic
1143874733 17:9983054-9983076 ACCTCTGAATGGTGGGATGATGG - Intronic
1145998653 17:29118551-29118573 AGTTGGGGATGATGGGATGATGG - Intronic
1146528209 17:33584906-33584928 ATGGTGGATTGATGGGATGATGG + Intronic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1146829581 17:36056956-36056978 ATATTGGTTTGGTGGGATGAGGG - Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147884388 17:43675061-43675083 CTGTGGGCATGATAGGATGATGG + Intergenic
1148763627 17:50022778-50022800 CTCTGGGAATGGGGGGTTGAGGG - Intergenic
1149243789 17:54681845-54681867 ATGTTTGAAGAGTGGGATGAAGG - Intergenic
1149374669 17:56031992-56032014 AGGTGAGGATGGTGGGATTATGG + Intergenic
1149833802 17:59894138-59894160 ACTTGTGAATGGTGGTATGAGGG + Intronic
1150006301 17:61470969-61470991 ATGAGGAAATGGTGGCATGCAGG + Intronic
1150315655 17:64166686-64166708 ATCTCTGAATGGTGGGATGATGG + Intronic
1152309907 17:79543846-79543868 ATGGGGCAAGGGTGGGATGCAGG + Intergenic
1152309919 17:79543878-79543900 ATGGGGCAAGGGTGGGATGCAGG + Intergenic
1152473719 17:80504106-80504128 ATGTGTGGATGGAGGGATGGTGG + Intergenic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1152565578 17:81098965-81098987 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565583 17:81098973-81098995 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565588 17:81098981-81099003 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152570067 17:81117783-81117805 CTGTGGGAAGGGTGGGCTTACGG + Exonic
1153236880 18:2996826-2996848 ATTTGGAGATGGTGGGATGTGGG - Intronic
1153988575 18:10375001-10375023 ATGAGGAAATGGTGGCTTGAAGG - Intergenic
1155523527 18:26693165-26693187 AAGTGGGATTGGTGGGTTTATGG + Intergenic
1155908709 18:31484206-31484228 ATGTGTGATTGGAGGGATGCTGG - Intergenic
1156880202 18:42068603-42068625 ATGTGGGAAAAGTGGGAGGTGGG - Intronic
1157157349 18:45280868-45280890 ATGCTGGGATGGTGGGATGCTGG - Intronic
1157470103 18:47982463-47982485 ATGGGGGGATAGTGGGATGGGGG + Intergenic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1159456799 18:68669471-68669493 ATGTGGTAATGGTGGGAGGCAGG + Intergenic
1159912373 18:74158277-74158299 GTGTGGGAATCATGGGATGTGGG + Intronic
1160159754 18:76462015-76462037 ATGTGGGAAGGGTGGGAGCCAGG - Intronic
1160502519 18:79409294-79409316 ATGGAGGAATGGATGGATGATGG - Intronic
1161328996 19:3677697-3677719 ATGGCGGAATGGAGGGATGGTGG + Intronic
1161328999 19:3677705-3677727 ATGGAGGGATGGTGGGATGGAGG + Intronic
1161329396 19:3678992-3679014 ATGGAGGGATGGTGGGATGGAGG + Intronic
1161657396 19:5524677-5524699 ATACGTGAATGGTCGGATGATGG - Intergenic
1161657498 19:5525098-5525120 ATGGGTGAATGGATGGATGATGG - Intergenic
1163238267 19:16042571-16042593 ATGTGGGAAGGGAAGGGTGATGG - Intergenic
1163241307 19:16065542-16065564 ATGGGGGAGGGGTGGGATAAGGG + Intergenic
1163919739 19:20277326-20277348 ATAGGGTAATGGTGGGAAGAGGG - Intergenic
1164449156 19:28345066-28345088 AGGTGGGAATGGAGGGGTGTGGG + Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1164884692 19:31768408-31768430 ATGTGGGAAGGGGGAGAGGAGGG + Intergenic
1164888781 19:31805346-31805368 AGGCGGGAATGGGGGGAGGAGGG + Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165491500 19:36126043-36126065 AGGTGGGAATGATGAGAAGATGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
1166827416 19:45617997-45618019 ATGTGGGAATGCTGGGACAAAGG + Intronic
1167277630 19:48548449-48548471 ATGAAGGAATGGTTGGGTGATGG + Intergenic
1167598134 19:50437981-50438003 GTGTGAGAATGGTGGGTTAAGGG - Intronic
1167820315 19:51921890-51921912 ATAGGGTAATGGTGGGAAGAGGG - Intronic
1168183379 19:54679282-54679304 AGGGGGGAAGGGTGGGAGGAGGG + Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1168404933 19:56105746-56105768 ATGGGGGAATGTTGTGGTGAGGG - Intronic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
925368417 2:3326446-3326468 AGGTGGGCATGGTGGGAGCAGGG - Intronic
925563566 2:5224842-5224864 TTTTGAGAATGGTGGGATGGTGG - Intergenic
925743731 2:7027957-7027979 ATGCGGGTCTGGTGAGATGAGGG + Intronic
925925719 2:8668548-8668570 ATGAGGGGATGGATGGATGAGGG + Intergenic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926663164 2:15491172-15491194 ATGGAGGAAGGGTGGGAGGAAGG - Intronic
927553211 2:24016532-24016554 GTGTGGGAAGGCTGGGCTGAAGG + Intronic
928986588 2:37188360-37188382 ATGAGACAAAGGTGGGATGAAGG - Intronic
929867551 2:45731035-45731057 ATGTGGGAATAGTGGGAGCCTGG + Intronic
930817206 2:55610403-55610425 ATTTGGGATTGGTGGTAGGAGGG + Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933286185 2:80386984-80387006 ATGTGTTTATGGTAGGATGAGGG + Intronic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933629442 2:84639142-84639164 CTGTGGGCATGGTGGGGTGGGGG + Intronic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
935542770 2:104369187-104369209 ATGGTGGAATGGTGGAATGGTGG + Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936666085 2:114597265-114597287 ATAGGGGAATGGTGGGAATAAGG + Intronic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
936946963 2:117939829-117939851 AAGTGGGAATTGTAGGATAATGG + Intronic
938222796 2:129586498-129586520 AAGGGGTAATGATGGGATGACGG - Intergenic
939012422 2:136862245-136862267 AAGTGGGAAAGGTGGGGTCATGG - Intronic
939115472 2:138055794-138055816 ATATGGGAGTGGTGGGATGGTGG - Intergenic
939875027 2:147568223-147568245 ATGGAGGGATGGAGGGATGAAGG + Intergenic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
941695406 2:168545887-168545909 GTGTGGGAAGGGGAGGATGAGGG + Intronic
944117918 2:196208943-196208965 ATGAATGAATGGTGGGATGCAGG + Intronic
945803863 2:214466004-214466026 ATGTGGGAGGGGTGGCATCAAGG + Intronic
946156184 2:217808225-217808247 ATGGGGGAATGGGGGAATGAGGG - Intronic
946658805 2:221977488-221977510 ATGTGGGGATATTGGGGTGAAGG + Intergenic
946828595 2:223704899-223704921 ATGTGGGGATGATGGTCTGAAGG - Intergenic
947212695 2:227722436-227722458 ATGGGGTAATGGTGGGGAGAGGG + Intergenic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
947837638 2:233187329-233187351 ATGAGGGAGGGGTGGAATGAAGG + Intronic
947888148 2:233592613-233592635 ATGCTGGAGTGGGGGGATGAGGG - Intergenic
947977927 2:234383956-234383978 ATGTGGCAATGGTGGTTTCAGGG - Intergenic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
948790075 2:240372455-240372477 ATGTGGGAGGGATGGGAAGAGGG + Intergenic
1170113608 20:12832416-12832438 ACATGGAAATGGTGGGCTGATGG - Intergenic
1170195500 20:13685046-13685068 ATGGGGGAAGGGTGAGAAGATGG - Intergenic
1170243981 20:14200381-14200403 AGGTTGGGATGTTGGGATGAGGG + Intronic
1170910620 20:20563653-20563675 ATGTGGGCATGATAGGATAAAGG - Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171535213 20:25881259-25881281 AGGAGGGAATGCTGGGAGGAAGG + Intergenic
1171572643 20:26268637-26268659 AGGAGGGAATGCTGGGAGGAAGG - Intergenic
1171805834 20:29679631-29679653 AGGAGGGAATGCTGGGAGGAAGG - Intergenic
1171838228 20:30176804-30176826 AGGAGGGAATGCTGGGAGGAAGG + Intergenic
1172413899 20:34748394-34748416 TTGTGGGAAGGCTGGGATAAAGG + Intronic
1172619029 20:36307408-36307430 ATGGAGGGATGGAGGGATGAAGG - Intronic
1172626415 20:36350044-36350066 ATGTGGGAACTGTGAGATGCTGG - Intronic
1172934339 20:38609092-38609114 ACATGGCAAAGGTGGGATGAAGG - Intronic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173663858 20:44751946-44751968 ATGAGGGAAAGGTGGGTGGATGG + Exonic
1173665602 20:44760915-44760937 ATGTGGGCAGGGGGGGATGTGGG + Intronic
1173823630 20:46033710-46033732 ATGGGTGAATGGTTGGATGATGG - Intronic
1174254730 20:49246142-49246164 AAGAGGGAGTGTTGGGATGAAGG + Exonic
1174468970 20:50741406-50741428 ATGTGGTAAAGGTGGGAAGGTGG - Intronic
1175442892 20:59003373-59003395 AGATGGGGCTGGTGGGATGAAGG - Intronic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181587831 22:23863497-23863519 AACTGGGAATGATGGGATGTGGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181975130 22:26723384-26723406 ATGTGGGAAGTGTGGGTTTATGG + Intergenic
1182039081 22:27222380-27222402 ATGGGTGAATGGATGGATGATGG + Intergenic
1182282748 22:29226609-29226631 AGGTGGGGAGGGTGGGATGGTGG - Intronic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182666596 22:31964664-31964686 ATGTGTGTGTGGTGGGGTGAGGG + Intergenic
1182750074 22:32634456-32634478 ATATGGGAATGAGGGGTTGACGG + Intronic
1182789404 22:32937155-32937177 ACGTGGAAATGGAGAGATGATGG + Intronic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183112001 22:35657281-35657303 ATGGGGAAGGGGTGGGATGAAGG - Intronic
1183226152 22:36551283-36551305 ATGGGGGGATGGATGGATGACGG - Intergenic
1183303966 22:37072144-37072166 ATGGGTGAATGGATGGATGATGG + Intronic
1184073392 22:42161102-42161124 AGGGGGGAGGGGTGGGATGATGG - Exonic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184293397 22:43509689-43509711 ATGGAGGGATGGAGGGATGAAGG - Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
1185362632 22:50417766-50417788 ATGTGGGTGTTGTGGGCTGATGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949310665 3:2694216-2694238 AAGTGGGAATGGTAGGAGCAAGG - Intronic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949683519 3:6541927-6541949 ATGTGGGATTGCTGGCAAGATGG - Intergenic
950753660 3:15153927-15153949 CTATGGTAATGGTGGAATGATGG - Intergenic
951113138 3:18829684-18829706 ATGTGGGAAATGTGAAATGAAGG + Intergenic
951630699 3:24716727-24716749 AGGTGGGATTGGGGGGAGGAAGG + Intergenic
951851790 3:27149640-27149662 ATGGGGGAATGGCTGGTTGATGG - Intronic
952273419 3:31854363-31854385 ATGTGGGAAAGGAGGCATTATGG - Intronic
952307669 3:32160308-32160330 ATGGGTGAATGGATGGATGATGG + Intronic
952307703 3:32160427-32160449 ATGGGTGAATGGATGGATGATGG + Intronic
952307733 3:32160533-32160555 ATGGGTGAATGGATGGATGATGG + Intronic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
954468470 3:50672691-50672713 GAGAGGGAATGGGGGGATGAGGG + Intergenic
954704034 3:52469270-52469292 ATGTGGGGGTGGGGGGCTGAGGG + Intronic
954945980 3:54424749-54424771 ATGTGGGGATGGGAGGATGCAGG - Intronic
955103986 3:55878396-55878418 ATGGGGAGATGGTGGGAGGAAGG - Intronic
955880148 3:63534939-63534961 ATGTGGCAATGTTGGGAGGTGGG - Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
959025277 3:101233709-101233731 ATGTGGGAACTGTGGCAGGATGG - Intronic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960119048 3:113927783-113927805 AAGTGGGACTGTTGGGCTGAAGG + Intronic
960363371 3:116741555-116741577 AATTGGGAAGGGTGGGAGGAAGG - Intronic
961807623 3:129500736-129500758 GTGTGGGAATGGGAGGGTGAAGG + Intronic
964282170 3:155079448-155079470 TTTTGGGAATGGTGAGATGGGGG + Intronic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
964803048 3:160575116-160575138 ATGGTGGAATGGTGGCATGGTGG + Intergenic
965800603 3:172489795-172489817 ATGGAGGAATGGGGAGATGATGG + Intergenic
966026545 3:175290477-175290499 ATTTGGGAGTTGGGGGATGATGG + Intronic
967077762 3:186019900-186019922 GTGTGCGAAAGGTGGGAGGAGGG + Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968375201 4:34376-34398 ATGGGGGGAGGGTGGGAGGAGGG - Intergenic
969241950 4:5904843-5904865 ATGAGGGGATGATAGGATGATGG - Intronic
969450113 4:7268212-7268234 AAGTGGGAGTGAAGGGATGAAGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969612300 4:8234220-8234242 ATGGGTGAATGGATGGATGATGG - Intronic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
970347022 4:15162229-15162251 ATGTGGGAGTGGTGTGATAATGG + Intergenic
972277520 4:37571011-37571033 ACGTGGGAATGAAGGCATGATGG - Intronic
972404441 4:38733185-38733207 TGGTGGTAATGGTGGGATGGTGG + Intergenic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
975468455 4:74736170-74736192 ATGTGAAAATGGTGAGATAAGGG - Intergenic
976002461 4:80388092-80388114 TGGTGGGAATGGTGTGGTGAAGG - Intronic
976672551 4:87669920-87669942 ATGTGGGAATGGCGGGGGGGAGG + Intergenic
976961400 4:90980645-90980667 ATTTTGTAATGGTGAGATGAAGG + Intronic
978148598 4:105407869-105407891 ATGTGGGAATTTGGGGGTGATGG + Intronic
979989374 4:127356410-127356432 ATGTAGGATTGCAGGGATGATGG - Intergenic
981045485 4:140261319-140261341 CTGTTGGAGTGGTGGGGTGATGG - Intronic
981148483 4:141353517-141353539 ATGTTGGAATGGGAGGATAAAGG + Intergenic
983666873 4:170192784-170192806 AGCTGGGAATGGAGGGACGATGG + Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
983917957 4:173312551-173312573 ATGTGGCAATGCTGGGAGGCAGG - Intronic
984212184 4:176863453-176863475 AAGTGTGAAGGGTGGGATGAGGG + Intergenic
984391458 4:179139220-179139242 ATGTTGGAATAGAGGGGTGATGG - Intergenic
985269423 4:188179748-188179770 ATGTGGGAGGGGTAGGATAAGGG + Intergenic
985459842 4:190094668-190094690 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
986437472 5:7748134-7748156 AGCTGGCAATGGTGAGATGAAGG - Intronic
986452761 5:7882460-7882482 ATATGGGAAAGCTGGGATGAAGG - Intronic
986593989 5:9401542-9401564 CTTTGGCAATGGTGGAATGAGGG - Intronic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987430331 5:17825007-17825029 ATGTGGGGATTATGGGATTATGG + Intergenic
988348533 5:30070632-30070654 AAGTGGGGAGGGTGGGAGGAGGG - Intergenic
988403668 5:30796214-30796236 AGGAGGGAATGGGGAGATGATGG + Intergenic
988799875 5:34686338-34686360 ATGTGGGAGTGGGGGGTTGGGGG + Intronic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989186766 5:38633540-38633562 ATGTGGGACTGGTTTTATGATGG + Intergenic
990236427 5:53772830-53772852 ATGTGGGATGGGCGGGAGGAGGG + Intergenic
991146826 5:63316785-63316807 ATGGGGGAAGAGTGGGAGGAGGG + Intergenic
991240875 5:64458705-64458727 GTGTGGCTATGGTGGGATGCTGG - Intergenic
992087498 5:73291134-73291156 CTTTGGGAATAGTGGGATGCAGG + Intergenic
993125845 5:83834834-83834856 ACCTGGAAATGGTGGAATGATGG - Intergenic
993481391 5:88429293-88429315 GTTTGGGAAAGGTGGGATTATGG - Intergenic
994570326 5:101506282-101506304 GTGTGGGCATGGTGGGCTGCAGG - Intergenic
995000153 5:107118321-107118343 ATGTGGGAGTGGTAGCATCAAGG - Intergenic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
995852693 5:116562720-116562742 CCGTGTGACTGGTGGGATGAAGG + Intronic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998387659 5:141767129-141767151 ATGTGTGAATGGGTGAATGAAGG + Intergenic
999294049 5:150446929-150446951 CCGTGTGACTGGTGGGATGAAGG - Exonic
999750331 5:154623845-154623867 AAGTGGGCATGGTGGGGTGGGGG - Intergenic
1001190956 5:169630762-169630784 AAGGGGAAATGGTGGGAAGAGGG - Intergenic
1001751445 5:174134588-174134610 ATGGGTGAATGGATGGATGATGG - Intronic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002791611 6:441488-441510 GTGTGGGAATGGAGGGCTGTGGG - Intergenic
1003111471 6:3255006-3255028 ATGTGGGAGCGCTGGGATAATGG + Intronic
1003533645 6:6957462-6957484 ATGAGTGAATGATGGGAGGATGG - Intergenic
1003795380 6:9596903-9596925 ATGTCGGAAAGATGGCATGAAGG - Intronic
1004920378 6:20370355-20370377 ATGTGGGAAGGATGGGCTCAAGG - Intergenic
1005681680 6:28215209-28215231 ATGTTGGAATGATGAGAGGAAGG - Intergenic
1005703311 6:28426420-28426442 ATGGGGGAATGGTTGGTTGGTGG + Intergenic
1005753906 6:28908720-28908742 AAGTGGGAAACGTGGGATAAGGG - Intronic
1006905333 6:37529490-37529512 ATGAAGGAATGGAGTGATGAAGG - Intergenic
1007691308 6:43703166-43703188 ATGGGGGCACGTTGGGATGAGGG + Intergenic
1007761324 6:44135223-44135245 ATGTGGGCATGGGGGCATGAGGG + Intronic
1008070119 6:47091084-47091106 AGATGGGAATGGTGAGGTGAAGG - Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1009867933 6:69420126-69420148 ATGTGGGAAATGTGGCAAGAGGG + Intergenic
1010181985 6:73097213-73097235 TTGGGGGAATGGGGAGATGATGG - Intronic
1010333827 6:74657360-74657382 ATGTGGAGATGGTGGTAGGAAGG + Intergenic
1010743125 6:79530356-79530378 AAGGGTGAAGGGTGGGATGAGGG + Intronic
1011700414 6:89950184-89950206 ATGTGGGAGTGGTGGGGGGCAGG + Intronic
1011904572 6:92348481-92348503 AGGTGTGAAAGGTGAGATGAAGG + Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1012601421 6:101102388-101102410 AGGGGGAAAAGGTGGGATGAGGG - Intergenic
1012730920 6:102878667-102878689 ATGTTTGAATGAGGGGATGAAGG + Intergenic
1012846172 6:104392320-104392342 AGGGGGGAATGGGGAGATGATGG + Intergenic
1013044445 6:106470346-106470368 ATGAAGGAATGGTAGGCTGAGGG - Intergenic
1013187032 6:107768278-107768300 GTGTGGGAAGGCTGGTATGATGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015077253 6:129173332-129173354 ATGTATGGATGGTGGAATGAAGG - Intronic
1015585092 6:134768432-134768454 GTGTGGGAAAGATGAGATGATGG - Intergenic
1016490846 6:144600113-144600135 AGATGGGAATGGTGTGTTGATGG - Intronic
1018638802 6:165888181-165888203 GTTTGGGAATGCTGGGATGGAGG - Intronic
1018847161 6:167563657-167563679 ATGAGGGAATGCATGGATGAAGG - Intergenic
1018847198 6:167563817-167563839 ATGTGTGAATGAGGGAATGAGGG - Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019303617 7:322143-322165 ATCTGGAAAGGGTGGGATGACGG - Intergenic
1019567252 7:1690425-1690447 ATGGGTGAATGGATGGATGAAGG + Intronic
1019567328 7:1690785-1690807 ATGGGTGAATGGATGGATGAAGG + Intronic
1020019584 7:4855149-4855171 ATGAGGGAATGGCTGGATGGTGG - Intronic
1020654285 7:10911168-10911190 ATGTGGGTATGGTGCCATGGAGG - Intergenic
1021316743 7:19157297-19157319 ATTTGGGAAGGGTGGGAGGTGGG - Intergenic
1021780754 7:24103400-24103422 GTGTGAGAGTGGTGGAATGATGG + Intergenic
1022281689 7:28917241-28917263 TTTTGTGAATGGTGAGATGAGGG - Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022543342 7:31160311-31160333 ATGTGGGAGGGGTGGGAGGTGGG - Intergenic
1023777769 7:43625549-43625571 ATGTGAGTGTGGTGTGATGAGGG - Exonic
1024254331 7:47528493-47528515 ATGTGGGAGTGGTGGGGGGCAGG - Intronic
1025921128 7:65914244-65914266 AGTTGGGCATGGTGGTATGATGG - Intronic
1026392565 7:69916693-69916715 ATGTAAGAATGGGGGGAAGAGGG - Intronic
1027626976 7:80558117-80558139 AAGTGTGAAGGGTGGGAGGAGGG - Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029221853 7:98996124-98996146 AGGTGTGTATGATGGGATGAGGG - Intronic
1029737227 7:102471733-102471755 ACGGGGGAATGGGGGAATGAGGG - Intronic
1030782040 7:113612774-113612796 TTGTTGTAATGATGGGATGAGGG - Intergenic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1034071241 7:148187962-148187984 ATGCGGGGATGGTGGGGTGGTGG - Intronic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1035242167 7:157539376-157539398 CTGTGGGAAGGGCGGGATGGAGG + Exonic
1035817192 8:2553900-2553922 ATGTGGGGATTATGGGGTGATGG - Intergenic
1036235730 8:7037787-7037809 AGGTTGGAATGGTGGGTTGCAGG - Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037493536 8:19418130-19418152 GTGTGGGAACAGTGGCATGATGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037660138 8:20919364-20919386 AGGTGGAGATGGTTGGATGATGG - Intergenic
1037813143 8:22098341-22098363 GTGGGGGAAGGGTGGGTTGACGG + Intronic
1038881853 8:31623316-31623338 AAGTGGGAATGAAAGGATGAAGG + Intergenic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040947359 8:52897495-52897517 ATGTGGCAATGTTGGGAGGTGGG - Intergenic
1041433754 8:57815508-57815530 ATGAGGAAATGGAGGTATGAAGG + Intergenic
1042650329 8:71033528-71033550 ATGTGGCAATGTTGGGATGTGGG + Intergenic
1042870053 8:73390276-73390298 AGGAGGTAATGATGGGATGAGGG - Intergenic
1043108348 8:76145382-76145404 ATGTTGGAATGATGAGTTGATGG + Intergenic
1043637721 8:82407367-82407389 ATTTGGGCATGGTGTGATGAGGG + Intergenic
1044415526 8:91935083-91935105 ATGTTGGAATGCTGGTATCAAGG - Intergenic
1044744766 8:95361514-95361536 AGGTGGGAATGGTAGCCTGATGG + Intergenic
1045013498 8:97978818-97978840 AAAAGGGAATGGTAGGATGAGGG - Intronic
1047506764 8:125486335-125486357 ATGTGGGGATGTCGGGATGTCGG - Intergenic
1047588112 8:126296797-126296819 ATGGGGGAGTGGTGGGGTGAGGG - Intergenic
1048045082 8:130765425-130765447 ATGGGGGAAAGATGGGATGAGGG + Intergenic
1048278196 8:133083746-133083768 ATGTTGGAATTGTGTGATGTGGG + Intronic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1049054628 8:140226105-140226127 ATGTGGTTCTGGTGGGATCAAGG + Intronic
1049769246 8:144372261-144372283 AGGTGGGAAGGGTCGGATGGAGG - Intergenic
1050006093 9:1132194-1132216 ATGGGGGAATGGGTAGATGATGG - Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1051512383 9:17892798-17892820 ATGTGGGAGTGGGGAGGTGATGG - Intergenic
1052075962 9:24140914-24140936 ATGGGTGAATGGTAGGATGACGG - Intergenic
1052083960 9:24240958-24240980 ATGTAGGAATTGTAGGATTAAGG - Intergenic
1052205499 9:25834822-25834844 ATGTGGTAATGGTGGGGGTAAGG - Intergenic
1052656578 9:31370514-31370536 ATGAGAGAATGGGGAGATGATGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053334141 9:37249092-37249114 ATGTGGGAGAGGTGGGGAGATGG + Intronic
1058186729 9:101864040-101864062 ATGGGGGACTGGTGGGGTGCAGG + Intergenic
1059179934 9:112202025-112202047 ATCTCTGAATGGTGAGATGATGG - Intergenic
1059326689 9:113507988-113508010 ATGATTGCATGGTGGGATGATGG + Intronic
1060532120 9:124353964-124353986 TTGTGGGGATGGTGGGGTGGGGG - Intronic
1060743275 9:126113448-126113470 ATGTGGGAGTTGGGGGACGATGG + Intergenic
1060763066 9:126272452-126272474 ATGTTGGAAGGATGGGAAGAGGG - Intergenic
1060943150 9:127554988-127555010 ATTTTGGAGTGGTGGGATAATGG - Intronic
1062201247 9:135303977-135303999 ATGAGTGAATGGTTGGATGGTGG + Intergenic
1062447782 9:136602830-136602852 GTGTAGGAATGGTGGGATGCTGG - Intergenic
1203574023 Un_KI270744v1:159774-159796 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185612158 X:1399121-1399143 ACGTGGGAAGGGAGGGAGGAGGG + Intergenic
1186147293 X:6637629-6637651 CTAGGGGAAGGGTGGGATGAAGG - Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1186567474 X:10679007-10679029 AAGTGGGATTGCTGGGAGGAAGG - Intronic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1188106546 X:26154221-26154243 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106549 X:26154229-26154251 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106552 X:26154237-26154259 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106555 X:26154245-26154267 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1189710737 X:43809095-43809117 ATATGGAAATGCTGTGATGAGGG + Intronic
1189797261 X:44657159-44657181 TTGTAGGGATAGTGGGATGATGG + Intergenic
1190112832 X:47605849-47605871 ATGTAGCAATTGTTGGATGATGG - Intronic
1190284475 X:48953119-48953141 ATGAGAGAATTGAGGGATGATGG + Intronic
1192539765 X:71957976-71957998 ATCTGGCAATGGTGGGGGGAAGG + Intergenic
1193203611 X:78721672-78721694 AAGGGGGAATGGTGGGAGGCGGG + Intergenic
1194062932 X:89226839-89226861 AAATGGGAGTGGTGGGTTGATGG + Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195806655 X:108779626-108779648 ATGTGGGAATTGGGAGATAATGG - Intergenic
1196796022 X:119502587-119502609 GTGTGTGAATGCTGGGATGCAGG + Intergenic
1198822388 X:140662462-140662484 ATGTGGGGATGCTGGCATAATGG - Intergenic
1199260162 X:145763903-145763925 ATGAGGGAATGGTTGGTTGGTGG - Intergenic
1199595766 X:149504835-149504857 AAGAGGGAAGGGAGGGATGAAGG + Intronic
1199894759 X:152118675-152118697 AGATGGGAATGGTGGGAGTAGGG + Intergenic
1200211325 X:154347831-154347853 TTGGGGGAATGGTGGCATGGTGG + Intergenic
1200716744 Y:6555507-6555529 AAATGGGAGTGGTGGGTTGATGG + Intergenic