ID: 1168394110

View in Genome Browser
Species Human (GRCh38)
Location 19:56033608-56033630
Sequence CTCCCAAGTTGAGGGATCTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168394110_1168394114 -8 Left 1168394110 19:56033608-56033630 CCTAAGATCCCTCAACTTGGGAG 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1168394114 19:56033623-56033645 CTTGGGAGGCACCCACCTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 272
1168394110_1168394118 6 Left 1168394110 19:56033608-56033630 CCTAAGATCCCTCAACTTGGGAG 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1168394118 19:56033637-56033659 ACCTGAAGGAAGAGGATGTAAGG 0: 1
1: 0
2: 1
3: 34
4: 363
1168394110_1168394115 -2 Left 1168394110 19:56033608-56033630 CCTAAGATCCCTCAACTTGGGAG 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1168394115 19:56033629-56033651 AGGCACCCACCTGAAGGAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 225
1168394110_1168394120 10 Left 1168394110 19:56033608-56033630 CCTAAGATCCCTCAACTTGGGAG 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1168394120 19:56033641-56033663 GAAGGAAGAGGATGTAAGGATGG 0: 1
1: 1
2: 28
3: 335
4: 2419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168394110 Original CRISPR CTCCCAAGTTGAGGGATCTT AGG (reversed) Exonic