ID: 1168400101

View in Genome Browser
Species Human (GRCh38)
Location 19:56080708-56080730
Sequence TCATGACCACAGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168400093_1168400101 30 Left 1168400093 19:56080655-56080677 CCTGGTCACTGGGAGCGGCTGGG No data
Right 1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168400101 Original CRISPR TCATGACCACAGATGGGACA TGG Intergenic
No off target data available for this crispr