ID: 1168400605

View in Genome Browser
Species Human (GRCh38)
Location 19:56084207-56084229
Sequence CTGTATACCCGGGTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168400605_1168400616 8 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400616 19:56084238-56084260 TGGAAAGTTCTGAGCCGGGTGGG No data
1168400605_1168400621 17 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400621 19:56084247-56084269 CTGAGCCGGGTGGGTGTGGGGGG No data
1168400605_1168400619 15 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400619 19:56084245-56084267 TTCTGAGCCGGGTGGGTGTGGGG No data
1168400605_1168400615 7 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400615 19:56084237-56084259 GTGGAAAGTTCTGAGCCGGGTGG No data
1168400605_1168400613 3 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400613 19:56084233-56084255 CATAGTGGAAAGTTCTGAGCCGG No data
1168400605_1168400614 4 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400614 19:56084234-56084256 ATAGTGGAAAGTTCTGAGCCGGG No data
1168400605_1168400618 14 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400618 19:56084244-56084266 GTTCTGAGCCGGGTGGGTGTGGG No data
1168400605_1168400620 16 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400620 19:56084246-56084268 TCTGAGCCGGGTGGGTGTGGGGG No data
1168400605_1168400617 13 Left 1168400605 19:56084207-56084229 CCCAGCCCCACCCGGGTATACAG No data
Right 1168400617 19:56084243-56084265 AGTTCTGAGCCGGGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168400605 Original CRISPR CTGTATACCCGGGTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr