ID: 1168401507

View in Genome Browser
Species Human (GRCh38)
Location 19:56088256-56088278
Sequence CGTCCCCGTGCTGGGCCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 145}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168401491_1168401507 22 Left 1168401491 19:56088211-56088233 CCACGCAGATGTGGGCCGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401489_1168401507 29 Left 1168401489 19:56088204-56088226 CCGCACTCCACGCAGATGTGGGC 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401487_1168401507 30 Left 1168401487 19:56088203-56088225 CCCGCACTCCACGCAGATGTGGG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401495_1168401507 -5 Left 1168401495 19:56088238-56088260 CCCCCGCCGCCCCGAGCCCGTCC 0: 1
1: 0
2: 5
3: 69
4: 717
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401492_1168401507 7 Left 1168401492 19:56088226-56088248 CCGGCTCCTCGCCCCCCGCCGCC 0: 1
1: 3
2: 14
3: 227
4: 1626
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401494_1168401507 -4 Left 1168401494 19:56088237-56088259 CCCCCCGCCGCCCCGAGCCCGTC 0: 1
1: 0
2: 3
3: 64
4: 601
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401497_1168401507 -7 Left 1168401497 19:56088240-56088262 CCCGCCGCCCCGAGCCCGTCCCC 0: 1
1: 0
2: 6
3: 66
4: 703
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401498_1168401507 -8 Left 1168401498 19:56088241-56088263 CCGCCGCCCCGAGCCCGTCCCCG 0: 1
1: 0
2: 4
3: 107
4: 938
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401496_1168401507 -6 Left 1168401496 19:56088239-56088261 CCCCGCCGCCCCGAGCCCGTCCC 0: 1
1: 1
2: 5
3: 62
4: 670
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145
1168401493_1168401507 1 Left 1168401493 19:56088232-56088254 CCTCGCCCCCCGCCGCCCCGAGC 0: 1
1: 1
2: 24
3: 244
4: 1741
Right 1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG 0: 1
1: 0
2: 0
3: 19
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168401507 Original CRISPR CGTCCCCGTGCTGGGCCCGC TGG Exonic
901506792 1:9690035-9690057 CGTCCTCGTGCGAAGCCCGCTGG - Intronic
902072102 1:13749189-13749211 CGGCCCCGTGCGGGCCGCGCCGG - Intronic
902978923 1:20109381-20109403 TGTCCCTGGGCTGGGCCCCCTGG + Intergenic
903931198 1:26863500-26863522 CGACACCGTGCTGGGCCTGCTGG + Exonic
905867058 1:41382216-41382238 CGGCCCGGTGCTGGGTGCGCCGG + Exonic
906961424 1:50421492-50421514 CGTCGCCGCGCCGGGCACGCTGG + Exonic
907278445 1:53329385-53329407 CAACCCTGTGCTGGGCCTGCGGG + Intergenic
912680649 1:111726906-111726928 GGTCCCAGTGCTGGGCCCCTGGG - Exonic
912927927 1:113929777-113929799 CGTCCCCGCGCCCGTCCCGCAGG - Exonic
914880170 1:151540692-151540714 CGAGCCCGTGCTTGGGCCGCGGG + Intronic
915348224 1:155208824-155208846 CGTCCCCGAGCGGGGACTGCGGG - Exonic
915471281 1:156127034-156127056 CGTCCCCGTGCTGGGTTGGCAGG - Intronic
915581112 1:156813970-156813992 CGTCCCTGAGCTGGGCCAGCAGG + Exonic
920373362 1:205493242-205493264 GGACTCCGTGCTGGTCCCGCAGG + Intergenic
923049404 1:230380377-230380399 CCTCCCTGTGCTGGGCCCTCTGG + Intronic
1062796638 10:349454-349476 TGTCCCTGTGATCGGCCCGCAGG - Exonic
1062799615 10:369382-369404 CGTTCCCGTGGTGTGCCCTCAGG - Intronic
1062858351 10:790828-790850 CATCCCTGAGCTGGGCCCCCAGG + Intergenic
1066406716 10:35126238-35126260 GGTCCGCATGCTGGGCCCGCTGG - Intergenic
1067431585 10:46249280-46249302 GGCCCCCATGCTGGGCCCCCAGG - Intergenic
1067441835 10:46312894-46312916 GGCCCCCATGCTGGGCCCCCAGG + Intronic
1069726799 10:70585448-70585470 AGTCACCATGCTGGGCACGCTGG - Intergenic
1071262378 10:83932432-83932454 AGTCCCTGAGCTGGGCCTGCTGG - Intergenic
1071329052 10:84542686-84542708 AATACCTGTGCTGGGCCCGCAGG - Intergenic
1072187984 10:93060559-93060581 CGTCCTCGGGCGGGGCCTGCGGG - Intergenic
1073475007 10:103747039-103747061 CGTCCTTGTGCTGGGCCCTGAGG - Intronic
1076313085 10:129521945-129521967 CGTGCCGGTGCAGGGCACGCAGG + Intronic
1076865755 10:133165465-133165487 CGTCCCCCTGCGGGGCCCTGGGG - Intronic
1077098489 11:810164-810186 CGGCCCCGGGATGGGCCGGCAGG + Intronic
1077229777 11:1453595-1453617 GGTCCCCGTGCTTGTCCGGCAGG + Intronic
1077962493 11:7089729-7089751 CGACCCCTACCTGGGCCCGCGGG + Exonic
1080475259 11:32584112-32584134 GGGCCCCGCGCTGGGACCGCCGG - Intronic
1081862236 11:46339749-46339771 CTTCCCCATGCTTGGCCCACAGG - Intronic
1084128820 11:67118591-67118613 AGCCGCCGGGCTGGGCCCGCGGG - Intergenic
1084352868 11:68615829-68615851 CCTCTGCATGCTGGGCCCGCAGG + Intergenic
1084477198 11:69395752-69395774 CATCCCCTGGCTGGGCCTGCTGG + Intergenic
1088688588 11:112305564-112305586 CGTCCCTGTGCTGGGTCTGTTGG + Intergenic
1089519994 11:119057034-119057056 TGTCCCAGAGCTGGGGCCGCAGG - Exonic
1090803888 11:130190551-130190573 CGTCCCCCCGCAGGGCCCACTGG - Exonic
1092088564 12:5785757-5785779 AGTCCCCATGCTGGTCCCCCGGG + Intronic
1092861723 12:12724836-12724858 CCACCCCCAGCTGGGCCCGCAGG - Intergenic
1095098001 12:38158229-38158251 AGTCCCTGCGCTGGGCCCGGGGG + Intergenic
1096156640 12:49345076-49345098 CGACCCCGGGCGGGGCCCCCGGG - Intergenic
1102145889 12:110654901-110654923 GGTCCCCTTGCTGGGCCATCAGG - Intronic
1102914640 12:116743756-116743778 AGTCCCAGTGCTGGGACCGGGGG - Intronic
1104961871 12:132491913-132491935 CCACCCCGTCCTGGGCCCACAGG - Intronic
1105323413 13:19348045-19348067 TGGCCCCGTGCTGGCCCTGCTGG + Intergenic
1105873975 13:24537792-24537814 TGGCCCCGTGCTGGCCCTGCTGG - Intergenic
1108229183 13:48319300-48319322 CCTCCCGGCGCTGGGCCCTCTGG + Intronic
1113695603 13:112343278-112343300 CCTCCCCGGCCTGGCCCCGCGGG - Intergenic
1113796276 13:113060619-113060641 CGTCCTCGTGCTTCGCCCGACGG + Exonic
1113912806 13:113852288-113852310 CGTCCCCGTGCTGGGGGTTCCGG + Intronic
1123213650 14:106785354-106785376 CGGCCTCCTGCTGGGCCTGCAGG + Intergenic
1128145540 15:65330646-65330668 CGCCCTCGTGCTGGGCCAGCCGG + Exonic
1128344005 15:66842495-66842517 CGGTCCCGTGCTCGGCTCGCAGG - Intergenic
1132519627 16:381394-381416 CTTCCCCGCGCCGGGCGCGCCGG + Intronic
1132747345 16:1442567-1442589 CCTCACCCTGCTGGGCCCTCCGG - Intronic
1132766422 16:1536679-1536701 CGTCCCCGTGTTGGGGCCTTGGG - Intronic
1132980904 16:2738264-2738286 CATCCCCGTGCTGGGTTCTCAGG - Intergenic
1133035333 16:3031030-3031052 GCTCCCCAAGCTGGGCCCGCAGG + Exonic
1133784193 16:8962845-8962867 CGTCCCCGTTCTGGGGCGTCCGG - Intronic
1141194898 16:81853041-81853063 AGGCCCCAGGCTGGGCCCGCTGG + Intronic
1141606005 16:85153812-85153834 AGTCCCCCTGCTGGGGCCCCAGG - Intergenic
1142018643 16:87766134-87766156 CGGCCCCGGGCTGGGCGCGGTGG + Intergenic
1142205596 16:88781509-88781531 TGTCCCCATGCTGGGCCTGGAGG - Intronic
1142809565 17:2388973-2388995 TGTCCAGGTGCAGGGCCCGCAGG + Intronic
1143247815 17:5500825-5500847 CGACGCCGACCTGGGCCCGCGGG + Intronic
1147252718 17:39162997-39163019 AGGCCCCGTGCTGGGCCCTGGGG + Intronic
1148608002 17:48944732-48944754 CATCCCCACCCTGGGCCCGCGGG + Exonic
1148783232 17:50133226-50133248 AGCCCCTGTGCTGGGCCAGCAGG - Intergenic
1149678704 17:58488492-58488514 CGTGCCCCAGCTCGGCCCGCCGG + Intergenic
1150765036 17:67995772-67995794 CGTGCCCGGGCCGGGCTCGCAGG - Intergenic
1151481414 17:74372020-74372042 CGTCCCCAGGCCGGACCCGCCGG + Exonic
1151704025 17:75757426-75757448 CCTCCAGGTGCTGGGCCCCCAGG - Exonic
1151704300 17:75758546-75758568 CCACCACGTGCCGGGCCCGCCGG + Exonic
1152523187 17:80872457-80872479 CGACCCAGTGCTGGGACAGCTGG - Intronic
1152666055 17:81570306-81570328 CAGCCCCGTGCTGGGCACCCAGG - Intronic
1154208723 18:12360652-12360674 TGTCCCTGTGCTGGGCCCTCTGG - Intronic
1160552977 18:79706864-79706886 GGTCACCGGGCTGTGCCCGCTGG - Intronic
1160563976 18:79775661-79775683 CGTCCCTGTGCTGAGGCCGCTGG + Intergenic
1161479708 19:4504427-4504449 CGACCCCGCGCCGGGCCTGCAGG + Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162573061 19:11483537-11483559 CGCCCCAGAGCTGGGCCCCCTGG - Exonic
1163012208 19:14433334-14433356 CGTCCCCGCGCCGCGCCCTCCGG - Intronic
1165063760 19:33217669-33217691 CCTCCACCTGCCGGGCCCGCAGG + Intronic
1166641918 19:44500663-44500685 CGTCCTCGTCCGGGGCCCGGGGG + Intergenic
1167445560 19:49535097-49535119 CCTCCCCCTCCTGGGCCCCCAGG + Intronic
1167612437 19:50513949-50513971 CGCCCCCACGCTGGGCCTGCGGG - Intronic
1167880246 19:52451519-52451541 CCTCCGCGGGCTGGGCCCGCTGG - Intronic
1168353848 19:55690481-55690503 CTTCCCTGTGACGGGCCCGCTGG + Intronic
1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG + Exonic
1168688446 19:58362567-58362589 CGGCCCTGAGCTGGGCCCTCTGG - Intronic
925347590 2:3181591-3181613 CGTCCCTGTGTTGGGAACGCTGG - Intergenic
927194571 2:20538768-20538790 TGCCCCTGAGCTGGGCCCGCTGG + Intergenic
927472482 2:23386110-23386132 AGCCCCCCTGCTGGGCCCGGCGG + Intronic
930015916 2:46970492-46970514 CATCCCAGTGCTGGACCCGGAGG + Intronic
936512116 2:113157204-113157226 CGGCGCCGTGCGGGGCGCGCAGG + Intergenic
941917807 2:170823583-170823605 CATCCCTGTGCTGGGGCAGCCGG + Intronic
945251126 2:207767515-207767537 CGGCTTCGTGCTGGGCCCGCTGG - Exonic
946416353 2:219541933-219541955 CGTCGCCGTGCTGCTCCAGCAGG + Exonic
946422101 2:219570917-219570939 CGTCACCGTGCTGGAGCCGCCGG - Exonic
947605766 2:231484133-231484155 CGCCCCCACGCTGGGTCCGCGGG - Intergenic
947857679 2:233335166-233335188 CATCACCCTGCTGGGCTCGCAGG + Intronic
948454955 2:238100611-238100633 TGGCCCCGTTGTGGGCCCGCTGG - Exonic
1174103333 20:48144034-48144056 CTTACCCATGATGGGCCCGCAGG - Intergenic
1175891681 20:62318555-62318577 CGGCCTCGTGCTGGGCCAGCCGG + Exonic
1176199858 20:63855350-63855372 CCTCCCCGAGCTGTGGCCGCAGG + Intergenic
1179784202 21:43720316-43720338 GGTCCCTGTGCTGGGCCCCACGG + Intronic
1180701586 22:17784268-17784290 GGTCCCTGTGCTGGGGCCTCCGG + Intergenic
1181026260 22:20129512-20129534 CGTCCGCGTGCTGGCCCCACGGG + Intronic
1181162029 22:20965073-20965095 CGGGGCGGTGCTGGGCCCGCGGG + Intergenic
1182145764 22:27995872-27995894 CGTCCCCGGGATGAGCCCGCTGG - Intronic
1183261602 22:36799026-36799048 CTGCCCCGGGCTGGGCCCTCAGG + Intergenic
1184110305 22:42390236-42390258 CTTCCCTGTGCTGGGCCCCGTGG + Intronic
1184739673 22:46420712-46420734 TGTCCTCGATCTGGGCCCGCGGG + Intronic
1184767432 22:46578895-46578917 CCTCACCGTGCTGGGCTCACAGG + Intronic
1185110579 22:48898086-48898108 CCCTCCTGTGCTGGGCCCGCAGG + Intergenic
1185322369 22:50207682-50207704 CATCCCTGCCCTGGGCCCGCTGG + Intronic
965913627 3:173814079-173814101 AGCCCCTGAGCTGGGCCCGCAGG + Intronic
966696343 3:182793729-182793751 CGTCGCCGTCCGGGTCCCGCGGG - Exonic
966743366 3:183253995-183254017 CGGCCCCGAGCTGGGCTCCCTGG + Intronic
968534275 4:1113529-1113551 CCTCCCCGCGCAGGGCCCGAAGG + Intronic
968693658 4:2009472-2009494 CGTGCAGGTGCTGGGCCCGCGGG - Exonic
969721253 4:8894067-8894089 CCTCCCCGTGCAGGCGCCGCTGG - Intergenic
976199107 4:82561824-82561846 CGGCCCCGTGCGCAGCCCGCAGG - Intronic
981708319 4:147684152-147684174 CCGCCCCGTCCTGGCCCCGCGGG + Exonic
986015570 5:3754434-3754456 CGTCCCTGGGCTGGGGCCGGAGG + Intergenic
992676716 5:79112424-79112446 CCTCCCTGTTCTGGGCGCGCCGG - Intronic
1002395096 5:178946427-178946449 CGTCCCTGTACAGGGCCCTCTGG - Exonic
1002522946 5:179801372-179801394 CATCTCCGAGCTGAGCCCGCAGG - Exonic
1006471368 6:34231054-34231076 CGGCTCCATGCTGGGCCCACTGG + Intergenic
1006641111 6:35490307-35490329 CGGCCCCTGGCTGGGACCGCTGG + Intronic
1014246691 6:119078090-119078112 CGACCCCGTGCGGGCCGCGCCGG - Intronic
1017018283 6:150118710-150118732 CTTCCCCAGGCTGTGCCCGCAGG - Intergenic
1018945903 6:168346488-168346510 CTTCCCCGTGCAGGGCTCCCAGG - Intergenic
1019475163 7:1241019-1241041 CCTCCCCATCCTCGGCCCGCGGG - Intergenic
1019524395 7:1474251-1474273 CCTGCACGTGCTGGGCCTGCTGG - Exonic
1022275785 7:28854265-28854287 GGTGCCCGTGCCGGGGCCGCGGG + Intergenic
1023842091 7:44103768-44103790 GGGCCCCGTGCTGGGCCCCAGGG - Intergenic
1029694054 7:102201667-102201689 CGCCCCCGGGCTGGACCCCCAGG + Exonic
1030348101 7:108455835-108455857 AGCCGCCGTGCCGGGCCCGCAGG + Intronic
1034900924 7:154907318-154907340 GGATCCCGTGCTGGGGCCGCGGG - Intergenic
1034988714 7:155534028-155534050 GGTCCCCCTGCTGGCCCCGCCGG + Intergenic
1035599995 8:891768-891790 CCTCCCCGTCCTGGGCTGGCTGG - Intergenic
1036195404 8:6708987-6709009 GCTCTCCGTGCTGGGTCCGCCGG - Intronic
1040560966 8:48523307-48523329 CTTCCCCGTGGTGGCCCTGCAGG + Intergenic
1049558626 8:143296440-143296462 TCTCCCCGTGGTGGGTCCGCCGG - Exonic
1049719366 8:144108525-144108547 GGTGACCGTGCTGGGCCCGCTGG + Exonic
1049936245 9:504340-504362 CGTCGCCGCGCCTGGCCCGCGGG - Intronic
1050382173 9:5042064-5042086 CGTCCCGGGGATGGGGCCGCCGG - Intronic
1057259755 9:93576954-93576976 CGTCCCCGAGCCGGGCCTGCGGG - Intronic
1058053233 9:100427087-100427109 CTTCCCCGAGCTGCGGCCGCCGG - Intergenic
1060986921 9:127825342-127825364 CGTCACCGTCCGGGGCCTGCGGG + Exonic
1061280964 9:129597467-129597489 CGTCCGAGCGCTGGGGCCGCTGG + Intergenic
1061583947 9:131554681-131554703 CGTCCTCGTCCAGGGTCCGCGGG - Intergenic
1062113869 9:134797112-134797134 TGTCCCACTGCCGGGCCCGCTGG + Intronic
1062271869 9:135713578-135713600 GCTCCCCGTGCTGTGCCCGTAGG - Intronic
1190745806 X:53321191-53321213 CCTCCCCCGGCTGGGCCCGGGGG - Exonic
1191249959 X:58255543-58255565 AGCCCCTGTGCTGGGCCCTCTGG - Intergenic
1191250429 X:58257580-58257602 AGTCCCTGCGCCGGGCCCGCTGG + Intergenic
1191250509 X:58257962-58257984 AGTCCCTGCGCTGAGCCCGCGGG + Intergenic
1191251160 X:58260847-58260869 AGCCCCTGTGCTGGGCCTGCAGG + Intergenic
1191251534 X:58262344-58262366 AGCCCCTGTGCTGGGCCCGTAGG + Intergenic
1191251918 X:58263897-58263919 AGCCCCTGTGCTGGGCCCGCGGG + Intergenic
1201152551 Y:11101970-11101992 CGTCCCTGCGCTGGGCCCCGTGG - Intergenic