ID: 1168403010

View in Genome Browser
Species Human (GRCh38)
Location 19:56096939-56096961
Sequence TCCCGATGTTGAGAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403010_1168403021 16 Left 1168403010 19:56096939-56096961 CCCTCACCCTCTCAACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1168403021 19:56096978-56097000 TCAGGAGAAAAGGCCCCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 269
1168403010_1168403017 -2 Left 1168403010 19:56096939-56096961 CCCTCACCCTCTCAACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1168403017 19:56096960-56096982 GAACTCCATCTGGGGTCATCAGG 0: 1
1: 0
2: 1
3: 9
4: 93
1168403010_1168403020 13 Left 1168403010 19:56096939-56096961 CCCTCACCCTCTCAACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1168403020 19:56096975-56096997 TCATCAGGAGAAAAGGCCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 199
1168403010_1168403016 -10 Left 1168403010 19:56096939-56096961 CCCTCACCCTCTCAACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1168403016 19:56096952-56096974 AACATCGGGAACTCCATCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1168403010_1168403023 25 Left 1168403010 19:56096939-56096961 CCCTCACCCTCTCAACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1168403023 19:56096987-56097009 AAGGCCCCAGGAGGCAGGTTAGG 0: 1
1: 0
2: 1
3: 32
4: 304
1168403010_1168403019 6 Left 1168403010 19:56096939-56096961 CCCTCACCCTCTCAACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1168403019 19:56096968-56096990 TCTGGGGTCATCAGGAGAAAAGG 0: 1
1: 0
2: 2
3: 27
4: 284
1168403010_1168403022 20 Left 1168403010 19:56096939-56096961 CCCTCACCCTCTCAACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1168403022 19:56096982-56097004 GAGAAAAGGCCCCAGGAGGCAGG 0: 1
1: 0
2: 1
3: 65
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403010 Original CRISPR TCCCGATGTTGAGAGGGTGA GGG (reversed) Intronic
901929495 1:12587926-12587948 TCCTGTTGTTGAGTGAGTGAGGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
905426067 1:37885645-37885667 TGCTGATGGTGAGAGGGGGAAGG + Exonic
906709919 1:47921774-47921796 TGCCGAGGTTGCAAGGGTGACGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
919120595 1:193335337-193335359 TTCAGATGTTGAGAGGGGGCAGG + Intergenic
922163076 1:223092653-223092675 TACCTATGGTGAGAGGGTGTCGG - Intergenic
1067281044 10:44873175-44873197 TCCTGATCTTGATAGTGTGATGG - Intergenic
1067801048 10:49359966-49359988 TCCAGATCTTGGGAGGGGGAGGG + Intergenic
1072824197 10:98589700-98589722 TCTGGATGGTGACAGGGTGATGG - Intronic
1073491781 10:103857154-103857176 TCCCGAACTTGGGAGGGTGCTGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1087535316 11:99436831-99436853 TCTCGATGTTGAGTGTATGAAGG - Intronic
1090066781 11:123510339-123510361 TCCCCCTGTTGAGAGGGAGAGGG - Intergenic
1092192615 12:6532112-6532134 TCCAGAGGTTGAGAGGGGAAAGG - Intergenic
1093251037 12:16805215-16805237 TCCGGATTTTGAGACAGTGAAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097802961 12:63935062-63935084 TCCCGATGTTCACAGGCTGGTGG - Intronic
1098031442 12:66258819-66258841 TCCTCATGGTGAGAAGGTGAAGG + Intergenic
1098071248 12:66677390-66677412 TCTTGATGTTGAGAAGTTGATGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1112988008 13:105476285-105476307 TACTGAAGTTGAGAGGGAGAAGG - Intronic
1113275526 13:108725184-108725206 TCCCTATGTTCAGAAAGTGAGGG - Intronic
1114884414 14:26830641-26830663 TCATGATGTTGGGAGGCTGATGG - Intergenic
1116173247 14:41430048-41430070 TCCCAATGTAGAGGGGGTTAGGG - Intergenic
1117015460 14:51513023-51513045 TCCTAATTTTGAGAGAGTGAGGG - Intronic
1118786950 14:69054141-69054163 GCCCGTTATTGTGAGGGTGAGGG + Exonic
1119192718 14:72694165-72694187 TCCCTATGTGGGGAGGTTGAGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120871096 14:89338196-89338218 TCCAGATGTTTGGAGGGGGAGGG - Intronic
1121511891 14:94518897-94518919 TCTCCATGAGGAGAGGGTGATGG + Intergenic
1122597091 14:102901259-102901281 CCCCGAGGTTAAGAGGGGGATGG - Intronic
1123083708 14:105707783-105707805 ACCGGATTTTGAGAGGGTGGCGG + Intergenic
1127827694 15:62719369-62719391 GCCCCATGTTCAGAAGGTGAGGG - Intronic
1133336578 16:5010564-5010586 TCCCGGTGGGGAGAGGGTGGAGG + Intronic
1133387309 16:5380072-5380094 TCCCAATTTTGAGAGGGTTAAGG + Intergenic
1135965881 16:27034574-27034596 TCACTATGTTGAGAAGGTCAGGG - Intergenic
1136931191 16:34419315-34419337 TGTCAATGTTGAGAGGGTGGTGG - Intergenic
1136973382 16:34992504-34992526 TGTCAATGTTGAGAGGGTGGTGG + Intergenic
1141670676 16:85490177-85490199 GCTAGATGTTGAGAGGCTGAGGG + Intergenic
1141951046 16:87339591-87339613 TCCGGGAGTTGACAGGGTGAGGG - Intronic
1142534457 17:604856-604878 TCCCTTTGTTGAGTGGATGAGGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1148945547 17:51259698-51259720 TCCGGAGGTTGAGAGGGCGTGGG + Intronic
1150185756 17:63179784-63179806 TCCTTATTTTGGGAGGGTGAGGG - Intronic
1150804392 17:68307756-68307778 TCCCGTTCTTGAGAGGGGAAGGG + Intronic
1153379774 18:4425376-4425398 TCCTGTTGATGTGAGGGTGAAGG + Intronic
1153912986 18:9720426-9720448 GCCAGATGTTCAGAAGGTGAGGG + Intronic
1156568838 18:38228156-38228178 TCCCCATTTTGAGAGGGGAAGGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165184876 19:34009336-34009358 TCAGAATCTTGAGAGGGTGATGG + Intergenic
1165285477 19:34838469-34838491 TCCCGCTGTTATGAGGGTGAGGG + Intergenic
1165783012 19:38444662-38444684 TCCCGCTGCGAAGAGGGTGAGGG + Exonic
1166134892 19:40770208-40770230 TCCTGATGTGAAGCGGGTGATGG + Intergenic
1168403010 19:56096939-56096961 TCCCGATGTTGAGAGGGTGAGGG - Intronic
925101672 2:1252094-1252116 TCCCGATGCTGTGAGGCTGCAGG + Intronic
927131574 2:20064674-20064696 TCCCTATGATGTAAGGGTGAAGG - Intergenic
929456242 2:42068234-42068256 TCCCAACGATGAGAGGGGGAGGG - Intergenic
935417961 2:102838427-102838449 TACCGATGTGAAGAGGGGGAAGG + Intronic
936718138 2:115214515-115214537 AGCCGATGTTGAGAGGGAGCAGG + Intronic
940196548 2:151101484-151101506 TCCTGATGGTGAGAGCCTGATGG - Intergenic
940883416 2:158968868-158968890 ACCCGGGGTGGAGAGGGTGATGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1170254022 20:14319500-14319522 TCAAGAAGTTAAGAGGGTGAAGG - Intronic
1176130792 20:63496029-63496051 TCCCCATCTGGAGCGGGTGAGGG + Exonic
1179996459 21:44976612-44976634 TCCGGGTGTTGAGGGGCTGAGGG + Intronic
1182395210 22:30030684-30030706 TCCTGATGTTTAGAGGCGGAAGG + Intronic
1182698127 22:32209924-32209946 TGCCCATGGTGAGGGGGTGAGGG - Intergenic
1184310346 22:43637208-43637230 TCCAGGTTTTGATAGGGTGAGGG + Intronic
958552068 3:95628162-95628184 TGGCAATGTTGAGATGGTGACGG - Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
968007676 3:195254290-195254312 TCCTGTGGTTGGGAGGGTGAGGG - Intronic
970780184 4:19728428-19728450 TTCCCATATGGAGAGGGTGAAGG - Intergenic
985514834 5:336234-336256 TCCCCAGTATGAGAGGGTGAGGG - Intronic
991503835 5:67303945-67303967 TCCAGAGGTTCAGAGGGAGAGGG + Intergenic
992419790 5:76591676-76591698 TCCCCATACTGAGAGGGAGAAGG - Intronic
994552437 5:101254774-101254796 TCTAGATGTTGAGAAGTTGAAGG + Intergenic
997725800 5:136118916-136118938 TCCCCATGCAGAGAAGGTGAGGG + Intergenic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006613635 6:35310635-35310657 TCCTGATGAGGTGAGGGTGATGG + Exonic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1011186011 6:84676667-84676689 TCCAGAGGTTGATGGGGTGATGG + Intergenic
1012322002 6:97861286-97861308 TCCTGATATTGAGAGTCTGAGGG - Intergenic
1015327591 6:131941078-131941100 TCCAGATGTGGAGCGGGTGGTGG + Intergenic
1018488077 6:164262747-164262769 TCCCAATGTGGAGTGGGGGAGGG - Intergenic
1023222457 7:37933397-37933419 TCCCCCTGTTGAGAGCGAGAAGG + Intronic
1024574124 7:50750181-50750203 TCCTGAGGTTGAGAGGGAGCTGG - Intronic
1029114574 7:98230711-98230733 TCCCGATGCTCAGAGGCTGCTGG + Intronic
1036236980 8:7047560-7047582 TCCCCTTGTTTAGACGGTGAAGG - Intergenic
1037825772 8:22159873-22159895 TCCCAATGTTGCCAGGATGATGG + Intronic
1039966620 8:42288713-42288735 TCCAGATCATGAGAAGGTGAGGG + Exonic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044035695 8:87300733-87300755 TTCCAATGTTTGGAGGGTGAAGG + Intronic
1050163243 9:2739545-2739567 TACAGATGGTGAGAAGGTGAAGG + Intronic
1050615614 9:7398862-7398884 TGCCCATGTTGAAAGGCTGAAGG + Intergenic
1050648920 9:7754263-7754285 ACCAGATGTGGAGAGAGTGAAGG - Intergenic
1057489760 9:95511447-95511469 TCCCGAGGAAGAGAGGGAGACGG + Intronic
1058840444 9:108902362-108902384 TCCCTTTGTTGGGAGTGTGATGG - Intronic
1059140030 9:111844340-111844362 TGGCGATGCTGAGAGGATGACGG - Intergenic
1059643829 9:116244198-116244220 TCTCAATTTTGAAAGGGTGAAGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060793298 9:126499772-126499794 TCCCGAGGGAGAGAGGGTGGGGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1198217917 X:134573645-134573667 TCCCAATTTTGAAAGGGAGACGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic