ID: 1168403475

View in Genome Browser
Species Human (GRCh38)
Location 19:56099044-56099066
Sequence CAGGCGGGACAGATCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403475_1168403487 20 Left 1168403475 19:56099044-56099066 CCACCCTGGATCTGTCCCGCCTG No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403475_1168403486 15 Left 1168403475 19:56099044-56099066 CCACCCTGGATCTGTCCCGCCTG No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data
1168403475_1168403485 14 Left 1168403475 19:56099044-56099066 CCACCCTGGATCTGTCCCGCCTG No data
Right 1168403485 19:56099081-56099103 GAGAACATATCAAGTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403475 Original CRISPR CAGGCGGGACAGATCCAGGG TGG (reversed) Intronic