ID: 1168403477

View in Genome Browser
Species Human (GRCh38)
Location 19:56099048-56099070
Sequence CCTGCAGGCGGGACAGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403477_1168403485 10 Left 1168403477 19:56099048-56099070 CCTGGATCTGTCCCGCCTGCAGG No data
Right 1168403485 19:56099081-56099103 GAGAACATATCAAGTCCTTCTGG No data
1168403477_1168403486 11 Left 1168403477 19:56099048-56099070 CCTGGATCTGTCCCGCCTGCAGG No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data
1168403477_1168403487 16 Left 1168403477 19:56099048-56099070 CCTGGATCTGTCCCGCCTGCAGG No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403477_1168403489 30 Left 1168403477 19:56099048-56099070 CCTGGATCTGTCCCGCCTGCAGG No data
Right 1168403489 19:56099101-56099123 TGGGCTAGGCCACTGCTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403477 Original CRISPR CCTGCAGGCGGGACAGATCC AGG (reversed) Intronic