ID: 1168403482

View in Genome Browser
Species Human (GRCh38)
Location 19:56099071-56099093
Sequence TTGATATGTTCTCGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403482_1168403487 -7 Left 1168403482 19:56099071-56099093 CCAGCTGCCCGAGAACATATCAA No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403482_1168403490 8 Left 1168403482 19:56099071-56099093 CCAGCTGCCCGAGAACATATCAA No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403482_1168403489 7 Left 1168403482 19:56099071-56099093 CCAGCTGCCCGAGAACATATCAA No data
Right 1168403489 19:56099101-56099123 TGGGCTAGGCCACTGCTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403482 Original CRISPR TTGATATGTTCTCGGGCAGC TGG (reversed) Intronic