ID: 1168403482 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:56099071-56099093 |
| Sequence | TTGATATGTTCTCGGGCAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1168403482_1168403489 | 7 | Left | 1168403482 | 19:56099071-56099093 | CCAGCTGCCCGAGAACATATCAA | No data | ||
| Right | 1168403489 | 19:56099101-56099123 | TGGGCTAGGCCACTGCTGTCCGG | No data | ||||
| 1168403482_1168403487 | -7 | Left | 1168403482 | 19:56099071-56099093 | CCAGCTGCCCGAGAACATATCAA | No data | ||
| Right | 1168403487 | 19:56099087-56099109 | ATATCAAGTCCTTCTGGGCTAGG | No data | ||||
| 1168403482_1168403490 | 8 | Left | 1168403482 | 19:56099071-56099093 | CCAGCTGCCCGAGAACATATCAA | No data | ||
| Right | 1168403490 | 19:56099102-56099124 | GGGCTAGGCCACTGCTGTCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1168403482 | Original CRISPR | TTGATATGTTCTCGGGCAGC TGG (reversed) | Intronic | ||