ID: 1168403483

View in Genome Browser
Species Human (GRCh38)
Location 19:56099078-56099100
Sequence GAAGGACTTGATATGTTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403483_1168403490 1 Left 1168403483 19:56099078-56099100 CCCGAGAACATATCAAGTCCTTC No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403483_1168403489 0 Left 1168403483 19:56099078-56099100 CCCGAGAACATATCAAGTCCTTC No data
Right 1168403489 19:56099101-56099123 TGGGCTAGGCCACTGCTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403483 Original CRISPR GAAGGACTTGATATGTTCTC GGG (reversed) Intronic