ID: 1168403484

View in Genome Browser
Species Human (GRCh38)
Location 19:56099079-56099101
Sequence AGAAGGACTTGATATGTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403484_1168403490 0 Left 1168403484 19:56099079-56099101 CCGAGAACATATCAAGTCCTTCT No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403484_1168403489 -1 Left 1168403484 19:56099079-56099101 CCGAGAACATATCAAGTCCTTCT No data
Right 1168403489 19:56099101-56099123 TGGGCTAGGCCACTGCTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403484 Original CRISPR AGAAGGACTTGATATGTTCT CGG (reversed) Intronic