ID: 1168403486

View in Genome Browser
Species Human (GRCh38)
Location 19:56099082-56099104
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403480_1168403486 -1 Left 1168403480 19:56099060-56099082 CCGCCTGCAGGCCAGCTGCCCGA No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data
1168403481_1168403486 -4 Left 1168403481 19:56099063-56099085 CCTGCAGGCCAGCTGCCCGAGAA No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data
1168403475_1168403486 15 Left 1168403475 19:56099044-56099066 CCACCCTGGATCTGTCCCGCCTG No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data
1168403479_1168403486 0 Left 1168403479 19:56099059-56099081 CCCGCCTGCAGGCCAGCTGCCCG No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data
1168403476_1168403486 12 Left 1168403476 19:56099047-56099069 CCCTGGATCTGTCCCGCCTGCAG No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data
1168403477_1168403486 11 Left 1168403477 19:56099048-56099070 CCTGGATCTGTCCCGCCTGCAGG No data
Right 1168403486 19:56099082-56099104 AGAACATATCAAGTCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type