ID: 1168403487

View in Genome Browser
Species Human (GRCh38)
Location 19:56099087-56099109
Sequence ATATCAAGTCCTTCTGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403476_1168403487 17 Left 1168403476 19:56099047-56099069 CCCTGGATCTGTCCCGCCTGCAG No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403475_1168403487 20 Left 1168403475 19:56099044-56099066 CCACCCTGGATCTGTCCCGCCTG No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403477_1168403487 16 Left 1168403477 19:56099048-56099070 CCTGGATCTGTCCCGCCTGCAGG No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403481_1168403487 1 Left 1168403481 19:56099063-56099085 CCTGCAGGCCAGCTGCCCGAGAA No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403479_1168403487 5 Left 1168403479 19:56099059-56099081 CCCGCCTGCAGGCCAGCTGCCCG No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403482_1168403487 -7 Left 1168403482 19:56099071-56099093 CCAGCTGCCCGAGAACATATCAA No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data
1168403480_1168403487 4 Left 1168403480 19:56099060-56099082 CCGCCTGCAGGCCAGCTGCCCGA No data
Right 1168403487 19:56099087-56099109 ATATCAAGTCCTTCTGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403487 Original CRISPR ATATCAAGTCCTTCTGGGCT AGG Intronic