ID: 1168403490

View in Genome Browser
Species Human (GRCh38)
Location 19:56099102-56099124
Sequence GGGCTAGGCCACTGCTGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168403481_1168403490 16 Left 1168403481 19:56099063-56099085 CCTGCAGGCCAGCTGCCCGAGAA No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403480_1168403490 19 Left 1168403480 19:56099060-56099082 CCGCCTGCAGGCCAGCTGCCCGA No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403482_1168403490 8 Left 1168403482 19:56099071-56099093 CCAGCTGCCCGAGAACATATCAA No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403483_1168403490 1 Left 1168403483 19:56099078-56099100 CCCGAGAACATATCAAGTCCTTC No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403479_1168403490 20 Left 1168403479 19:56099059-56099081 CCCGCCTGCAGGCCAGCTGCCCG No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data
1168403484_1168403490 0 Left 1168403484 19:56099079-56099101 CCGAGAACATATCAAGTCCTTCT No data
Right 1168403490 19:56099102-56099124 GGGCTAGGCCACTGCTGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168403490 Original CRISPR GGGCTAGGCCACTGCTGTCC GGG Intronic