ID: 1168405745

View in Genome Browser
Species Human (GRCh38)
Location 19:56109385-56109407
Sequence GAAACACGCCCTCCTCGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168405739_1168405745 11 Left 1168405739 19:56109351-56109373 CCCTTTCTTCCTGCAAGCAGATG 0: 1
1: 0
2: 2
3: 45
4: 375
Right 1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 29
1168405737_1168405745 15 Left 1168405737 19:56109347-56109369 CCTCCCCTTTCTTCCTGCAAGCA 0: 1
1: 0
2: 5
3: 35
4: 425
Right 1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 29
1168405740_1168405745 10 Left 1168405740 19:56109352-56109374 CCTTTCTTCCTGCAAGCAGATGA 0: 1
1: 0
2: 0
3: 37
4: 254
Right 1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 29
1168405741_1168405745 2 Left 1168405741 19:56109360-56109382 CCTGCAAGCAGATGAAACCCCAC 0: 1
1: 0
2: 2
3: 7
4: 132
Right 1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 29
1168405738_1168405745 12 Left 1168405738 19:56109350-56109372 CCCCTTTCTTCCTGCAAGCAGAT 0: 1
1: 0
2: 2
3: 38
4: 345
Right 1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168405745 Original CRISPR GAAACACGCCCTCCTCGTAG AGG Intronic
919820656 1:201469777-201469799 CATTCATGCCCTCCTCGTAGTGG + Intergenic
920958013 1:210637030-210637052 GAAAAACACCTACCTCGTAGGGG + Intronic
1088572512 11:111236782-111236804 GGAACACGGGCTGCTCGTAGAGG - Intergenic
1094411540 12:30172374-30172396 GAAACATGCCCTCCTGAGAGTGG + Intergenic
1097229419 12:57500423-57500445 GACACACGCCCTCCACGAAGCGG - Exonic
1122208180 14:100158864-100158886 TAAAGATGCCCTCCTCGCAGAGG + Intronic
1129286705 15:74531335-74531357 GTAACAAGCCCTCCTGGCAGTGG - Intergenic
1130850194 15:87785065-87785087 GAACCACGCCCCTCTCCTAGGGG - Intergenic
1132952232 16:2569838-2569860 GTGCCACGCCCTCCTCCTAGAGG + Intronic
1132962119 16:2630332-2630354 GTGCCACGCCCTCCTCCTAGAGG - Intergenic
1136377379 16:29873345-29873367 GAGACTCGCCCGCCTGGTAGTGG + Exonic
1141163225 16:81643147-81643169 GTAACACGTCCACCTCGTGGAGG + Intronic
1146393779 17:32445158-32445180 GAAAGAGACCCTCCTCTTAGTGG - Intronic
1149610828 17:57956567-57956589 GAACCACACCCTCCTCGGGGAGG + Intergenic
1159870220 18:73752868-73752890 GAAACACCCCCTCATTCTAGGGG + Intergenic
1161731227 19:5961924-5961946 GAACCACGCGCTCTTGGTAGTGG - Intronic
1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG + Intronic
1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG + Intronic
928149247 2:28811124-28811146 GACACACGCGCTCCCCGCAGCGG + Intronic
938517682 2:132032349-132032371 CAAACATGCCCTCTTCCTAGCGG + Intergenic
1183330548 22:37218550-37218572 GAAACACGCCCCTCCCATAGAGG + Intergenic
950269326 3:11601045-11601067 GGCACACACCCTCCTCGCAGAGG - Intronic
954802890 3:53197310-53197332 CAAACACGTCCTCCACGTGGCGG - Intergenic
961718471 3:128875605-128875627 TAAACACACCATCCTCTTAGAGG - Intergenic
985929603 5:3046905-3046927 GAAACAGGTCCTCATCTTAGTGG + Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1015249022 6:131107398-131107420 GAAAAACACCCTCTTCCTAGAGG + Intergenic
1016737448 6:147494593-147494615 GAAACACACCCTCCTGGGTGTGG + Intergenic
1019928460 7:4208283-4208305 GAAACCCGCCTTCCTCCTACCGG - Exonic
1020718957 7:11717235-11717257 GAAAGACGGCCTCCTCGCAGAGG + Intronic
1021027376 7:15686222-15686244 CAAACATGCCCTCTTCGTTGGGG + Exonic
1200115709 X:153768869-153768891 GGGACACGCCCTCCTCCTAGTGG - Intronic
1200958965 Y:8979948-8979970 GAACCACACCCTCCTCTAAGAGG - Intergenic