ID: 1168405940

View in Genome Browser
Species Human (GRCh38)
Location 19:56110758-56110780
Sequence CAGGCTATGGATGGGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 547}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168405919_1168405940 26 Left 1168405919 19:56110709-56110731 CCCCTGGCCTCCACCTCCGGCCA 0: 1
1: 0
2: 1
3: 48
4: 548
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405921_1168405940 24 Left 1168405921 19:56110711-56110733 CCTGGCCTCCACCTCCGGCCAGC 0: 1
1: 0
2: 2
3: 59
4: 584
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405920_1168405940 25 Left 1168405920 19:56110710-56110732 CCCTGGCCTCCACCTCCGGCCAG 0: 1
1: 2
2: 3
3: 46
4: 492
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405927_1168405940 10 Left 1168405927 19:56110725-56110747 CCGGCCAGCTTCCTGCAGGGTGA 0: 1
1: 0
2: 4
3: 35
4: 316
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405930_1168405940 -1 Left 1168405930 19:56110736-56110758 CCTGCAGGGTGAAGGCCTTGACC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405923_1168405940 16 Left 1168405923 19:56110719-56110741 CCACCTCCGGCCAGCTTCCTGCA 0: 1
1: 0
2: 1
3: 38
4: 474
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405929_1168405940 6 Left 1168405929 19:56110729-56110751 CCAGCTTCCTGCAGGGTGAAGGC 0: 1
1: 0
2: 3
3: 49
4: 274
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405925_1168405940 13 Left 1168405925 19:56110722-56110744 CCTCCGGCCAGCTTCCTGCAGGG 0: 1
1: 0
2: 6
3: 25
4: 333
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405917_1168405940 30 Left 1168405917 19:56110705-56110727 CCTTCCCCTGGCCTCCACCTCCG 0: 1
1: 1
2: 3
3: 119
4: 1370
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547
1168405922_1168405940 19 Left 1168405922 19:56110716-56110738 CCTCCACCTCCGGCCAGCTTCCT 0: 1
1: 0
2: 8
3: 99
4: 944
Right 1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG 0: 1
1: 0
2: 3
3: 49
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168405940 Original CRISPR CAGGCTATGGATGGGGGAGG CGG Intronic
900185404 1:1331003-1331025 CAGGCTGTGGAGAGGAGAGGGGG - Intergenic
900310766 1:2032192-2032214 CAGGCTGGGGATGGAGGGGGTGG + Intergenic
900529048 1:3143860-3143882 CTGTCTGTGGATGGAGGAGGAGG + Intronic
900532257 1:3160366-3160388 CAGTCCCTGGCTGGGGGAGGGGG + Intronic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
901102055 1:6726518-6726540 CAGGCTGAGAATGGGGGAGTGGG - Intergenic
901662059 1:10804658-10804680 CTGGATGTGGGTGGGGGAGGAGG + Intergenic
901830970 1:11892305-11892327 AAGCCCATGGATGGGGAAGGGGG - Intergenic
902681771 1:18048819-18048841 CAGTCCAGGGCTGGGGGAGGTGG - Intergenic
902808985 1:18877682-18877704 CGGGCCATGGATGGCGTAGGTGG - Intronic
903281699 1:22253958-22253980 CGGGGTATGGGTGGGGGTGGAGG - Intergenic
903295413 1:22340277-22340299 CAGGCTTTTGTTGGGGTAGGGGG + Intergenic
903328679 1:22585990-22586012 CAGGCCAGGGATGGGGGTGCTGG - Intronic
903335823 1:22623833-22623855 AAGGCTATGGGTGTGGGCGGGGG + Intergenic
903540388 1:24093232-24093254 CAGGCCTTGGGTGGGGGTGGTGG + Intronic
904328324 1:29741934-29741956 CAGGCTTTGGAGGGGTGGGGTGG - Intergenic
904466993 1:30714185-30714207 CAGGCCAGTGTTGGGGGAGGCGG - Intronic
904473564 1:30750640-30750662 CAGCCATGGGATGGGGGAGGGGG - Intronic
905022317 1:34826439-34826461 CCTGCTTTGGATGGAGGAGGGGG - Intronic
905232608 1:36523848-36523870 AAGGCTATGGTTAGGGGAAGTGG - Intergenic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
905545187 1:38792198-38792220 CAGGCATTAGATGGTGGAGGTGG - Intergenic
906480583 1:46196940-46196962 TAGGCTAAGGATGGGGTAGGGGG - Intronic
906560017 1:46749436-46749458 CAGGCTATGGCAGGGTGAGGAGG - Intergenic
906584137 1:46961577-46961599 CAGGCTATGATGTGGGGAGGAGG + Intergenic
906694362 1:47814218-47814240 CAGCCTGTGGCTGGTGGAGGTGG + Intronic
907310660 1:53537180-53537202 CAAGCTCTGGCTTGGGGAGGGGG + Intronic
907744402 1:57198580-57198602 CAGGATATGGATGGAGGTGGGGG - Intronic
907876940 1:58499221-58499243 CAGGCTGGGGATCGGGGAGTAGG + Intronic
908371868 1:63490503-63490525 CAGGGTATGGTTGGGAGAGTTGG - Intronic
908796592 1:67835979-67836001 AAGGCTAGGGATGGAGGTGGAGG - Intergenic
908939546 1:69415176-69415198 AGGGGTATGGTTGGGGGAGGGGG + Intergenic
910612597 1:89161077-89161099 CAGGGTATGGATGGAGCTGGAGG - Intronic
912333475 1:108841292-108841314 CAGACTAAGGAAGGGAGAGGAGG + Intronic
912475896 1:109934526-109934548 GAGGCTATGGATCGGGGCAGTGG + Intergenic
912641756 1:111352804-111352826 GAGGATATTGATGGGGGTGGAGG + Exonic
912776129 1:112507669-112507691 CAGTCTTTGGTTGGGGGTGGGGG - Intronic
913007618 1:114650375-114650397 CAGACTATGGCTGGGTGCGGTGG + Intronic
913493377 1:119404075-119404097 CAGGCTGTTGATGGTGGGGGAGG + Intergenic
913688028 1:121252641-121252663 CAGGGTGTGGATTGGGGTGGTGG + Intronic
914001521 1:143698690-143698712 CTGGCAATGGATGTGGGATGTGG + Intergenic
914039885 1:144040281-144040303 CAGGGTGTGGATTGGGGTGGTGG + Intergenic
914149574 1:145027639-145027661 CAGGGTGTGGATTGGGGTGGTGG - Intronic
914245254 1:145880996-145881018 CAGGCCATGGCTGGGTGCGGTGG + Intronic
915107222 1:153542089-153542111 GAGGTTGTGGATTGGGGAGGGGG + Intergenic
915493912 1:156267582-156267604 CAGGCTGAGGTTGGGTGAGGAGG + Exonic
915543636 1:156583697-156583719 CAGGAAAGGGAGGGGGGAGGGGG - Intronic
915608589 1:156971813-156971835 TACGCTAGGGATGGGTGAGGAGG + Exonic
915674593 1:157518559-157518581 GAGACTCTGGCTGGGGGAGGAGG - Intronic
916007371 1:160674671-160674693 GAGGTTAGAGATGGGGGAGGAGG + Intergenic
916872526 1:168932429-168932451 AAGGCTATGGGTGTGGGAGAAGG - Intergenic
917065561 1:171089414-171089436 CAGGCTCTGGTTGGGGCAGTGGG - Intergenic
919470936 1:197978452-197978474 GAGGCTGGGGATGGGGGAGAGGG - Intergenic
919808432 1:201394742-201394764 CAGGCTATGGACAAGGGACGGGG - Intronic
919991755 1:202712165-202712187 CTGGCTAAGGGTGGGGGTGGTGG - Intergenic
920074280 1:203325465-203325487 CAGGCTAGGGGTGGGGAGGGAGG - Intergenic
920247433 1:204599098-204599120 CAGGCTATGGAAGGCGAAGGTGG + Intergenic
920475350 1:206271140-206271162 CAGGGTGTGGATTGGGGTGGTGG + Intronic
920769997 1:208875082-208875104 CAGCTAATGGGTGGGGGAGGAGG - Intergenic
920844771 1:209584547-209584569 CATGGTGTGGATGGGGGTGGTGG - Intronic
921838471 1:219802706-219802728 CTGGCTATGAATGGGTGAGAAGG - Intronic
922199906 1:223393229-223393251 GAGGCTGGGGATGGGGGTGGTGG - Intergenic
922384213 1:225065513-225065535 AAGGCTATGGGTGGGGGAAATGG - Intronic
922491835 1:226023769-226023791 AAGTATCTGGATGGGGGAGGGGG + Intergenic
922765098 1:228152417-228152439 CAGGAGCTTGATGGGGGAGGGGG + Intronic
923193096 1:231639600-231639622 AAGGACATGGATGGGGAAGGAGG + Intronic
923334086 1:232951747-232951769 CAGGCATTGGATGGGGGAGTTGG + Intronic
923427848 1:233890174-233890196 CAAGGTATGGAGGTGGGAGGTGG + Intergenic
923666918 1:236006723-236006745 GAGGCTATGATTGGGGCAGGTGG + Intronic
923695633 1:236247703-236247725 GATGCTAGGGATGGGGCAGGAGG - Intronic
1062824070 10:556083-556105 CCGGCTATGGAAGGGGGGGTGGG - Intronic
1062972970 10:1662418-1662440 CAGGCTCTGGGTGGGGGAAGGGG - Intronic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1064271823 10:13872226-13872248 GTGGCTCTGGATGGGTGAGGAGG + Intronic
1064295368 10:14074237-14074259 GAAGCAGTGGATGGGGGAGGGGG + Intronic
1064471029 10:15636144-15636166 CAGGCATTGGAAGGTGGAGGAGG - Intronic
1065623360 10:27606310-27606332 CAGTCTATGGGTTGGGGGGGTGG - Intergenic
1067140841 10:43655345-43655367 CATGCTATGGGTGGGGGATTTGG + Intergenic
1067907106 10:50304091-50304113 CACAGTATTGATGGGGGAGGGGG + Intergenic
1069677960 10:70262232-70262254 CAGGATATGGTTGGGGAGGGGGG + Intronic
1069820225 10:71222958-71222980 TGGGATAGGGATGGGGGAGGGGG - Intronic
1069899081 10:71696688-71696710 GTGGCTCTGGATGGGAGAGGAGG - Intronic
1070540763 10:77413559-77413581 AAGGGAATGGATGGAGGAGGTGG + Intronic
1070676901 10:78418067-78418089 GGGGCTGTGGGTGGGGGAGGTGG + Intergenic
1070791299 10:79191070-79191092 CCTGCTATGGGTGTGGGAGGTGG + Intronic
1070799701 10:79238064-79238086 CAGGCTACCGAGCGGGGAGGGGG - Intronic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1072118416 10:92385406-92385428 CAGGCTCTGGCTGGGTGTGGTGG - Intergenic
1072190538 10:93073634-93073656 CACACCTTGGATGGGGGAGGCGG + Intronic
1072194990 10:93109889-93109911 CAGGTTATGGGAGGGGGAGAAGG + Intergenic
1072409309 10:95185041-95185063 CAGGCTATGGTCGGGGCAGTGGG - Intergenic
1072430922 10:95369860-95369882 CAGGTGATGGGTGGGGCAGGTGG - Intronic
1072618135 10:97063211-97063233 GAGGTGATGGATGGGGCAGGAGG + Intronic
1072618144 10:97063252-97063274 GAGGTGATGGATGGGGCAGGAGG + Intronic
1072626002 10:97112369-97112391 CAGGCTGTGGATGCGGAAAGGGG - Intronic
1072635013 10:97172331-97172353 TTGGCTCTGGCTGGGGGAGGTGG - Intronic
1072727264 10:97822204-97822226 CAGGCTATGAAGGGGTGGGGTGG + Intergenic
1073116416 10:101094254-101094276 CAGGGTTGGTATGGGGGAGGTGG - Intronic
1073428727 10:103472134-103472156 CAGGCTAGCGGTGGGGCAGGTGG + Intergenic
1073683008 10:105725192-105725214 TAGATTATGGATGGAGGAGGCGG + Intergenic
1073825642 10:107317465-107317487 CAGGATATGGATGGAGCTGGAGG + Intergenic
1074128257 10:110548202-110548224 CAGGCAGGGGATGGGGGTGGCGG - Intergenic
1074976507 10:118586211-118586233 CAGGCATTGGCTGGGGGTGGTGG + Intergenic
1076372971 10:129966906-129966928 CAGGCCAGGGATGGGGAAGGGGG + Intergenic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1076707161 10:132308180-132308202 CAGTCTAGGGATGGGGGCTGTGG + Intronic
1076718785 10:132383398-132383420 CAGGTTGTGGACGGAGGAGGAGG - Intergenic
1077551776 11:3203587-3203609 CAGGCTGGGGGTGGGGGTGGGGG + Intergenic
1077581438 11:3419692-3419714 CAGGCTGTGGCTGGGCGGGGTGG + Intergenic
1077837445 11:5937186-5937208 CAGGCTAGGGATGAGAGAGACGG - Intronic
1079451324 11:20601779-20601801 CAGGTGATGGATGCGGGAGGCGG + Intronic
1080052213 11:27869272-27869294 CAAGCTATGGTTGGGGCAGGAGG + Intergenic
1080533304 11:33197755-33197777 CAGGCAATGGATGGTGGTGATGG - Intergenic
1081773672 11:45664404-45664426 CAGGCCCGGGGTGGGGGAGGGGG + Intronic
1083156903 11:60828878-60828900 CAGGCTGTGGCTGGGGGCTGTGG - Intergenic
1083191103 11:61052943-61052965 CAGGCCATGGTTGGGAGATGGGG - Intergenic
1083629708 11:64089240-64089262 CGGGCTCTGGGTGGGGGAGCAGG + Intronic
1083654662 11:64223673-64223695 CAGGCCAGGGATGGGGGTGGGGG + Exonic
1084659502 11:70538617-70538639 CAGGAAATGCATGGAGGAGGAGG + Intronic
1084804804 11:71571488-71571510 CAGGCCAGGGATGGAGGAGCGGG + Intergenic
1084805651 11:71577035-71577057 CAGGCCAGGGATGGAGGAGCGGG - Intergenic
1085253700 11:75160077-75160099 CAAGGAATGGATGGGGGAGAGGG - Intronic
1086158083 11:83690670-83690692 CATGCTGTGGGTGGGGGTGGGGG + Intronic
1086371096 11:86156547-86156569 CAGGCTAGGGCTGGGGGCTGGGG - Intergenic
1086898026 11:92335981-92336003 CAGGCAAGGGGTGGGGAAGGTGG + Intergenic
1088102198 11:106167819-106167841 CAGGTTATGAAAGGGGGAGAAGG + Intergenic
1089783343 11:120890293-120890315 CAGCTTATGCATGGGAGAGGAGG + Intronic
1090168955 11:124581406-124581428 TTGGCTCTGGATGGAGGAGGGGG + Intergenic
1090240760 11:125179982-125180004 CAGGACATGAATTGGGGAGGAGG - Intronic
1090741820 11:129669087-129669109 CAGAAAATGGATGGGGGAGTGGG - Intergenic
1091596436 12:1882058-1882080 CAGGCTGTGGAAGGGGAAGGGGG - Intronic
1091725756 12:2845500-2845522 CAGGCTTGGAAAGGGGGAGGTGG + Intronic
1091745865 12:2992502-2992524 CAGGCCATGGGTGGGAGATGAGG + Intronic
1092116491 12:6012416-6012438 CACGCCAGGGATGGGGAAGGTGG + Intronic
1092169514 12:6364224-6364246 CAGTCTTTGGAGGAGGGAGGCGG - Intronic
1092986013 12:13847286-13847308 AAGCATATGGATGGGGAAGGTGG + Intronic
1093016548 12:14161155-14161177 CAGGAGAGGGAGGGGGGAGGAGG + Intergenic
1093267907 12:17024585-17024607 CAGGCTTTGGATTGGGAAGAAGG + Intergenic
1094409448 12:30153398-30153420 AAGGGTCTGGATAGGGGAGGTGG - Intergenic
1095989603 12:48025600-48025622 CAGGCTTGGGCTGGGGGCGGGGG - Intergenic
1096230551 12:49894465-49894487 TGGGCTGTGGGTGGGGGAGGGGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097140189 12:56896066-56896088 CAAGGTAAGGATGGTGGAGGAGG - Intergenic
1098390837 12:69968125-69968147 CAGGCTAGGGTTGGTGGTGGTGG + Intergenic
1100232195 12:92619723-92619745 CTGGCTATAAATGGGGGAGAGGG + Intergenic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101306823 12:103536651-103536673 CAGGCTATGGATGTTGGGGTTGG - Intergenic
1101707027 12:107230373-107230395 CAGGCTATGGAGGGAGAGGGAGG - Intergenic
1102029976 12:109734718-109734740 TAGGCTATGACAGGGGGAGGGGG + Intronic
1102273459 12:111560683-111560705 TAGCCTATGGTTGGGGGTGGTGG - Intronic
1103616387 12:122155586-122155608 CAAGCAATGGACGGGGGTGGGGG - Intergenic
1103850342 12:123928857-123928879 CAGGCTGTGTGTGGGGGGGGGGG - Exonic
1104323522 12:127774211-127774233 CAGGAGATGGAGGGTGGAGGTGG - Intergenic
1104685999 12:130784530-130784552 AAGGCTAAGGTTGGGGGAGTGGG + Intergenic
1108047076 13:46393359-46393381 TAGGTTCTGGATGGGGGATGGGG - Intronic
1108084231 13:46768208-46768230 AAGGCAATGGAAGGGGGTGGTGG - Intergenic
1108508559 13:51135017-51135039 CAGGCAAGGGGTGGGAGAGGAGG - Intergenic
1109358003 13:61257442-61257464 GAGGCTGTGTATGTGGGAGGGGG - Intergenic
1109650260 13:65314464-65314486 CTGGCAATGGATGGGGAATGGGG - Intergenic
1110589106 13:77233412-77233434 TAGGTTATGGGTGGGGGTGGGGG - Intronic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113642600 13:111968822-111968844 CAGGCTGCTGATGGCGGAGGAGG - Intergenic
1115309570 14:31965650-31965672 CAGGCTCAGGATGGGGGTAGGGG - Intergenic
1117546375 14:56797673-56797695 CAGGCTCTGGAATGGGGAAGCGG - Intergenic
1118767616 14:68920703-68920725 AGGCCTCTGGATGGGGGAGGTGG + Intronic
1119395496 14:74323294-74323316 CAGGTTCTGGCTGGGGGCGGTGG + Intronic
1119668045 14:76498834-76498856 CAGGCCACAGATGGGGGAGGGGG - Intronic
1119775367 14:77244727-77244749 CAGGATATGGCTGGGGGCTGAGG - Intronic
1119900073 14:78251913-78251935 CAGGCTGTGGCTGGCAGAGGAGG + Intronic
1121171042 14:91854760-91854782 CAGGGTATGGATTGTGGAAGTGG - Intronic
1121582445 14:95040953-95040975 CAGTGTTTGGAAGGGGGAGGGGG + Intergenic
1121609781 14:95269874-95269896 CAGCCTGTGGATTGGGGTGGGGG - Intronic
1121798382 14:96754116-96754138 CAGGGTGTGGAAGGGGGAGAGGG + Intergenic
1121921726 14:97888284-97888306 CAGGCCTGGGATGGTGGAGGTGG + Intergenic
1122056930 14:99105379-99105401 CAGTCTTTGGGTGGGGGGGGGGG + Intergenic
1122116768 14:99531572-99531594 GAGGCCATGGGTGGGGGGGGGGG + Intronic
1122292820 14:100688597-100688619 CAGGACTTGGGTGGGGGAGGAGG + Intergenic
1122355143 14:101118436-101118458 TGGGCCAGGGATGGGGGAGGAGG - Intergenic
1122451759 14:101814514-101814536 GAGCGTATGGATGAGGGAGGTGG - Intronic
1122856777 14:104563792-104563814 GAGGCTGTGTGTGGGGGAGGAGG + Intronic
1122920091 14:104876478-104876500 GGGGCTATGGCTGGGGGAGGAGG - Intronic
1123413010 15:20074451-20074473 CCGGCTGTGGATGGCCGAGGCGG - Intergenic
1123522352 15:21081564-21081586 CCGGCTGTGGATGGCCGAGGCGG - Intergenic
1124022682 15:25938798-25938820 CAAGTTTTGGAGGGGGGAGGGGG + Intergenic
1125171244 15:36768770-36768792 CAGGCTTTGGCTGGGGAAGCAGG + Intronic
1125796726 15:42409007-42409029 CAGGCCTGGGATGGTGGAGGGGG + Intronic
1126689787 15:51280383-51280405 CAGGCTTTGGCTGGGCGTGGTGG - Intronic
1126814584 15:52442254-52442276 CAGGAGATGGCTGGTGGAGGTGG - Intronic
1126947090 15:53833265-53833287 CAGGCTATAGCTAGTGGAGGAGG - Intergenic
1127315166 15:57788204-57788226 CAGGAAATAGATGGGGCAGGTGG + Intergenic
1127828005 15:62722735-62722757 CAGGATATGGAAAGAGGAGGAGG - Intronic
1127975040 15:63990890-63990912 CAGGCTGTGGCTGTGGGATGTGG - Intronic
1128509784 15:68306338-68306360 CAGGGTATGTGTGGGGGAGCGGG + Intronic
1128549822 15:68590920-68590942 AAGGGTAGGGATGGGGAAGGCGG - Intronic
1128770553 15:70278548-70278570 CAGGATGGGGATGGGGGAGTGGG + Intergenic
1128786508 15:70401378-70401400 CATCCTATTGTTGGGGGAGGCGG - Intergenic
1128811731 15:70578101-70578123 GAGGCTATGGGTGGAGGACGGGG - Intergenic
1129029083 15:72605518-72605540 CAGGCTTGGGAGGGGGCAGGAGG - Intergenic
1129232374 15:74203893-74203915 CAGGCTCAGGATGGGGATGGGGG + Intronic
1129232378 15:74203899-74203921 CAGGATGGGGATGGGGGTGGGGG + Intronic
1129834070 15:78690982-78691004 CAGGGTCTGGATGGGAGTGGGGG + Intronic
1129929435 15:79398144-79398166 CAGGGGTTGGATGGAGGAGGAGG - Intronic
1130011050 15:80153083-80153105 CAGGTTGTGGATGGGGAAGTCGG - Exonic
1130843457 15:87723304-87723326 CAGGTGAGGGTTGGGGGAGGGGG - Intergenic
1131499908 15:92952317-92952339 CAGGCTGGGGAGGAGGGAGGGGG + Intronic
1132104110 15:99050585-99050607 CAGGGCATGGGTGGGGGGGGGGG - Intergenic
1132155366 15:99492232-99492254 CAGCCTTTGGTTGGGGCAGGAGG + Intergenic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132547370 16:539567-539589 GAGGCTATGGCTGAGGGCGGGGG - Intronic
1132622777 16:875627-875649 CGGGCCATGGAAGCGGGAGGTGG + Intronic
1132709168 16:1258868-1258890 GAGGCTCAGGATGGAGGAGGGGG - Exonic
1132852828 16:2032622-2032644 CTGGCTGGGGATAGGGGAGGTGG + Intronic
1132906775 16:2286531-2286553 GGGGCTGTGGATGGTGGAGGAGG + Intronic
1133207502 16:4242128-4242150 CAGGCGGTGGAGGGGGGAGAGGG + Intergenic
1133263887 16:4571510-4571532 CCGGGTATGGCTGGGGGAGAAGG - Intronic
1133402016 16:5495092-5495114 CAGGCTGTGCATGGCTGAGGAGG + Intergenic
1134050263 16:11132244-11132266 CAGGGGCTGGATGGGGGCGGGGG - Intronic
1134236660 16:12471602-12471624 CAGGCCGTAGATGGGGCAGGAGG - Intronic
1134598002 16:15511225-15511247 CAGGCTGTGGCTTGGGGAGAGGG - Intronic
1135005526 16:18818777-18818799 GAGGCTGTGGATTGGGCAGGGGG - Intronic
1135144585 16:19950287-19950309 CAGGCTATGGACCGGGGTTGGGG + Intergenic
1137444266 16:48522275-48522297 CAGGCTGGGGTTGGGGGTGGTGG + Intergenic
1137521063 16:49195800-49195822 CAGCCTAGGGATGGGGCAAGGGG - Intergenic
1137740686 16:50769803-50769825 GAGGTTAAGGATGGGGCAGGAGG - Intronic
1137759578 16:50929276-50929298 CATGCAATGGAAGTGGGAGGAGG - Intergenic
1137830513 16:51539213-51539235 CAGGCACAGGATGGGGGAGAGGG + Intergenic
1138586064 16:57971174-57971196 CAGGTGCTGAATGGGGGAGGGGG + Intergenic
1138674337 16:58640166-58640188 AAGGCGGTGGAGGGGGGAGGTGG + Intergenic
1139908150 16:70380737-70380759 GAGGCGATGGGTGGAGGAGGAGG + Exonic
1140387993 16:74559454-74559476 GAGGGTAAGGCTGGGGGAGGAGG + Intronic
1141020069 16:80486761-80486783 GAGCCTGTGGATGGGGGATGTGG - Intergenic
1141055786 16:80812481-80812503 CATCCTAGGGATGGGGGTGGGGG - Intergenic
1141819954 16:86438487-86438509 CAGCTGATGGATGGGAGAGGTGG + Intergenic
1141993356 16:87622549-87622571 GAGGCTGTGGCTGGGGTAGGAGG + Intronic
1142383711 16:89748903-89748925 CAGGCTTTGGATGGGACAGAGGG - Intronic
1142633099 17:1238752-1238774 CAGGCCATGGCTGGGCGTGGTGG - Intergenic
1142867553 17:2799880-2799902 CAGGCTGGGGATGGAGGAGCTGG + Intronic
1144340818 17:14309330-14309352 CAGCCTAGGGGCGGGGGAGGCGG - Intronic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1144801242 17:17929305-17929327 CAGGCTTTGGGTGGGTGAGAGGG + Intronic
1145272239 17:21410986-21411008 CAGTCTCTGCATGGGGGATGGGG + Intronic
1145858276 17:28183614-28183636 CAGGCTAAGGCTGGGTGCGGTGG - Intronic
1146644445 17:34567785-34567807 GCAGCCATGGATGGGGGAGGTGG - Intergenic
1148108533 17:45132117-45132139 GAGGCTATGGCTAGGGGCGGAGG - Intronic
1148226719 17:45903366-45903388 CAGGCCATGGGAGGGGGATGAGG - Intronic
1148540015 17:48472857-48472879 CAGGCATGGGATGGGGGAAGAGG - Intergenic
1148674686 17:49438560-49438582 GAGGAGCTGGATGGGGGAGGGGG + Intronic
1149205919 17:54247739-54247761 CAGGCCATGGATAGGGGTGTGGG + Intergenic
1149361406 17:55899378-55899400 GAGGGTATGGCTGGTGGAGGTGG - Intergenic
1149449373 17:56737961-56737983 CAGGCGCTGGCTGTGGGAGGTGG - Intergenic
1149906832 17:60534257-60534279 CAGACTCTGGCTGGGTGAGGTGG - Intergenic
1150160490 17:62893965-62893987 CAAGGTAGGGATGGGGGAGGCGG + Intergenic
1150662948 17:67101346-67101368 CATGGAGTGGATGGGGGAGGAGG - Intronic
1150690467 17:67362385-67362407 CAGGCTCTGGCTGGGCGCGGTGG + Intronic
1151453612 17:74213771-74213793 CAGGCTCTCGAGGGGAGAGGGGG - Intronic
1151527638 17:74681799-74681821 CAAGTGATGGATGGGGCAGGTGG - Intronic
1151581655 17:74982555-74982577 CAGGTTCTGGATGGGGGAACGGG - Intergenic
1151867447 17:76813570-76813592 GGGGTTATGGGTGGGGGAGGAGG - Intergenic
1152518257 17:80838691-80838713 GAGGCCAGGGATGGGGGAGGCGG + Intronic
1152693844 17:81734162-81734184 CAGGCTGGGGTTGGGTGAGGAGG - Intergenic
1153162460 18:2222998-2223020 CAGGTTATGCTTGGAGGAGGAGG + Intergenic
1153163691 18:2238317-2238339 CAGACTTTGGGTGGGGGTGGAGG + Intergenic
1153211963 18:2777057-2777079 TAGGGTATGGGGGGGGGAGGTGG - Intronic
1153348751 18:4056128-4056150 CAGGTTATCTATGGGGAAGGGGG + Intronic
1153987880 18:10369045-10369067 CAGGCAATGCATGGGGCAGGTGG - Intergenic
1154123460 18:11670087-11670109 CAGGCTGGGGCTGGGGGAGAGGG - Intergenic
1155330222 18:24708196-24708218 CAGGATTGGGATGGGGGTGGGGG + Intergenic
1155640693 18:28010572-28010594 CAGGCTATGGAAGGGGACGAAGG + Intronic
1156292403 18:35759452-35759474 GAGGCTGGGGAGGGGGGAGGGGG + Intergenic
1156473081 18:37389589-37389611 CTGGGTATGCTTGGGGGAGGTGG + Intronic
1156480108 18:37430937-37430959 CAGGCAATGGATGGGAGTGTGGG - Intronic
1156599470 18:38587735-38587757 CAGACTGTGGATGTAGGAGGTGG + Intergenic
1157776302 18:50399332-50399354 CAGGATCTGGATGGGGCAGCTGG - Intergenic
1158685805 18:59613174-59613196 CAGGGCATGGATGGGGTGGGGGG + Intronic
1158725730 18:59969760-59969782 CAGGCTGTGCAGGGGGGCGGCGG + Intergenic
1159402712 18:67958093-67958115 CAGTCTATTGTTTGGGGAGGAGG + Intergenic
1159580952 18:70234474-70234496 CAGGATGTGAATGGGGGAGGGGG - Intergenic
1159599892 18:70419016-70419038 CAGCTTATGGATAGGTGAGGCGG + Intergenic
1159644520 18:70901593-70901615 GAGGGTGTGGTTGGGGGAGGTGG + Intergenic
1160786040 19:900662-900684 CCAGGTATGGATGGGGGATGGGG - Intronic
1160898101 19:1412248-1412270 CAGGCTATGGAGGGGCGGGCTGG + Intronic
1161206930 19:3046437-3046459 CGGGCTGGGGATGGGGAAGGGGG + Intronic
1161266683 19:3367484-3367506 GAGGCTACGGGAGGGGGAGGGGG - Intronic
1161383141 19:3977088-3977110 CAGGTGATGGATGGAGCAGGTGG - Intronic
1161482438 19:4517693-4517715 CAGGGTCTGCATGGGGGCGGGGG + Exonic
1161573842 19:5044750-5044772 CAGGAGAGGGATGGGGGAGAGGG - Intronic
1162078827 19:8206826-8206848 CAGGCAATGGAGGAAGGAGGAGG + Intronic
1162925674 19:13929701-13929723 CAGGATAGGCATGGGGGGGGAGG + Intronic
1164573790 19:29393379-29393401 CAGGCAATGAGAGGGGGAGGTGG + Intergenic
1164740959 19:30575383-30575405 AAGGCTCTGGATGGGAGGGGTGG - Intronic
1164804749 19:31108188-31108210 CAGGCTATGGGTAGGCAAGGTGG + Intergenic
1165143518 19:33717171-33717193 CATGCTCTGGCTGGGTGAGGTGG + Intronic
1165782627 19:38442891-38442913 CACGCTTGGGATGGGGGAGGTGG - Intronic
1166046371 19:40233163-40233185 CACCCTATGGATGAGGCAGGAGG - Exonic
1166760100 19:45218663-45218685 CAAGTGAGGGATGGGGGAGGGGG + Intronic
1167360017 19:49025018-49025040 CACGATGTGCATGGGGGAGGAGG - Intronic
1167361066 19:49030753-49030775 CACGATGTGCATGGGGGAGGAGG + Intronic
1167643881 19:50695527-50695549 AGGGCTCTGGAGGGGGGAGGGGG - Intronic
1168080012 19:54003188-54003210 CAGGCTCAGGGAGGGGGAGGCGG + Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
925508521 2:4597617-4597639 CATTCTGTGGATGGGGGAAGGGG + Intergenic
926188073 2:10707199-10707221 CAGGCTGTGGAGGGCTGAGGAGG + Intergenic
926297478 2:11579162-11579184 CAGGCGATGGATGGGCCAGGTGG - Intronic
927219153 2:20690688-20690710 CTGGCGGGGGATGGGGGAGGAGG + Intronic
927256296 2:21043693-21043715 CAGGCTCAGGATGGGGGGCGCGG - Intronic
927639418 2:24837281-24837303 CAGGTTATGGAGTGGGAAGGAGG + Intronic
928789350 2:34932456-34932478 GAGGCTATGGATAAGGGAGAAGG + Intergenic
929867352 2:45729514-45729536 CAGGCTATTGCTGTAGGAGGGGG - Intronic
929872768 2:45772745-45772767 CAAGCTCTGCATGGGGAAGGTGG + Intronic
929890969 2:45918263-45918285 CTGGCTGTGGAAGGGGCAGGTGG + Intronic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
930113185 2:47696301-47696323 CAGGTTCTGGGAGGGGGAGGAGG + Intronic
930880628 2:56266147-56266169 CAGGATATGGGTGGGGAAAGGGG + Intronic
931819983 2:65942019-65942041 CAGGCTGTTGCTGGGGGAGGAGG + Intergenic
931938918 2:67230699-67230721 CAGGCACAGGATGGGGGATGGGG - Intergenic
931948121 2:67332872-67332894 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
932014595 2:68011575-68011597 CAGGCGAGGTATGGGGGAAGGGG + Intergenic
932336162 2:70932643-70932665 CAGGTGGTGGATGGGGGTGGGGG - Intronic
932761136 2:74440025-74440047 CAGGCCAGGGATGTGGGCGGGGG - Intronic
932796507 2:74700429-74700451 AATGCCATGGATGGGGTAGGGGG - Intergenic
932837405 2:75050457-75050479 CAGCCTCTGGATGGGGAAGGAGG - Intronic
932912859 2:75822515-75822537 CTGGCTTTGGAAGGTGGAGGTGG - Intergenic
933559734 2:83875138-83875160 CAGGCTAGGGATGAGAGAGATGG + Intergenic
934976352 2:98805559-98805581 GAGGCTCTGGAGGGTGGAGGAGG - Intronic
935591881 2:104852519-104852541 CAGGCTCTGGCTGGGGGCGGCGG + Intergenic
935654943 2:105414041-105414063 CAGGCTATTAGTTGGGGAGGGGG + Intronic
936004568 2:108872229-108872251 GATGCTATGGTGGGGGGAGGAGG - Intronic
940252388 2:151693415-151693437 GAGGCTGGGGGTGGGGGAGGCGG - Intronic
940841681 2:158589979-158590001 CTGCCTAGGGATGGGGGTGGGGG + Intronic
941212376 2:162657085-162657107 CAGGTTGTGGATAGTGGAGGAGG - Intronic
941494993 2:166189095-166189117 CAGTCTATGGTGGGGGGAGGGGG - Intergenic
942081518 2:172403571-172403593 GAGGATATGGATGGAGTAGGCGG + Intergenic
942922142 2:181387976-181387998 CAGGCACTGGAGGGGGGAAGTGG + Intergenic
943114292 2:183647001-183647023 CATGCTATGGATTCTGGAGGTGG - Intergenic
943618356 2:190119333-190119355 TAGGCGATGGCTGGAGGAGGCGG + Intronic
944802907 2:203253822-203253844 CTTGCTCTGGATGGGGGTGGTGG + Intronic
945820926 2:214664431-214664453 AAGGCTAGAGATAGGGGAGGGGG - Intergenic
946180184 2:217944167-217944189 GAGGCCATGGCTGGCGGAGGGGG - Intronic
946919696 2:224566069-224566091 CAGCCTGTAGATGGGGAAGGTGG - Intronic
947447980 2:230179310-230179332 AAGGCTAGGCATGGGGGTGGAGG + Intronic
947796601 2:232897111-232897133 GAGGGTAGGGATGGGGTAGGGGG + Intronic
948458803 2:238119389-238119411 CAGGAGGTGGATGGAGGAGGTGG + Intronic
948570131 2:238912649-238912671 GAGGCCAGGGCTGGGGGAGGAGG - Intergenic
948815799 2:240509939-240509961 GAGGGCATGGATGGGGGAGGAGG - Intronic
948975546 2:241461426-241461448 CAGGCTATTGGTGGGGAAGCAGG - Intronic
948976295 2:241465766-241465788 CAGGCGAGGGATGGAGGAGGGGG - Intronic
949007177 2:241656316-241656338 CAGGCTGGGGATGTGGGACGGGG - Intronic
1168971496 20:1934240-1934262 CAAGGGCTGGATGGGGGAGGAGG - Intronic
1170334522 20:15253593-15253615 CGGGGTATGGATGGTGCAGGTGG - Intronic
1171311690 20:24150079-24150101 CAGGACATGCATGGGTGAGGCGG + Intergenic
1171865210 20:30484317-30484339 CAGGGTGTGGGTGGGCGAGGAGG + Intergenic
1171992899 20:31709971-31709993 CAGGCTGTGGCTGGGCGTGGTGG - Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172812874 20:37662476-37662498 CTGCCTAAGGCTGGGGGAGGTGG - Intergenic
1173292296 20:41725611-41725633 CAGACTATGGATGGGCGAACTGG + Intergenic
1174658790 20:52192703-52192725 CAGGGAGTGGTTGGGGGAGGAGG - Intronic
1174826821 20:53776089-53776111 AAGGCTATGGCCGGGCGAGGTGG + Intergenic
1175371514 20:58495946-58495968 CAGGCCAAGGATGGGGGATGTGG - Intronic
1175938288 20:62525262-62525284 CAGGCCATGGCGGGGGGAGTGGG + Intergenic
1176296545 21:5076312-5076334 GAGGCTGTGGATGGGGAGGGTGG - Intergenic
1177257457 21:18683868-18683890 CAGGGTGTGGAAGAGGGAGGAGG + Intergenic
1178007611 21:28240653-28240675 CAGGCTGTGGAGGAGGGAGGAGG - Intergenic
1178690586 21:34746583-34746605 GTGGCTCTGGCTGGGGGAGGAGG + Intergenic
1178974406 21:37209005-37209027 CAGGGGGTGGATGGGGGTGGGGG + Intergenic
1179225411 21:39448595-39448617 CAGGAGATGAATGTGGGAGGTGG + Intronic
1179576679 21:42312610-42312632 CAGGGTAGGGGTGGGGGTGGGGG - Intronic
1179790297 21:43752433-43752455 CAGGTGATGGATCGGGGAGTGGG + Intronic
1179860504 21:44185809-44185831 GAGGCTGTGGATGGGGAGGGTGG + Intergenic
1180190814 21:46161715-46161737 CAGCGCATGGATGGGGGTGGGGG + Intronic
1180258742 21:46651548-46651570 CAGGCAGTGGAGGGGGAAGGCGG + Intronic
1180567909 22:16690902-16690924 CACGCCAGGGATGGGGAAGGTGG + Intergenic
1180938049 22:19638737-19638759 CAGGGCAGGGCTGGGGGAGGGGG + Intergenic
1181419922 22:22790576-22790598 CAGGGCATGGAGGGTGGAGGTGG - Intronic
1181516258 22:23415319-23415341 CAGGCTGTGGCTGGAGCAGGTGG - Intergenic
1181582770 22:23837222-23837244 CAGGCTGTGGATGGGGGCCTGGG - Intronic
1182430125 22:30294328-30294350 GAGGCTAGGGGAGGGGGAGGAGG + Intronic
1182822856 22:33233613-33233635 CAGACAAGGGATGGGGGAGAGGG + Intronic
1182970559 22:34570876-34570898 CAGCCTGTGGTTGTGGGAGGGGG - Intergenic
1183285473 22:36959879-36959901 CAGGGCATGGCTGTGGGAGGAGG - Intergenic
1183359416 22:37375730-37375752 CTGGCTAGGGCTGGGGGTGGGGG + Exonic
1183382239 22:37496004-37496026 CTGGGCATGGATGGGGCAGGGGG + Intronic
1183582652 22:38735151-38735173 CTGGATAGGGAAGGGGGAGGAGG - Exonic
1184004110 22:41696473-41696495 CTGGCTATGGATGTGGGACCCGG + Exonic
1184019803 22:41813423-41813445 CAGGCTGAGGATGGGCGAGTGGG - Exonic
1184258917 22:43303345-43303367 CAGGGCATGGATGGGGCAGGAGG - Intronic
1184288524 22:43485982-43486004 CAGGCAAAGGCTGGGGGAGATGG - Intronic
1184707422 22:46224223-46224245 CAGGCTAGGCAGGGAGGAGGGGG - Intronic
1185335536 22:50269593-50269615 CAGAGTCTGGGTGGGGGAGGGGG - Intronic
1185377044 22:50487490-50487512 CAGGGTGTGGATGGGGGAGAAGG - Intronic
949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG + Intronic
949546799 3:5079893-5079915 CGGACAATGGATGGGGGAGTGGG - Intergenic
949959756 3:9302317-9302339 CAGGCTGGGGAGGGGTGAGGGGG - Intronic
950185731 3:10944481-10944503 GAAGCTATGGATGGTGGTGGAGG + Intergenic
950198740 3:11028159-11028181 CTGGCTCCGGATGGGGGTGGGGG - Intronic
950457579 3:13101869-13101891 CAGGATCTGGATGGGGAAGGAGG - Intergenic
950655094 3:14431606-14431628 CTGGTTCTGGATGGTGGAGGGGG + Intronic
951803478 3:26622761-26622783 CAGGCTGGGAATGAGGGAGGAGG - Intergenic
952668084 3:35932011-35932033 TTGGCTATGCATGGGGCAGGGGG - Intergenic
953470872 3:43164743-43164765 CAGGCTCTTCATGGGGGATGTGG + Intergenic
953570176 3:44065259-44065281 CAGGCTCTGAGTCGGGGAGGTGG - Intergenic
953571945 3:44078205-44078227 CAGGCAGTGGAAGGGGGTGGGGG - Intergenic
953572816 3:44085370-44085392 CAGGCAATGTATGAGAGAGGTGG + Intergenic
953853829 3:46485537-46485559 CAGGCTAAGGCTGGGGGCAGGGG + Intergenic
954368533 3:50158398-50158420 GAGGCCAGGGCTGGGGGAGGTGG + Intronic
954752016 3:52819137-52819159 GACGCTAAGGATGGGGCAGGGGG + Exonic
954807519 3:53229175-53229197 CAGCCCATGGATGGGGGGGTAGG - Intronic
955227508 3:57073209-57073231 CAAGCTTGGGATGGGGAAGGTGG + Intronic
955552203 3:60096834-60096856 CAGGCTGGGGAAGGGGCAGGAGG + Intronic
956462230 3:69484283-69484305 CAGGGGCTGGATGGGGAAGGTGG + Intronic
956698220 3:71936550-71936572 CAGGCCATGGAAGGGGTTGGAGG + Intergenic
958127981 3:89382218-89382240 GAGACTATGGCTGGGGGTGGTGG + Intronic
958744713 3:98118824-98118846 GAGGCTATGGATCAGGAAGGTGG + Intergenic
958953013 3:100436734-100436756 CAGCATATGAATGGGGGAAGGGG - Intronic
959827362 3:110814538-110814560 CAGCCTATGGATGGGGATGGAGG + Intergenic
960176494 3:114523783-114523805 GAGCGTAAGGATGGGGGAGGAGG + Intronic
960944335 3:122956040-122956062 CCGGGTCTGGATGGGGAAGGGGG + Intronic
961105473 3:124237290-124237312 CAGGCTCTGGTTGTTGGAGGTGG + Intronic
961654077 3:128432148-128432170 CAGGCCAGAGATGGGGGAGGTGG + Intergenic
962682193 3:137812017-137812039 GAGGACATGGATGGGTGAGGAGG - Intergenic
963271461 3:143289805-143289827 CTGGCTATGAATGGGAGGGGAGG - Intronic
965738475 3:171847777-171847799 CACGGTGGGGATGGGGGAGGAGG + Intronic
966994474 3:185266352-185266374 CAGTTTATGGCTGGGCGAGGTGG - Intronic
967153331 3:186669535-186669557 CTGGCTTTGCATGTGGGAGGTGG + Intronic
968727107 4:2252817-2252839 CAGGGTGGGGATGGGGGATGGGG - Intronic
969518542 4:7662228-7662250 CAGGGTGGGGGTGGGGGAGGGGG - Intronic
969636165 4:8370512-8370534 CAGGACAGGGATGGGGGAAGAGG + Intronic
969711372 4:8846211-8846233 GAGCCTCTGGATGGCGGAGGAGG - Intronic
975281659 4:72569034-72569056 CAGGCTAAGCCTGGGAGAGGGGG + Intergenic
978747755 4:112212935-112212957 CAGGCCATGGATGGGGGCTGGGG + Intergenic
979211056 4:118103634-118103656 CACGGTTTGGATGGGGGAGGAGG - Intronic
980736636 4:136898967-136898989 ATGGCTATGGAGGGGGAAGGTGG - Intergenic
981225656 4:142290762-142290784 CTGGCCATAGATGGGGGACGTGG + Intronic
982719020 4:158840123-158840145 CAGGTTATGGAGGAGGAAGGAGG + Intronic
983049609 4:163030607-163030629 CAATGTATGGATGGGGGTGGTGG - Intergenic
984944006 4:184957037-184957059 CAGGCCATGGAAGTGGGAGGTGG + Intergenic
985660994 5:1156368-1156390 GAGTCTGGGGATGGGGGAGGTGG - Intergenic
985692092 5:1319193-1319215 CAGGCTCTGCAGGGGGCAGGCGG + Intronic
985731810 5:1553679-1553701 CAGCCCATTGATGGGGGAAGTGG + Intergenic
986709525 5:10478466-10478488 AAGGCTCTGGCTGGGGGTGGGGG + Intergenic
987751689 5:22047527-22047549 TAGGCAATGGATGTGGGGGGGGG - Intronic
989122086 5:38015071-38015093 CAGGATTTGGATGGATGAGGTGG - Intergenic
989157439 5:38357462-38357484 AAGGCTTTGGGTGGGGGAGGGGG + Intronic
991319077 5:65348491-65348513 CAGGCTAGGGATGGGAGAGAAGG + Intronic
991631179 5:68657640-68657662 CAGGATTTGGATGGGAGAGTTGG - Intergenic
992074363 5:73177178-73177200 CAGGCTGAGGATGGAGGAGAGGG - Intergenic
992821663 5:80503952-80503974 CAGGCTATGGATGGAAGACTAGG + Intronic
993287317 5:86016131-86016153 CAGCCAAGGGCTGGGGGAGGAGG + Intergenic
994044906 5:95296539-95296561 AAGGTTAGGGATGGGGGATGAGG - Intergenic
994296000 5:98089330-98089352 CAGCCTCTGGAGGGAGGAGGGGG - Intergenic
994775546 5:104032901-104032923 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
995144618 5:108772775-108772797 TAGGCAATGGAGGGTGGAGGAGG - Intronic
996403301 5:123085696-123085718 TAGGAAATGGATGGGGGTGGGGG - Intergenic
996650355 5:125868466-125868488 CAGGCCATAGTTGGGGGAGTGGG - Intergenic
996904015 5:128576970-128576992 AAGGATGTGTATGGGGGAGGTGG - Intronic
997406189 5:133648780-133648802 GAGGTTATGCATGTGGGAGGTGG - Intergenic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
999394073 5:151215417-151215439 CATGCTGTGGATGGGGAAGAAGG + Intronic
999476512 5:151904482-151904504 CACGCTATGGATGAGGAAGCTGG - Intronic
1000380223 5:160622364-160622386 CCAGCGATGGCTGGGGGAGGAGG - Intronic
1001117425 5:168951418-168951440 CAGCCACTGGGTGGGGGAGGTGG + Intronic
1001197169 5:169684236-169684258 GAGGCTATGGGTGGGGGATGAGG - Exonic
1001494223 5:172176594-172176616 CTGTCTTTTGATGGGGGAGGAGG - Intronic
1001976926 5:176007718-176007740 CACTCTATGGCTGGGGGAGGAGG - Intronic
1001997021 5:176170309-176170331 CAGGCCTTGGATGTGGGAGAAGG - Intergenic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002163887 5:177332850-177332872 CAGGCTGTGGGTGGAGGAGCTGG + Intronic
1002209123 5:177585534-177585556 CAGGCCCTGGAGGGGAGAGGTGG + Intergenic
1002240502 5:177836062-177836084 CACTCTATGGCTGGGGGAGGAGG + Intergenic
1002914548 6:1518507-1518529 CAGACTTTGGCTGGGGGAGATGG + Intergenic
1006131359 6:31871209-31871231 CAGGCTTTGGACAGAGGAGGAGG - Intronic
1006706285 6:36024168-36024190 GAGGAAATGGATGGGGTAGGCGG + Intronic
1006920100 6:37622134-37622156 CAGGTATTGGTTGGGGGAGGAGG - Intergenic
1006929508 6:37679330-37679352 GGGGCTGTGGATGCGGGAGGAGG + Intronic
1006941176 6:37753350-37753372 CAGGCAATTGACTGGGGAGGGGG - Intergenic
1007412980 6:41675402-41675424 CTGGCTCTTGGTGGGGGAGGGGG + Intergenic
1008160183 6:48067735-48067757 CAGTGAATGGAAGGGGGAGGGGG - Intronic
1008916783 6:56796603-56796625 CAGGCAATGGTTGGGAGTGGTGG + Intronic
1010487733 6:76435436-76435458 CAGGCAATGGAGGGGAGAGATGG + Intergenic
1010556189 6:77282155-77282177 CAGGCACAGGATGGGGGAGCAGG + Intergenic
1012526218 6:100181273-100181295 AAGGCTATGCATGTGGGAGGAGG - Intergenic
1013368712 6:109453212-109453234 CAAGTTCTTGATGGGGGAGGGGG + Intronic
1014016280 6:116533974-116533996 CAGACTATGGATAGTGGAGAAGG - Intronic
1015286080 6:131488118-131488140 CAGCTTTTGGATGGGGGATGGGG + Intergenic
1016467997 6:144345888-144345910 CAGGCTTTGGCCGGGGGCGGTGG + Intronic
1016778631 6:147934127-147934149 AAAGATATTGATGGGGGAGGAGG + Intergenic
1017542121 6:155413504-155413526 CAGGGTATGGAGGGTGGGGGAGG + Intronic
1018582011 6:165315768-165315790 TTGGCTAGGGATGGGGGAGATGG + Intergenic
1018719033 6:166558359-166558381 CAGACTTTGGCTGGTGGAGGAGG + Intronic
1018724026 6:166596913-166596935 CAAGCTATGTAGGGGTGAGGGGG + Intronic
1019119168 6:169789869-169789891 GAGGCTATGAGTGGGGGTGGGGG - Intergenic
1019136518 6:169911934-169911956 CAGGCTCAGGATGGGGGTGTAGG - Intergenic
1019738692 7:2662484-2662506 CAGTCTCTGGGTGGGGGAAGGGG - Exonic
1020077582 7:5268571-5268593 CAGGGTATGGCTGGGCGTGGTGG - Intergenic
1020283572 7:6663869-6663891 CAGGCGATGGAGGGGGTCGGCGG + Intergenic
1020622790 7:10537972-10537994 CAGGCTTTGATTTGGGGAGGAGG + Intergenic
1020878629 7:13730077-13730099 GAGGCGAAGGATGGGGGCGGTGG + Intergenic
1021484286 7:21149765-21149787 AAGGCTATGGAGGTGGGAAGAGG - Intergenic
1021992734 7:26152940-26152962 CAGGCTGTGCAGGGGGGCGGCGG + Exonic
1022097237 7:27148525-27148547 CAGGATGTGTATGTGGGAGGAGG - Intronic
1023058322 7:36307254-36307276 CAGGGTTTGGAAGAGGGAGGAGG - Intergenic
1023522813 7:41065841-41065863 CAGGCTGTGGGTGGGGAAGGCGG + Intergenic
1024240677 7:47433040-47433062 CAGGGTGTGGAGGGGTGAGGAGG + Intronic
1028082401 7:86594754-86594776 CAGGCTAGGGGTGGTGGTGGGGG - Intergenic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1028483696 7:91335565-91335587 CAGGCAATGGCTGGAGGAAGAGG - Intergenic
1029440681 7:100585225-100585247 CAGGCTTAGGAAGGAGGAGGAGG + Intronic
1029481731 7:100817435-100817457 CAGGCTAGTGATGGGAGTGGAGG - Intronic
1029544459 7:101202936-101202958 CAGGCTTTGGCTGGGTGCGGTGG - Intergenic
1030830996 7:114221562-114221584 CACCCAATGGCTGGGGGAGGGGG - Intronic
1031004771 7:116458333-116458355 GAGGCTTTGGATTGGGGAGAAGG - Intronic
1032408498 7:131675174-131675196 AAGGCTGTGGATGGAGGAGGAGG + Intergenic
1033432172 7:141299478-141299500 AAGGCTATGGATCTGGAAGGTGG - Intronic
1033648825 7:143324505-143324527 AAGCCGATTGATGGGGGAGGGGG - Intronic
1033654258 7:143362499-143362521 GAGGAGAGGGATGGGGGAGGGGG + Intronic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034029976 7:147750749-147750771 CAGGCTTTGGCTGGGTGCGGCGG + Intronic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034562497 7:151890048-151890070 CAGGCTGTGGTTGGGGGATTTGG + Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1034935698 7:155199119-155199141 CATGCAATAGATGGGGGTGGTGG + Intergenic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1035056263 7:156038821-156038843 AAGGCCATGGAGGGTGGAGGTGG + Intergenic
1035227247 7:157440514-157440536 CAGGCTCTGGCTGGGGAAGACGG - Intergenic
1036307293 8:7611528-7611550 CAGTCCCAGGATGGGGGAGGAGG + Intergenic
1036488126 8:9198549-9198571 CAGTCTCTGGCTGTGGGAGGTGG + Intergenic
1036892814 8:12607431-12607453 CAGTCCCAGGATGGGGGAGGAGG - Intergenic
1037726561 8:21487362-21487384 GAGGCTAGGGATGGGGGTTGTGG - Intergenic
1037765093 8:21767783-21767805 GAGGCTTTGGTTGTGGGAGGGGG + Intronic
1038334672 8:26636562-26636584 CAGACTTTAGTTGGGGGAGGTGG + Intronic
1039059095 8:33559420-33559442 CTAGCTAGGGATGGGGGAGTTGG - Intronic
1039360380 8:36870376-36870398 CAGGGTATGTATGGCAGAGGGGG - Intronic
1039955879 8:42207018-42207040 GAGGCTGTGGATGGGGCAGAGGG - Intronic
1040555621 8:48475189-48475211 CAGGATATGAATGGGGCAGTAGG - Intergenic
1041099524 8:54382050-54382072 CGGGCTAAGGCTGGGGGTGGGGG + Intergenic
1042453408 8:68974446-68974468 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
1044824433 8:96182826-96182848 CATCCTATGGGTGGGGGTGGGGG + Intergenic
1044850835 8:96425853-96425875 CAGGGTAGTGTTGGGGGAGGGGG - Intergenic
1044922093 8:97177907-97177929 GAGGCTTTGGATTGGGGAGAAGG - Intergenic
1046123889 8:109880385-109880407 CAGCATATGTATGGGGGCGGTGG + Intergenic
1047614919 8:126556284-126556306 CCGGCTGTGGACGGGGGAGGAGG - Exonic
1047879190 8:129174036-129174058 CAGGCTATCAATGTGAGAGGTGG - Intergenic
1048000447 8:130375351-130375373 CTGGCTATGGTTAGGGGTGGGGG + Intronic
1048028710 8:130610955-130610977 CAGGCCATAGATGGAGCAGGTGG + Intergenic
1048032881 8:130649647-130649669 CAGCTGCTGGATGGGGGAGGAGG + Intergenic
1048835560 8:138515513-138515535 AAGGCTATGCAAGAGGGAGGGGG + Intergenic
1049501804 8:142971219-142971241 GAGCCTGTGGATGGGGGAGGCGG + Intergenic
1049511382 8:143028430-143028452 GAGGCTGTGGATGGGGGAGGTGG - Intergenic
1049649586 8:143759251-143759273 CAGGCTATGTTTGCGAGAGGAGG - Intergenic
1052892163 9:33711780-33711802 CAGAAAATGGATGGGGGAGTGGG - Intergenic
1053266103 9:36714579-36714601 CAGGCTCAGGGTGGGGGAAGTGG + Intergenic
1053283843 9:36838177-36838199 CAGGTTCTGGGTGGGGGCGGGGG + Exonic
1054725031 9:68641601-68641623 CATGCTATGGCTGGGTGTGGTGG + Intergenic
1054908508 9:70431862-70431884 AAGGGTAAGGGTGGGGGAGGAGG - Intergenic
1056057013 9:82835452-82835474 GAGGTTAGAGATGGGGGAGGAGG + Intergenic
1056739233 9:89238640-89238662 CTGCCTAGGGATGGGGGAGGTGG + Intergenic
1056885042 9:90433733-90433755 CAGGCCCGGGGTGGGGGAGGGGG - Intergenic
1057142226 9:92734588-92734610 CAGCCTGTGGGAGGGGGAGGAGG - Intronic
1057184037 9:93046408-93046430 CAGGCTAGGGGTGGGGTGGGGGG + Intergenic
1057312012 9:93948771-93948793 CCGGCCCGGGATGGGGGAGGGGG - Intergenic
1058418301 9:104810932-104810954 CAGGCAGTGGAGGGGGCAGGGGG + Intronic
1059340507 9:113595028-113595050 CAGGGTCTGGATGGGGGCGAAGG - Intronic
1059606603 9:115842082-115842104 GAGGCTTTGGATTGGGAAGGAGG + Intergenic
1060858924 9:126937950-126937972 CAGGAAGTGAATGGGGGAGGTGG + Intronic
1061220338 9:129246878-129246900 CAGCCGAAGGATGGGGGAGATGG + Intergenic
1061280015 9:129592472-129592494 CAGGGTCTGGATGCGGGAAGGGG + Intergenic
1061377515 9:130235123-130235145 CAGGATGTTGGTGGGGGAGGGGG - Exonic
1061395484 9:130341399-130341421 CAGGCTGTGGCTGGGAGAGCTGG - Intronic
1061415318 9:130444423-130444445 GAGGCTATGGTTGGGGAGGGAGG + Intergenic
1061883686 9:133580227-133580249 CAGGCTGTTGATGGAGAAGGGGG - Exonic
1061998580 9:134204095-134204117 CAGTCTATGGAGGAGGCAGGTGG - Intergenic
1062024256 9:134333036-134333058 CAGGCTCTGGATGAAGTAGGGGG + Intronic
1062182715 9:135199326-135199348 CATGGTCTGGGTGGGGGAGGGGG - Intergenic
1062244635 9:135559168-135559190 CATGCTCTGGATGGGGGTGGTGG - Intergenic
1062245578 9:135564316-135564338 CATGCTCTGGATGGGGGTGGTGG - Exonic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1062332945 9:136052529-136052551 CAGGCAGTGGGTGGGTGAGGCGG + Intronic
1186295369 X:8142976-8142998 AAGGCTATGGCAGGGGTAGGGGG + Intergenic
1186389822 X:9147941-9147963 CGGGCTGTGGCTGGGGGTGGGGG - Intronic
1186506590 X:10098310-10098332 CTGGCTGGGGAGGGGGGAGGGGG - Intronic
1188107047 X:26158798-26158820 AAGGCTATGGTTGGGAGAAGGGG + Intergenic
1190026752 X:46930889-46930911 CAGGGTATGGATGGGGGGCTGGG - Intronic
1192291080 X:69795872-69795894 TATGTTCTGGATGGGGGAGGGGG - Intronic
1192430171 X:71106488-71106510 GAGTCTGTGGATGGGGGTGGAGG - Intronic
1193461974 X:81801770-81801792 CCTGCTATGGATGGTGGTGGTGG - Intergenic
1194115580 X:89892581-89892603 GTGGCTATGGATGGTGCAGGGGG + Intergenic
1195343436 X:103926384-103926406 GAGGATATGGATGGAGCAGGGGG + Intronic
1195760618 X:108242321-108242343 CTGGCAATGGATGGTGGAGACGG - Intronic
1196141259 X:112265799-112265821 AAGGTTATGCATGGAGGAGGAGG - Intergenic
1196251990 X:113471808-113471830 CAGGTTATGGAAGGGAGAGAAGG - Intergenic
1197147414 X:123185112-123185134 CAGGCTGGTGCTGGGGGAGGTGG + Intronic
1198089885 X:133318140-133318162 CAAGCTATGGAGTGGGGAAGGGG - Intronic
1198633804 X:138673281-138673303 CATGCGATGGCTGGAGGAGGTGG + Intronic
1198790714 X:140342577-140342599 GTGCCTATGGGTGGGGGAGGGGG + Intergenic
1199803140 X:151270993-151271015 CACTCAATGGTTGGGGGAGGTGG + Intergenic
1199894605 X:152118086-152118108 CAGGATAGGGGTGGGGGATGTGG + Intergenic
1200141358 X:153904535-153904557 GAGGCTATGGCAGTGGGAGGAGG + Intronic
1201770586 Y:17613894-17613916 CAGGCTAGGGATGAGAGAGATGG - Intergenic
1201830969 Y:18292092-18292114 CAGGCTAGGGATGAGAGAGATGG + Intergenic
1202076433 Y:21041964-21041986 GAGGCTTTGGATTGGGGAGAAGG + Intergenic