ID: 1168409840

View in Genome Browser
Species Human (GRCh38)
Location 19:56132854-56132876
Sequence TCCGGCAGCAGGTTTTCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168409840 Original CRISPR TCCGGCAGCAGGTTTTCCAC CGG (reversed) Intronic
900611903 1:3547810-3547832 TCAGGCAGCAGGACTTCCCCCGG + Intronic
905772305 1:40646228-40646250 TCCGGCAGCAGGTCTAGCTCAGG + Intronic
909420877 1:75463500-75463522 TCGGGCAGCAGATTTTTCAGTGG + Intronic
912601312 1:110935990-110936012 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
915747604 1:158176681-158176703 GCCTGCAGCAGATTTTTCACTGG + Intergenic
916341640 1:163743611-163743633 TCTGCCAGCAGATTTTCCAGTGG - Intergenic
919376842 1:196805822-196805844 TCTGGCAGCAGGTGTTCTAATGG - Intergenic
919386546 1:196930703-196930725 TCTGGCAGCAGGTGTTCTAATGG - Intronic
920801272 1:209189949-209189971 TGGGGAAGCAGGTTTTCCATAGG + Intergenic
921338463 1:214111085-214111107 TCCAGCAGCATGTGTTCCAGGGG - Intergenic
921935891 1:220796691-220796713 TCAGGAAGCTGGTTATCCACTGG - Exonic
922330596 1:224571875-224571897 TGCCCAAGCAGGTTTTCCACAGG + Intronic
924576598 1:245286196-245286218 CCCGGCCACAGGTTATCCACAGG - Intronic
924943939 1:248832285-248832307 TCTGGGAGCAAGTTTTCAACTGG - Intergenic
1068076180 10:52257574-52257596 TAGGGCAGCAGGGTTTCCCCAGG - Intronic
1068367207 10:56067395-56067417 TCTGGCAGCAGGTTTTGTATTGG + Intergenic
1069249344 10:66247638-66247660 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1072282702 10:93882997-93883019 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1072843256 10:98798116-98798138 TCTGGCAGCAGATTTTTCAGTGG + Intronic
1073872600 10:107882080-107882102 TCTGGCAGCAGATTTTTCACTGG + Intergenic
1076557297 10:131335518-131335540 TCCAGCAGCAGATGTGCCACTGG - Intergenic
1080437795 11:32262266-32262288 TCCTGCAGCAGGTTTTTACCTGG + Intergenic
1083941944 11:65900557-65900579 TCCGGCTGCAGCCTTTTCACCGG + Intronic
1084493237 11:69489496-69489518 GCCAGCAGCAGCTTTCCCACAGG + Intergenic
1084756163 11:71240185-71240207 TCCCGCAGCGGGTTTTCAGCAGG - Intronic
1085184061 11:74560372-74560394 TCTTCCAGCAGCTTTTCCACTGG + Intronic
1088586476 11:111364185-111364207 TCCTGCAGCTGCTGTTCCACTGG + Intronic
1090997053 11:131876329-131876351 TCCGGCAGCTTGTTTATCACTGG - Intronic
1091750733 12:3019960-3019982 TCCTGCAGCAGCCTCTCCACCGG + Intronic
1094031216 12:26013104-26013126 ATCAGCAGCATGTTTTCCACAGG + Intronic
1094258772 12:28466507-28466529 TCTGGCAGCAGATTTTTCAGTGG + Intronic
1096393436 12:51247670-51247692 TCAGCCAGCTGGTTTTCCCCAGG - Intronic
1096454051 12:51770596-51770618 TGAGGAAGCAGGTTTTCCGCAGG - Exonic
1099609917 12:84855630-84855652 TCTGGCAGCAGGCTTTTCAATGG - Intergenic
1102614156 12:114138538-114138560 TCAGGCACCAGGTCTTCTACTGG + Intergenic
1103912940 12:124362203-124362225 TCCGGCTGCAGGTTTTGCGGTGG + Exonic
1105743067 13:23349098-23349120 TCCTGCTGCAGGTTTTCCAGTGG - Intronic
1107552012 13:41485880-41485902 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
1107885751 13:44873024-44873046 TACCCAAGCAGGTTTTCCACAGG - Intergenic
1108099439 13:46938136-46938158 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
1109016529 13:57021819-57021841 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1109506913 13:63313540-63313562 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
1109692152 13:65908578-65908600 TCTGTCAGTAGGTTTTCTACTGG + Intergenic
1112435100 13:99386179-99386201 CCTGGCAGCAGGTTCTCCTCAGG + Intronic
1113564562 13:111311801-111311823 TTAGCCAGCAGTTTTTCCACGGG + Intergenic
1113964149 13:114142973-114142995 TCCTGCTGCAGGCTTTCCTCTGG + Intergenic
1118259372 14:64233252-64233274 TCCAGCAGCAGGTCATACACTGG + Exonic
1119096602 14:71838744-71838766 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
1119262231 14:73244688-73244710 TCCGGCTGCAGGGGCTCCACTGG - Exonic
1119320349 14:73726689-73726711 GCTGTCAGCAGGTCTTCCACTGG + Exonic
1120275972 14:82372484-82372506 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1120697630 14:87661428-87661450 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1121266123 14:92603767-92603789 TCTGGCAGCACCTTTTCCTCAGG + Intronic
1123466053 15:20516827-20516849 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123760844 15:23431414-23431436 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124276777 15:28332803-28332825 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1126053029 15:44704899-44704921 TCTGGCAGCAGACTTTCCAGTGG - Intronic
1126184025 15:45813123-45813145 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1133431224 16:5738699-5738721 TCTGACTGCAGGTTTTCCACTGG + Intergenic
1136032982 16:27516946-27516968 TCCAGCACAAGGTTTTCCAAAGG - Intronic
1140646434 16:77036721-77036743 TCTGGCAGCAGACATTCCACTGG - Intergenic
1143303778 17:5930048-5930070 TGCCCCAGCAGGTTTTCCCCGGG - Intronic
1147638288 17:41977488-41977510 TCAGGTAGCATGTTTTGCACGGG - Exonic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152233852 17:79128371-79128393 CCCAGAAGCAGGTTTTCCCCAGG + Intronic
1152586682 17:81192464-81192486 GCCGGCACCAGGTCTACCACCGG - Exonic
1153075120 18:1154343-1154365 TCTGGCAGCAGGTTTTTCAGTGG - Intergenic
1155282340 18:24252365-24252387 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1158461335 18:57648644-57648666 GACGGCAGCAGGTGTTCCGCCGG - Exonic
1160667141 19:336205-336227 TCCAGCAGCAGGTTTTGGGCCGG - Intronic
1161321919 19:3645335-3645357 TCTGGCAGCAGGTTGGCCACGGG + Intronic
1164582400 19:29442618-29442640 TCCAGCAGCTGGTTGCCCACAGG - Intergenic
1166495807 19:43302435-43302457 CCCGGCAGCAACTTGTCCACAGG - Intergenic
1167114515 19:47480781-47480803 TCTGGGAAGAGGTTTTCCACGGG + Exonic
1168409840 19:56132854-56132876 TCCGGCAGCAGGTTTTCCACCGG - Intronic
925783775 2:7408350-7408372 TCTGGCAGCATGTTTTCCATAGG + Intergenic
928609721 2:32980925-32980947 TCTGGCAGCAGGCTTTTCACTGG - Intronic
928831473 2:35490746-35490768 TAAGACAGCAGGTTTTCCACTGG + Intergenic
928851828 2:35757765-35757787 TCTGGCAGCAGGCTTTTCAGTGG - Intergenic
929575223 2:43047427-43047449 GCTGGCAGCAAGGTTTCCACAGG + Intergenic
931406672 2:61986225-61986247 TCTGGCAGCAGGCTTTTCAGTGG - Intronic
932436493 2:71705106-71705128 TCTGGAAACAGGTCTTCCACAGG + Intergenic
935609074 2:105001723-105001745 TCCTTCAGCAGGCTTGCCACTGG - Intergenic
939725500 2:145715883-145715905 TCTGGCAGCAGACTTTCCATTGG + Intergenic
942693748 2:178615312-178615334 TTCTGCAACAGGTTCTCCACAGG + Exonic
943485283 2:188472116-188472138 TCTGGCAGCAGAATTTCCAGTGG - Intronic
943923489 2:193740162-193740184 TCTGGCAGCAGATTTTCCAGTGG + Intergenic
944607393 2:201364162-201364184 TCTGTCAGCAGGTTTTATACTGG - Intergenic
947312149 2:228816544-228816566 TCTGGCAGCAGGTTTTTGAGTGG - Intergenic
948475303 2:238214702-238214724 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
1168917032 20:1498413-1498435 TCTGGCAGCAGATTTTTCAGGGG - Intergenic
1169080909 20:2797290-2797312 TCCGGCAGGAGGTTCAGCACTGG + Exonic
1170430954 20:16276076-16276098 TCCGGCTTCAGGTCTCCCACAGG + Intronic
1170589316 20:17759371-17759393 GCCGACGGCAGGTTTTCTACTGG + Intergenic
1176373059 21:6074050-6074072 TCAGCCAGCTGGTTCTCCACCGG - Intergenic
1177970254 21:27779801-27779823 TTTGGCAGCAGGCTTTTCACTGG + Intergenic
1179168549 21:38954730-38954752 ACCAGCAGCAGCTTATCCACTGG + Intergenic
1179439059 21:41380546-41380568 TCCTGCAGCAGCATTTCCAAAGG - Intronic
1179750418 21:43464193-43464215 TCAGCCAGCTGGTTCTCCACCGG + Intergenic
1179887812 21:44321939-44321961 TCCAGCAGCCGGCCTTCCACAGG - Intronic
1183732162 22:39624570-39624592 TCCAGCAGCTGGTGTTCCCCTGG + Intronic
1184108219 22:42380989-42381011 TCTGGCAGCAGAGTTTCCATGGG - Exonic
1184826015 22:46951747-46951769 TCCGGCAGCACAAATTCCACTGG - Intronic
950098535 3:10343912-10343934 TCCTGGAGGAGGTGTTCCACAGG - Intronic
951102500 3:18705080-18705102 TCTGGCAACAGGTTTTTCAGTGG + Intergenic
952996039 3:38883298-38883320 TTTGGTAGCAGGTTTTCCGCAGG + Exonic
954472317 3:50708219-50708241 TCCAGCAGCAGGATTCCCAAGGG - Intronic
955187863 3:56732306-56732328 TCCAGCAGGAGGTCTTTCACGGG + Exonic
957268017 3:77992559-77992581 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
957672404 3:83322751-83322773 TCCGGAAGCAGACTTTTCACTGG - Intergenic
958154231 3:89732120-89732142 TCCGGCAGCAGCCTTCCCAAAGG + Intergenic
958156325 3:89760956-89760978 TCTGTCAGCAGGTTTTACATTGG + Intergenic
960214291 3:115011448-115011470 TCTGGCAGCAGACTTTTCACTGG + Intronic
964253890 3:154751883-154751905 TCTGGCAGCAGGCTTTTCAGTGG + Intergenic
965527060 3:169732091-169732113 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
966348761 3:179006644-179006666 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
967939063 3:194752578-194752600 TCCTTCAGCAGGTATTCCAGAGG - Intergenic
972856727 4:43115820-43115842 TCCGGCAGCAGACTTTTCAGTGG + Intergenic
975369289 4:73566508-73566530 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
975629954 4:76389753-76389775 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
977396840 4:96481875-96481897 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
977396875 4:96482613-96482635 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
977654600 4:99506150-99506172 TCCATCAGCAGATTTTCCAGTGG - Intergenic
977764023 4:100776656-100776678 TCTGCCAGCAGGTTTTACACTGG + Intronic
978212490 4:106155206-106155228 TCCGGCAGCAGACTTTTCAGTGG - Intronic
981045790 4:140263820-140263842 TCCAGCAACACGGTTTCCACAGG - Intronic
981870885 4:149485058-149485080 TCTGGCAGCAGACTTTTCACTGG - Intergenic
981987541 4:150875585-150875607 TCCGTCAGCAGGTTTTATATTGG - Intronic
983389112 4:167104882-167104904 TCTGGCAGCAGACTTTTCACTGG + Intronic
987125895 5:14812417-14812439 TCTGGAAGCAGGTTTTGCATGGG + Intronic
991205435 5:64044068-64044090 TCTGGCAGCAGATTTTTCACTGG + Intergenic
994101544 5:95898679-95898701 GCCTGCAGCAGATTTTTCACTGG + Exonic
997281820 5:132653793-132653815 TCCTGCAGCAGGGTTTTCTCCGG + Intergenic
1004427508 6:15516465-15516487 TCAGGCAGCAGGGTGTCCACTGG + Intronic
1006018310 6:31100937-31100959 TCTGGCAGCAGATTTTTCAGTGG - Intergenic
1007990662 6:46251936-46251958 TCAGGCACCAGGTTTTTCACTGG + Intronic
1009301848 6:62033505-62033527 TCCGGCAGCAGACTTTTCAGTGG + Intronic
1010491181 6:76477724-76477746 TCTGTCAGCAGGTTTTACATTGG - Intergenic
1011322654 6:86114291-86114313 TCCGGCAGCAGACTTTTCAGTGG - Intergenic
1012512416 6:100018428-100018450 TCTGGCAGCAGGCTTTTCAGTGG + Intergenic
1014322019 6:119942206-119942228 TCTGTCAGCAGGTTTTATACTGG + Intergenic
1014542229 6:122691033-122691055 TCTGGCAGCAGGGTTTTCAGTGG - Intronic
1015323256 6:131899558-131899580 CCAGGCAGCAGACTTTCCACAGG - Intergenic
1021130814 7:16911544-16911566 TCTGGCAGCAGATTTTTCAATGG - Intergenic
1024453683 7:49579405-49579427 GACGGCAGCACGTTTCCCACGGG + Intergenic
1025028219 7:55535402-55535424 TGAGGCAGCAGGGTTTCCAGGGG - Intronic
1030347388 7:108449857-108449879 TCCTGTAGGAGGTCTTCCACTGG - Intronic
1030390692 7:108924430-108924452 TCTGGCTGCAGGTTTTTCAATGG - Intergenic
1035551001 8:525109-525131 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1040425766 8:47284580-47284602 TCCTGCAGCAGGACATCCACAGG + Intronic
1040902042 8:52427509-52427531 GCCTGCCGCAGGTTTTCCCCTGG - Intronic
1044308442 8:90665437-90665459 TCTGTCAGCAGGTTTTTTACTGG + Intronic
1045041094 8:98225544-98225566 TCTGGCAGCAGATTTTTCAGAGG - Intronic
1047933820 8:129755259-129755281 TCTGGCAGCAGACTTTTCACTGG + Intronic
1047937143 8:129793422-129793444 TCTGGCAGCAGACTTTTCACTGG - Intergenic
1049194250 8:141307170-141307192 TCCAGCAGCGGCTTTTCCAGCGG - Intronic
1050102941 9:2137311-2137333 TCCTGCATCAGGTTCTCCAGTGG + Intronic
1050327032 9:4507824-4507846 TCCTGCAGCAGGTTTTAGTCAGG - Intronic
1053204860 9:36177420-36177442 TCTGGCAGCAGATTTTTCAGTGG + Intergenic
1056828189 9:89891259-89891281 TCCAGGACCAGGATTTCCACTGG + Intergenic
1058285036 9:103167303-103167325 TCTGGCAGCAGGCTTCTCACTGG - Intergenic
1059555265 9:115274527-115274549 TCTGGCAGCAGATTTTTCAGTGG - Intronic
1061868415 9:133507220-133507242 TCCCCCAGCTGGTTTTCCAGTGG - Intergenic
1062528485 9:136988565-136988587 ACTGGCAGCAGCTTTTCCACTGG - Intergenic
1187143825 X:16619591-16619613 TCAGGCACCAGGTTGTCCAGAGG - Intronic
1189868614 X:45358852-45358874 TCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1191813397 X:65216612-65216634 TACTGCAGCAGGTGTTGCACTGG - Intergenic
1192875053 X:75221162-75221184 TCTGGCAGCAGGTTTTCCAGTGG - Intergenic
1193438882 X:81514362-81514384 TCTGGCAGTAGATTTTTCACTGG + Intergenic
1193711653 X:84887386-84887408 TGAGGCAGCTGGTTTTCCAAAGG + Intergenic
1193981801 X:88189637-88189659 TCTGGCAGCAGACTTTCCAGTGG + Intergenic
1194016787 X:88631501-88631523 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1194033334 X:88842089-88842111 TCCGGCAGCAGACTTTTCAGTGG + Intergenic
1196495327 X:116317937-116317959 TAAGGCAGCAGGTTTTCTTCTGG - Intergenic