ID: 1168411768

View in Genome Browser
Species Human (GRCh38)
Location 19:56144708-56144730
Sequence CCCCTTGACCACAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168411768 Original CRISPR CCCCTTGACCACAAGGCAGA GGG (reversed) Intronic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
901927298 1:12574490-12574512 CCTCTTGACCACAGGGCTGTGGG - Intronic
902816397 1:18918943-18918965 CCCCTTGGACACAAGTGAGAGGG + Intronic
904323833 1:29714275-29714297 CCCTTAGAGCACAAGACAGATGG - Intergenic
905240379 1:36577140-36577162 CCCCCAGATCACAAGGGAGAGGG + Intergenic
906240986 1:44242206-44242228 GCCCTTCCCCACAAGGCAGCTGG + Intronic
906896521 1:49779160-49779182 CTCCTTGACCACCAGGAATAAGG - Intronic
907125560 1:52047319-52047341 CCTCTTTACCAGAAGACAGAAGG - Intronic
907786857 1:57620953-57620975 CTCTTTGAACCCAAGGCAGAAGG - Intronic
910919654 1:92330006-92330028 CCCCTAGACCTCAAGGAAAAAGG + Intronic
911229185 1:95342284-95342306 CCCCTTATTCACAAGGCAGCAGG + Intergenic
911472676 1:98337520-98337542 CACCTTCTCCACAAGGCAGCAGG + Intergenic
915917846 1:159951811-159951833 TCCCTTGGCCAGGAGGCAGAAGG + Exonic
916739472 1:167635771-167635793 TCCCTTTACCATATGGCAGAGGG - Intronic
917739891 1:177952046-177952068 CCCATTGCCCACAAGGCTCAGGG + Intronic
921654086 1:217713548-217713570 CCCCTTCACTCAAAGGCAGATGG - Intronic
923103712 1:230838062-230838084 CCCCATGCCCTCCAGGCAGAAGG + Exonic
923256812 1:232229452-232229474 CACCTTCTTCACAAGGCAGAAGG - Intergenic
1063045425 10:2387385-2387407 CTCCTTGGCTACAAGGAAGATGG - Intergenic
1063320692 10:5050103-5050125 CACCTGGACCACAAGGTTGATGG - Intronic
1063847978 10:10152558-10152580 CACCTTGGCCACAAAGCAGCTGG + Intergenic
1064007341 10:11709176-11709198 TGCCTGGACCACAAGGGAGAAGG + Intergenic
1069657230 10:70098979-70099001 GCCCTTGACCTGAATGCAGAGGG + Intronic
1070509754 10:77149863-77149885 CCACATGACCACTAAGCAGATGG - Intronic
1070738705 10:78886701-78886723 CCTGTTGCCTACAAGGCAGATGG + Intergenic
1071947726 10:90666417-90666439 CACCTTGTTCACAAGGCAGCAGG + Intergenic
1075778951 10:125004825-125004847 GCCTTTGAGCACAAGGCAGCAGG + Intronic
1077217158 11:1399711-1399733 CCCCATGTCCACCCGGCAGAAGG - Intronic
1079445738 11:20554871-20554893 CCTCTTCACCAGACGGCAGAAGG + Intergenic
1080246612 11:30186204-30186226 ACCCCTTACCACATGGCAGAAGG + Intergenic
1081285873 11:41269539-41269561 GCCCTGGACCACCAGGGAGAAGG + Intronic
1081705843 11:45181447-45181469 CCCCTAGACCAAAGGGCAAAGGG - Intronic
1082225623 11:49703272-49703294 CCAGTTCACCACAAGGCAGTAGG - Intergenic
1083617393 11:64033112-64033134 CCTCGTGACCCCAAGACAGAGGG - Intronic
1083668930 11:64289796-64289818 TCCCTTGACCAGGAGACAGAAGG - Intergenic
1084692484 11:70735155-70735177 TCCCTTGAACACAGGGCAGTGGG - Intronic
1085987002 11:81799907-81799929 CACCTTCTTCACAAGGCAGAAGG - Intergenic
1087504615 11:99003615-99003637 CACCTTGTTCACAAGGCAGCAGG - Intergenic
1090487498 11:127127121-127127143 CCCCTAGGCCACAAGGAACAAGG - Intergenic
1091315931 11:134614072-134614094 CCTCCTTACCACAAGGCAGATGG - Intergenic
1091671327 12:2454163-2454185 GCCCTTGTCCTCAAGGCACAAGG - Intronic
1094700838 12:32869209-32869231 ACCCAAGATCACAAGGCAGAGGG + Intronic
1095363092 12:41367855-41367877 CGCCATGTCCAAAAGGCAGAAGG + Intronic
1101013171 12:100472224-100472246 CCCCTTCGGCACAAGGAAGAGGG - Intergenic
1101535558 12:105613160-105613182 CACCTTTATCACAAGGCAGCAGG - Intergenic
1102765553 12:115429987-115430009 CCCCATGACAACAAGGGATATGG + Intergenic
1103746324 12:123126981-123127003 CCCCTAGACCACCATGCTGAGGG - Intronic
1106099720 13:26683759-26683781 CCCCCTGACCACAAAACACATGG + Intronic
1106148936 13:27079341-27079363 TCTCTTGACCACAAGGTAGCTGG + Intronic
1107559639 13:41547582-41547604 GCCCTTGACCACAGTGCACAGGG - Intergenic
1107828627 13:44353702-44353724 CCCCGTGCCCACTAGCCAGAAGG - Intergenic
1109500913 13:63235370-63235392 CCCCTAGACCACAAGGAGGATGG - Intergenic
1110665908 13:78116998-78117020 CCCCTTCTTCACAAGGCAGCAGG + Intergenic
1110679278 13:78289245-78289267 CACCTTCTTCACAAGGCAGAGGG - Intergenic
1111062938 13:83046765-83046787 ACCCTGAACCAGAAGGCAGAGGG + Intergenic
1112756962 13:102646691-102646713 CACCATCACCAGAAGGCAGATGG - Intronic
1114852238 14:26395086-26395108 CACCTGGACCACAAGGAAGAAGG + Intergenic
1115040835 14:28924711-28924733 CCCCTCTTCCACAAGGCATATGG - Intergenic
1116386066 14:44331551-44331573 CACCTTCAACACAAGGCAGCAGG + Intergenic
1117162300 14:53001539-53001561 CCCCTACCCCACAAGGCAGGAGG - Intergenic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1119569328 14:75656232-75656254 CCCCTAGATCACAAGGGAGATGG + Intronic
1119661764 14:76457165-76457187 CTCCGTGACCTTAAGGCAGAGGG - Intronic
1121177386 14:91900982-91901004 CCCCTTGAGCCCCAGGCATATGG + Intronic
1121791724 14:96704272-96704294 CCCCATGACCTCAAGGCAGATGG + Intergenic
1122550233 14:102545302-102545324 CCCCTTCCCCACAAGGCCGGGGG - Intergenic
1125069847 15:35540937-35540959 CCCCCTGGCCACAAGGGATAAGG + Intronic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1130775199 15:86971950-86971972 CCCCTTCTTCACAAGGCAGCAGG - Intronic
1135757722 16:25111880-25111902 GCCCATGGCCACTAGGCAGAGGG + Exonic
1137296212 16:47096782-47096804 CCCCATGAGATCAAGGCAGAAGG + Intronic
1139307708 16:66001532-66001554 CCCCTTGAGAACAAGGAACAAGG + Intergenic
1141805046 16:86336699-86336721 CCCCTTGATCCCTACGCAGAGGG + Intergenic
1141986383 16:87582952-87582974 CCCCTGAGCCACACGGCAGAGGG - Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1143564259 17:7712039-7712061 CCCCTTGACCTCCAGACAGATGG - Intergenic
1144495194 17:15741409-15741431 CCCCCTCACCTCAAGTCAGACGG + Intronic
1144735719 17:17554238-17554260 CCCCTCAGCCACAAGGCAGTGGG + Intronic
1146909848 17:36641632-36641654 CTCCTGGAACACAAGGCAGTGGG - Intergenic
1147357875 17:39911753-39911775 TGGCTTGCCCACAAGGCAGAGGG + Intronic
1149186886 17:54008609-54008631 CTCCTTGACCACAAGAAAGATGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150577949 17:66446559-66446581 GCCCTTGACCACAATCTAGATGG - Intronic
1152123544 17:78433156-78433178 CCCCTCGCCCAGAAGGCAGAGGG - Intronic
1153707488 18:7760938-7760960 ACCCTGGACCAAGAGGCAGATGG - Intronic
1154014617 18:10605232-10605254 CCCTGTGCTCACAAGGCAGAGGG - Intergenic
1155710028 18:28865355-28865377 CACCTTTATCACAAGGCAGCAGG + Intergenic
1156473730 18:37393204-37393226 CCCCTTGACCAGGAGGTAGCAGG - Intronic
1157337847 18:46754762-46754784 CCCCCTGTTGACAAGGCAGAAGG + Intronic
1158468846 18:57716249-57716271 CACCTTCACTAAAAGGCAGAAGG + Intronic
1158707631 18:59807507-59807529 TCCATTGACCACAATGTAGAAGG + Intergenic
1161101029 19:2422033-2422055 CCCCTCGACCACAAGGATGCTGG + Exonic
1162149339 19:8633733-8633755 TCCCTTGACCAGGAGGCAGGGGG - Intergenic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1165774159 19:38395199-38395221 CCCCTGGATCTCAAGGTAGAGGG + Intronic
1166030664 19:40124268-40124290 CCCCTGGAACACAGAGCAGAAGG + Intergenic
1166315314 19:41986034-41986056 CCCAGTGACCCCCAGGCAGAGGG - Intronic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG + Intergenic
926596689 2:14797485-14797507 CCCATTCACCACACTGCAGATGG + Intergenic
926883719 2:17577661-17577683 CCCCTGGTCCCCAGGGCAGATGG - Intronic
928687840 2:33767790-33767812 CCACTAGACCACATGGAAGAGGG - Intergenic
929012292 2:37456944-37456966 CCCCTTGAAAACGGGGCAGACGG - Intergenic
929720335 2:44361601-44361623 CTCCTTGACCACAACAAAGATGG - Intronic
930118700 2:47742080-47742102 ACCCCTGATCCCAAGGCAGAGGG - Intronic
931152037 2:59585165-59585187 CCCATTTACCCCAAGTCAGAGGG - Intergenic
931762535 2:65431043-65431065 CCCCTGGACCGCGAGGCAGGAGG + Intronic
935120521 2:100180000-100180022 CCCTCTAACCAGAAGGCAGAGGG - Intergenic
939764664 2:146231763-146231785 TTCCTTGACAACAAGGAAGAAGG + Intergenic
939830934 2:147069857-147069879 CCTCTTCACCATGAGGCAGATGG - Intergenic
943331403 2:186563762-186563784 CACCTTCACCAAAAGGAAGATGG + Intergenic
947924555 2:233909830-233909852 CCCCTAGATCAGAAGGAAGATGG + Intergenic
948757333 2:240167315-240167337 TCCCCTGACCCCAAGGCAGGTGG + Intergenic
948811453 2:240480540-240480562 CCTCTGGACCACAGGGCAGTTGG - Intronic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1173478664 20:43382264-43382286 CTCCTTGAACACAAGGCAGCAGG + Intergenic
1176089096 20:63311163-63311185 TCCCATGACCTCAAGGCAGATGG + Intronic
1178665414 21:34542347-34542369 CCCCGAGAGAACAAGGCAGAAGG - Intronic
1179608618 21:42534338-42534360 CCACCTGTCCACAAGGAAGAAGG - Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1183100098 22:35578638-35578660 CCCCTTGAACTGAAGCCAGAGGG + Intergenic
951350953 3:21606250-21606272 CCCATTGTCCTGAAGGCAGAAGG - Intronic
951902839 3:27673929-27673951 CACCTTCTCCACAAGGCAGCAGG - Intergenic
954127248 3:48538841-48538863 CCCCTGTACCACAAGGATGAGGG - Intronic
954695151 3:52420379-52420401 TTTCTTGGCCACAAGGCAGATGG - Exonic
954852246 3:53613268-53613290 CCTTTTGACCACAAAGAAGATGG + Intronic
954896386 3:53978729-53978751 CACCTTGTTCACAAGGCAGCAGG - Intergenic
959647719 3:108722444-108722466 CCCCTTCTTCACAAGGCAGCAGG + Intergenic
960463322 3:117964160-117964182 CACCTTCTTCACAAGGCAGAAGG - Intergenic
961029881 3:123592374-123592396 CACCTTCTCCACAAGGCAGCAGG + Intergenic
961124389 3:124403173-124403195 CACTCTGACCACATGGCAGATGG - Intronic
961658738 3:128457262-128457284 CCCCATGACAACGGGGCAGATGG + Intergenic
962342939 3:134600612-134600634 CCCCCAGGCCACAGGGCAGAAGG - Intronic
963141465 3:141949401-141949423 CACCTTGATCATAAGGCACAAGG + Intergenic
969386451 4:6852830-6852852 ACCTTTCACCACATGGCAGATGG + Intronic
970515960 4:16830357-16830379 CACCTTCTTCACAAGGCAGAAGG - Intronic
971698730 4:29939299-29939321 CCCCCTAACCTCAAGGCAAATGG + Intergenic
971739719 4:30503870-30503892 CACTTTGGACACAAGGCAGAAGG + Intergenic
972894550 4:43603157-43603179 CACCTTCTTCACAAGGCAGAAGG - Intergenic
975848048 4:78546203-78546225 CCCCAGAATCACAAGGCAGAAGG - Intergenic
976069969 4:81230333-81230355 CACCTTCTCCACAAGGCAGCGGG - Intergenic
977823520 4:101503297-101503319 CACCTTTATCACAAGGCAGCAGG + Intronic
984214211 4:176888031-176888053 CCCCTTCTTCACAAGGCAGTGGG - Intergenic
985661714 5:1160561-1160583 CCCCATGATCTCGAGGCAGAGGG - Intergenic
985937140 5:3106184-3106206 CCCCTCCACCACATGGCAGGGGG - Intergenic
987218654 5:15766494-15766516 CTTCATCACCACAAGGCAGAGGG + Intronic
990575250 5:57117658-57117680 CCCCTTGACCTCAAAGAAGGTGG - Intergenic
991925415 5:71700729-71700751 CACCTTGTTCACAAGGCAGCAGG + Intergenic
992885309 5:81152869-81152891 CCCCCTGACAACAAAGCTGATGG - Intronic
994253780 5:97569300-97569322 CACCTTCTTCACAAGGCAGAAGG + Intergenic
995353905 5:111215107-111215129 CACCTTCTTCACAAGGCAGAAGG - Intergenic
998416621 5:141950889-141950911 CCCCATTACCACAAGGGAAATGG + Intronic
999621513 5:153479559-153479581 CTCCTTGACCACTATACAGATGG - Intergenic
999742461 5:154566597-154566619 TCCCTTGACCACAAGACCCAAGG + Intergenic
1000455439 5:161442892-161442914 CCCCTTTACCACAGAGCAGTGGG + Intronic
1002313382 5:178328138-178328160 ACCCTTGGCCAAAGGGCAGAGGG - Intronic
1002647807 5:180669817-180669839 TGCCCTGACCACAGGGCAGATGG - Intergenic
1003259644 6:4505807-4505829 CACCTTTATCACAAGGCAGCAGG + Intergenic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1010821572 6:80421225-80421247 CCCCTTTTTCACAAGGCAGAAGG - Intergenic
1013333478 6:109130491-109130513 CACCATAACCAAAAGGCAGAAGG - Intronic
1017549933 6:155495318-155495340 CCCCATGACCACAAGGGAGCAGG - Intergenic
1018444113 6:163839598-163839620 GGCCTTGACCAGAAGGCAAATGG + Intergenic
1019685484 7:2379697-2379719 CCCTCTGACCACATTGCAGATGG + Intronic
1022227973 7:28382988-28383010 AGCCTTGAAAACAAGGCAGAGGG + Intronic
1022509891 7:30928376-30928398 CCACTTGACCACAAGGACCACGG + Intergenic
1023237017 7:38100109-38100131 CACCTTTCTCACAAGGCAGAGGG - Intergenic
1023753059 7:43390167-43390189 CACCTTGAAGACAAGGCACAGGG - Intronic
1024661537 7:51500068-51500090 ACCAGTGACCACAAGCCAGAGGG - Intergenic
1027466663 7:78523631-78523653 CCCCTTCTTCACAAGGCAGCAGG + Intronic
1028295448 7:89124103-89124125 CAGCTTGACCAGAAGCCAGAGGG - Intronic
1031317578 7:120275121-120275143 CACCATGACTGCAAGGCAGAGGG + Exonic
1032263116 7:130352189-130352211 CCCTCTGATCACAGGGCAGAGGG - Intronic
1039395980 8:37225440-37225462 CCCCTTCACCAAAAGCCAGCAGG + Intergenic
1039489944 8:37939977-37939999 CCCCTCGCCCACAAGCTAGAGGG - Exonic
1039796458 8:40919507-40919529 CCCCCTGACCTCATGGGAGAAGG - Intergenic
1042086573 8:65115592-65115614 CACCTTGTTCACAAGGCAGCAGG + Intergenic
1043076718 8:75710495-75710517 CCATTTCACTACAAGGCAGATGG + Intergenic
1045072273 8:98520565-98520587 CCCATTTTCCTCAAGGCAGAAGG + Intronic
1047875979 8:129138030-129138052 CACCTTCTCCACAAGGCAGCAGG - Intergenic
1051430162 9:16973420-16973442 CTCCTTGATCACAAGGAAGATGG - Intergenic
1052736910 9:32352097-32352119 CCACTGCAACACAAGGCAGAGGG + Intergenic
1054345146 9:63906636-63906658 CACCTTGTTCACAAGGCAGCAGG - Intergenic
1055731845 9:79286685-79286707 ACCTTGGACCAGAAGGCAGAGGG + Intergenic
1057097837 9:92328076-92328098 CCCCTTGACCAAGAGGGAGTCGG + Intronic
1060095603 9:120786369-120786391 CACCTTGTTCACAAGGCAGCAGG - Intronic
1060809045 9:126599244-126599266 CACCTTCACCACAAGGCGGCAGG + Intergenic
1060876111 9:127084643-127084665 CCCCACTACCACAAGGAAGAGGG - Intronic
1062273201 9:135719116-135719138 CCCCTGGACTCCCAGGCAGAGGG - Intronic
1187343900 X:18445710-18445732 CACCTTCTCCACAAGGCAGCAGG - Intronic
1189997031 X:46648794-46648816 CAACCTGACCACAAGGTAGAAGG + Exonic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1195777492 X:108423939-108423961 GACCTTAACCTCAAGGCAGAGGG - Intronic
1195885814 X:109636309-109636331 CACCTTCTCCACAAGGCAGTAGG - Intronic
1196390777 X:115205097-115205119 CACCTTCTTCACAAGGCAGAGGG + Intronic
1198198490 X:134389517-134389539 CCCCTCTACCACAAGGCACCTGG - Intronic
1198772915 X:140149968-140149990 CCCCTGGGCCACAATGCAGAGGG + Intergenic
1199112694 X:143954255-143954277 CACCTTGTTCACAAGGCAGCAGG - Intergenic
1199391175 X:147281052-147281074 ATCCTTGACCACAAGGAAAACGG - Intergenic
1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG + Intergenic
1199961879 X:152786651-152786673 CCGCTGGACCAGAAGGCAGATGG - Intergenic