ID: 1168414978

View in Genome Browser
Species Human (GRCh38)
Location 19:56161918-56161940
Sequence GAGGTGGGTGCTGAGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168414978_1168414986 15 Left 1168414978 19:56161918-56161940 CCACAGGCCTCAGCACCCACCTC No data
Right 1168414986 19:56161956-56161978 TAGTAATGCCCCTCCTGAAAAGG No data
1168414978_1168414982 -8 Left 1168414978 19:56161918-56161940 CCACAGGCCTCAGCACCCACCTC No data
Right 1168414982 19:56161933-56161955 CCCACCTCCTAAGACAGGACTGG No data
1168414978_1168414987 16 Left 1168414978 19:56161918-56161940 CCACAGGCCTCAGCACCCACCTC No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168414978 Original CRISPR GAGGTGGGTGCTGAGGCCTG TGG (reversed) Intergenic
No off target data available for this crispr