ID: 1168414984

View in Genome Browser
Species Human (GRCh38)
Location 19:56161937-56161959
Sequence ACTACCAGTCCTGTCTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168414984_1168414986 -4 Left 1168414984 19:56161937-56161959 CCTCCTAAGACAGGACTGGTAGT No data
Right 1168414986 19:56161956-56161978 TAGTAATGCCCCTCCTGAAAAGG No data
1168414984_1168414994 26 Left 1168414984 19:56161937-56161959 CCTCCTAAGACAGGACTGGTAGT No data
Right 1168414994 19:56161986-56162008 TTTGAAAATTAAATAAGGCTGGG No data
1168414984_1168414992 21 Left 1168414984 19:56161937-56161959 CCTCCTAAGACAGGACTGGTAGT No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data
1168414984_1168414993 25 Left 1168414984 19:56161937-56161959 CCTCCTAAGACAGGACTGGTAGT No data
Right 1168414993 19:56161985-56162007 TTTTGAAAATTAAATAAGGCTGG No data
1168414984_1168414987 -3 Left 1168414984 19:56161937-56161959 CCTCCTAAGACAGGACTGGTAGT No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168414984 Original CRISPR ACTACCAGTCCTGTCTTAGG AGG (reversed) Intergenic
No off target data available for this crispr