ID: 1168414987

View in Genome Browser
Species Human (GRCh38)
Location 19:56161957-56161979
Sequence AGTAATGCCCCTCCTGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168414978_1168414987 16 Left 1168414978 19:56161918-56161940 CCACAGGCCTCAGCACCCACCTC No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data
1168414984_1168414987 -3 Left 1168414984 19:56161937-56161959 CCTCCTAAGACAGGACTGGTAGT No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data
1168414979_1168414987 9 Left 1168414979 19:56161925-56161947 CCTCAGCACCCACCTCCTAAGAC No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data
1168414983_1168414987 0 Left 1168414983 19:56161934-56161956 CCACCTCCTAAGACAGGACTGGT No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data
1168414981_1168414987 1 Left 1168414981 19:56161933-56161955 CCCACCTCCTAAGACAGGACTGG No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data
1168414985_1168414987 -6 Left 1168414985 19:56161940-56161962 CCTAAGACAGGACTGGTAGTAAT No data
Right 1168414987 19:56161957-56161979 AGTAATGCCCCTCCTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168414987 Original CRISPR AGTAATGCCCCTCCTGAAAA GGG Intergenic
No off target data available for this crispr