ID: 1168414992

View in Genome Browser
Species Human (GRCh38)
Location 19:56161981-56162003
Sequence CTGTTTTTGAAAATTAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168414988_1168414992 -6 Left 1168414988 19:56161964-56161986 CCCCTCCTGAAAAGGGACTGTTT No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data
1168414989_1168414992 -7 Left 1168414989 19:56161965-56161987 CCCTCCTGAAAAGGGACTGTTTT No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data
1168414990_1168414992 -8 Left 1168414990 19:56161966-56161988 CCTCCTGAAAAGGGACTGTTTTT No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data
1168414983_1168414992 24 Left 1168414983 19:56161934-56161956 CCACCTCCTAAGACAGGACTGGT No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data
1168414984_1168414992 21 Left 1168414984 19:56161937-56161959 CCTCCTAAGACAGGACTGGTAGT No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data
1168414981_1168414992 25 Left 1168414981 19:56161933-56161955 CCCACCTCCTAAGACAGGACTGG No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data
1168414985_1168414992 18 Left 1168414985 19:56161940-56161962 CCTAAGACAGGACTGGTAGTAAT No data
Right 1168414992 19:56161981-56162003 CTGTTTTTGAAAATTAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168414992 Original CRISPR CTGTTTTTGAAAATTAAATA AGG Intergenic
No off target data available for this crispr