ID: 1168415221

View in Genome Browser
Species Human (GRCh38)
Location 19:56163455-56163477
Sequence CTGTTCCTCATGGTGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168415214_1168415221 27 Left 1168415214 19:56163405-56163427 CCAGCCAGACAGACTGGCACAGG No data
Right 1168415221 19:56163455-56163477 CTGTTCCTCATGGTGCTGCTTGG No data
1168415218_1168415221 -1 Left 1168415218 19:56163433-56163455 CCGCAGAAGGTCCTGCATAGCGC No data
Right 1168415221 19:56163455-56163477 CTGTTCCTCATGGTGCTGCTTGG No data
1168415216_1168415221 23 Left 1168415216 19:56163409-56163431 CCAGACAGACTGGCACAGGTGCA No data
Right 1168415221 19:56163455-56163477 CTGTTCCTCATGGTGCTGCTTGG No data
1168415212_1168415221 29 Left 1168415212 19:56163403-56163425 CCCCAGCCAGACAGACTGGCACA No data
Right 1168415221 19:56163455-56163477 CTGTTCCTCATGGTGCTGCTTGG No data
1168415213_1168415221 28 Left 1168415213 19:56163404-56163426 CCCAGCCAGACAGACTGGCACAG No data
Right 1168415221 19:56163455-56163477 CTGTTCCTCATGGTGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168415221 Original CRISPR CTGTTCCTCATGGTGCTGCT TGG Intergenic
No off target data available for this crispr