ID: 1168417079

View in Genome Browser
Species Human (GRCh38)
Location 19:56175955-56175977
Sequence CCTTCTGAGGAGACAATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168417079_1168417082 -9 Left 1168417079 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1168417082 19:56175969-56175991 CTCAGAAGGCATAAAAGCTCAGG 0: 1
1: 0
2: 8
3: 129
4: 276
1168417079_1168417083 -8 Left 1168417079 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1168417083 19:56175970-56175992 TCAGAAGGCATAAAAGCTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 228
1168417079_1168417086 10 Left 1168417079 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1168417086 19:56175988-56176010 CAGGGGGCGTGAAAGAGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 111
1168417079_1168417084 -7 Left 1168417079 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1168417084 19:56175971-56175993 CAGAAGGCATAAAAGCTCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 283
1168417079_1168417085 -6 Left 1168417079 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1168417085 19:56175972-56175994 AGAAGGCATAAAAGCTCAGGGGG 0: 1
1: 0
2: 0
3: 16
4: 213
1168417079_1168417087 16 Left 1168417079 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1168417087 19:56175994-56176016 GCGTGAAAGAGTCCAGGCGCTGG 0: 1
1: 0
2: 1
3: 7
4: 69
1168417079_1168417088 23 Left 1168417079 19:56175955-56175977 CCTTCTATTGTCTCCTCAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1168417088 19:56176001-56176023 AGAGTCCAGGCGCTGGAGCGAGG 0: 1
1: 0
2: 3
3: 9
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168417079 Original CRISPR CCTTCTGAGGAGACAATAGA AGG (reversed) Intergenic
900706528 1:4083835-4083857 GCTTCTGAGGAAACAATGCACGG + Intergenic
904801998 1:33099577-33099599 TCTTCTGAGGAGCCAATGAAGGG - Intronic
904937819 1:34144289-34144311 CCCTCTGTGGAGACAAGAGTAGG - Intronic
906175032 1:43763755-43763777 CCATCAGAGGAGGCAATGGAGGG + Intronic
906922440 1:50078891-50078913 CCTTCTGAGCTCACAATGGAAGG - Intronic
907407867 1:54264755-54264777 CCTTCTGTGAAGACAAAAGGCGG - Intronic
907461075 1:54606052-54606074 CCTGCTCTGGAGAAAATAGATGG - Intronic
907934709 1:59031947-59031969 TCTTCTGAGGAAAAAGTAGAGGG + Intergenic
907988787 1:59558574-59558596 ACTTCTGAGGAAACAGTACAAGG + Intronic
910071762 1:83223881-83223903 GCATCAGAGAAGACAATAGATGG - Intergenic
911808501 1:102243091-102243113 CCCTGTGAGGAGAAAACAGAAGG + Intergenic
912648046 1:111413973-111413995 CTTCTTGAGGAGAGAATAGATGG + Intergenic
915242980 1:154537074-154537096 CCTTCTGGGCTGACAATAGTAGG - Intronic
916689646 1:167178202-167178224 CCATCTGAGGATACAAGGGAGGG - Intergenic
917978137 1:180253233-180253255 CTTTTTGAGGAGACATGAGAAGG - Intronic
918062790 1:181076610-181076632 CCTTCTGAAGGGACAATAGCTGG + Intergenic
918122205 1:181549915-181549937 TCTACTGTGAAGACAATAGAGGG + Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
923192753 1:231635928-231635950 CCTTCTGATGAAACAATATCCGG - Intronic
1063267908 10:4474767-4474789 CCTGCTGAGGAGAGACTTGAGGG + Intergenic
1063464661 10:6234995-6235017 CCTTTTGAGGGGACATTGGACGG + Exonic
1063587552 10:7366229-7366251 CTTTCTTTGGAGACAATAAAGGG + Intronic
1063886949 10:10589306-10589328 CCCACTTAAGAGACAATAGATGG + Intergenic
1064339845 10:14476080-14476102 CCCACTGAGGAGAGAATATAAGG + Intergenic
1069633787 10:69913318-69913340 CCTTCTGGGGAGACAAGAGGGGG + Intronic
1070728185 10:78806788-78806810 CATTCTGAGGTGACAAGAAAGGG + Intergenic
1071709702 10:88038043-88038065 AGTTCAGAGGACACAATAGAGGG + Intergenic
1075180538 10:120207035-120207057 GCTGCTGAGGAGATAATAGATGG - Intergenic
1078804527 11:14684454-14684476 GCTTCTGAGGAAACAGTACAAGG + Intronic
1081805764 11:45889686-45889708 CCTTATGAGGAAACAAGAGAGGG + Intronic
1082893246 11:58162859-58162881 TCTTCTGAGGACAAAATGGAAGG + Intronic
1084583409 11:70038901-70038923 CCTTCGGGAGAGAAAATAGAAGG + Intergenic
1084862441 11:72028882-72028904 CCTTCTGGTGAGACAAGAGATGG + Intronic
1089479189 11:118791350-118791372 CTTCCTGAGGAGAAAATGGAGGG + Intergenic
1090844109 11:130516667-130516689 CCTTCTGAGGAGGCAAAGCATGG + Intergenic
1092506064 12:9101438-9101460 CCTTCTCACCAGATAATAGAAGG + Exonic
1095339712 12:41075275-41075297 CCTTCTGAGTAGTCAAAAGGTGG + Intergenic
1095461478 12:42449062-42449084 CCTTCTGACGATACATCAGAAGG - Intronic
1096599704 12:52720897-52720919 CCCTCTGAGGAGACGAGGGACGG + Intergenic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1102109576 12:110354761-110354783 CCTTCTGAGCTGACAGTACAAGG - Intergenic
1103962464 12:124617621-124617643 CCTTCTGAGGAGGCAAAATGGGG - Intergenic
1105959468 13:25317197-25317219 CCTTTTGAGGAAATGATAGAAGG + Intronic
1109774625 13:67023949-67023971 CATTCAGAGGAGAAAAAAGATGG + Intronic
1110162584 13:72396989-72397011 CCTTCAGTGGATACAACAGAAGG + Intergenic
1115849083 14:37573918-37573940 GATTCTGAGGAGACAAAAGTTGG + Intergenic
1116789469 14:49325164-49325186 GCTTCTGAGGAGCCAACAGAAGG - Intergenic
1117263257 14:54058650-54058672 CATTCTGAGGACACAGCAGAGGG + Intergenic
1118861558 14:69668206-69668228 TCTTCTGTGGAGAAAAGAGAGGG + Intronic
1121147237 14:91594708-91594730 TCTTGTGAAGAGAAAATAGAGGG + Intronic
1122024668 14:98867144-98867166 CCATGTGAGGACACAAGAGACGG + Intergenic
1122401888 14:101472253-101472275 CCTGCTGAGGAGATCACAGATGG - Intergenic
1124192109 15:27588833-27588855 CTTTCTGAGTATAAAATAGAGGG - Intergenic
1125347540 15:38733217-38733239 TCTTCTGAGAAGACCACAGAAGG - Intergenic
1127299043 15:57634630-57634652 CCTTATGAGGGGACAGTACAGGG - Intronic
1132424149 15:101699820-101699842 CTTTCTGAGAAGACAATCCATGG - Intronic
1133639879 16:7706518-7706540 TCTTCTGGGGAGACACTATATGG - Intronic
1135593514 16:23723022-23723044 GCTTCTGAGGAAACAAGACAAGG - Intergenic
1137246220 16:46707819-46707841 CCTTATGAAGAAACAATAAAAGG + Intronic
1141214695 16:82012097-82012119 CATGATGAGGAGACAAAAGATGG - Intergenic
1143124897 17:4635818-4635840 TCTTCTGAGGGGACACTTGATGG - Exonic
1143403617 17:6661332-6661354 TCTTCTGAGGGGACACTTGATGG + Intergenic
1153369378 18:4296877-4296899 CTTTCTGAGCAGGCAATGGATGG + Intronic
1153456798 18:5291669-5291691 CCTTCTGATGACACAGTAGAAGG - Exonic
1155597061 18:27500454-27500476 CCTTCTCTGGAGACAAATGATGG + Intergenic
1163646008 19:18489528-18489550 CCCTCTGAGGAAACTAGAGAAGG - Intronic
1168417079 19:56175955-56175977 CCTTCTGAGGAGACAATAGAAGG - Intergenic
925539379 2:4950437-4950459 GCTTCTGAGGAAACCAAAGAAGG - Intergenic
926006937 2:9379600-9379622 CCTCCTGAGGGGACAACAGCTGG - Intronic
927362639 2:22253899-22253921 CCTTCTGGGGAAGCAAAAGATGG + Intergenic
927951704 2:27174689-27174711 GGTTCTGAGGAGAAAAAAGAAGG - Intergenic
928642639 2:33316503-33316525 CCTGCTGAGCAGACAAAACATGG + Intronic
928705260 2:33942561-33942583 CCTTCTGAGGACAATATATAAGG + Intergenic
929726217 2:44430461-44430483 CCTTCAGTGCAGAGAATAGATGG + Intronic
930617681 2:53610631-53610653 CCTTCTGATGATACATTTGAAGG - Intronic
931062048 2:58541084-58541106 CCTGCTTAGAATACAATAGATGG - Intergenic
931431405 2:62211720-62211742 GCTTCTGAGGCCACACTAGAAGG - Intronic
933428687 2:82146315-82146337 CATTCTGAGGAGACACCTGATGG + Intergenic
933486450 2:82930531-82930553 CCTCCTGAGGAGACACTGCAAGG - Intergenic
935182226 2:100701362-100701384 CCTGCTGAGGAGCCCAAAGATGG - Intergenic
935299961 2:101685587-101685609 TCTTCTGAGGAGGCAATAATTGG - Intergenic
935751195 2:106235289-106235311 CCTTCTGAGGAAACAGGACAAGG + Intergenic
936315854 2:111423397-111423419 CCTTCTGAGGAGACTCCAGTGGG + Intergenic
936975268 2:118213961-118213983 CTCTCTGAGAAGACAAAAGAGGG + Intergenic
941140120 2:161769571-161769593 CCTTCTGAGGGGAACATATAAGG - Intronic
942497017 2:176550487-176550509 TCTTCTGTGTAGACAATACATGG - Intergenic
944879964 2:204002693-204002715 CCTTCTGAAGAAAACATAGAAGG + Intergenic
945045073 2:205774680-205774702 ACTTCTGAGAAGACATTAGAAGG + Intronic
945266841 2:207899022-207899044 CTTTGTGAGGAAACATTAGAAGG - Intronic
945816022 2:214605911-214605933 ACTTCTGTGGAGAGAAGAGACGG + Intergenic
946073256 2:217052544-217052566 ACTTTTGGGGAGACACTAGAAGG + Intergenic
946229405 2:218282288-218282310 CCCTCTAAGGAGAAAATAGGTGG - Intronic
946374570 2:219300249-219300271 TCTTCTGAACAGACAATGGAGGG - Exonic
1169012246 20:2260341-2260363 CCTGGTGAGGAGCCAAGAGATGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1178846281 21:36176626-36176648 CCTTCTGAGAAGACACCAAATGG + Intronic
1180741168 22:18054116-18054138 CCTCCTGAGGAGCCACAAGAGGG - Intergenic
1181729451 22:24834009-24834031 CCTTTTGTGGAGAGAACAGATGG + Intronic
1181844703 22:25697891-25697913 ACTTCTGAACAAACAATAGAAGG - Intronic
1183540213 22:38425463-38425485 CCTTCCGGCGAGTCAATAGAAGG - Intergenic
1184133730 22:42533707-42533729 CCATGTGAGGAGACGAGAGATGG - Intergenic
1185037620 22:48488244-48488266 TTTTCTGAGGAGCCAGTAGAGGG - Intergenic
949230136 3:1741094-1741116 CCTCCAGAGTACACAATAGATGG - Intergenic
949308063 3:2665680-2665702 CCCTCTCAGGAGAGAATATAAGG + Intronic
950006307 3:9693631-9693653 CATGCTGAGGAAAAAATAGAGGG + Intronic
951849661 3:27125003-27125025 CCTTCTGAGTTGACAATAATAGG + Intronic
953635559 3:44660894-44660916 CATTCTGAGAAGACCAAAGAGGG + Intergenic
954316100 3:49802807-49802829 CCGTCTGAGGACTCAAGAGAGGG - Intergenic
956373721 3:68591599-68591621 CCTTCTGATGATACATCAGAAGG - Intergenic
956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG + Intergenic
957463284 3:80551511-80551533 TCATGGGAGGAGACAATAGAAGG + Intergenic
957794223 3:84982150-84982172 CCTTCTGATGTCACATTAGAAGG + Intronic
961092690 3:124128554-124128576 CCCTCTGAGTTGACAATACAGGG + Intronic
961848079 3:129785796-129785818 ACTTCTGTGGAGGGAATAGAGGG - Intronic
962902464 3:139773272-139773294 CCTTCGTAGCAGACAAGAGAGGG + Intergenic
963963978 3:151344675-151344697 CCTTCTGATAAGACAAAATATGG - Intronic
964783901 3:160372513-160372535 CCTTATGAGGAAAGTATAGATGG + Intronic
965243646 3:166236147-166236169 CCTTCTGAACAGACAAAAGGTGG - Intergenic
967346165 3:188458183-188458205 GCTTCTGAAGAGATAATTGAAGG + Intronic
970330576 4:14979340-14979362 GCTTCTGAGGAAATAAAAGATGG + Intergenic
970758551 4:19455477-19455499 CCTCCTGAGCAAACAACAGACGG + Intergenic
971004830 4:22361519-22361541 CCTTCTGAGCACACAAAAGTTGG - Intronic
971235207 4:24835364-24835386 CCTTCTGAATAGACATGAGATGG + Intronic
971855749 4:32041245-32041267 CCATGTGAGGACACAGTAGAAGG + Intergenic
972482424 4:39510030-39510052 CAATTTGAGGAGACAATGGATGG + Intronic
975035448 4:69674544-69674566 CCTCCTGAGCAAACAAAAGAGGG + Intergenic
977042488 4:92031355-92031377 CCTTATGAAGAGAAAATAGGAGG + Intergenic
977869199 4:102070041-102070063 TCTTCTGAGGAGACAAGAATTGG - Intronic
979892770 4:126120573-126120595 CCTTATGAGGATGCATTAGAAGG + Intergenic
980305440 4:131054795-131054817 CCTCCTGAGCAAACAACAGAGGG + Intergenic
986565964 5:9114877-9114899 CTTTCTGAGGTTACAATAAAAGG - Intronic
987784393 5:22480470-22480492 GCTACTCAGGAGACAAAAGACGG + Intronic
989720304 5:44520303-44520325 CATTCTGAATAGAGAATAGAAGG - Intergenic
990537001 5:56732947-56732969 GCTTCGGAGGAGAAAAAAGAAGG - Intergenic
991237354 5:64415228-64415250 CCTTCTGACAAGACATCAGAAGG + Intergenic
992991804 5:82291546-82291568 TCTCCTGTGGAGACAGTAGAGGG + Intronic
994052695 5:95380673-95380695 CCTTCTGAGGCGACGAGACAGGG - Intergenic
996800656 5:127398960-127398982 AGTTCTGAGGAGACAGAAGAAGG + Intronic
996906723 5:128609205-128609227 CCTGCAGAGGTGACAATAGCTGG + Intronic
996948979 5:129102104-129102126 TCTTATGAGGAGAGTATAGAGGG - Intronic
997982670 5:138478794-138478816 GATTCTGAGGAGACAATGCAGGG - Intergenic
999283973 5:150383043-150383065 CCTTCTGAGGGGACAAGACCTGG - Intronic
999477340 5:151912657-151912679 GCTTCTGCAGAGCCAATAGAAGG + Intronic
999841921 5:155437152-155437174 CATTTTGATGAGACATTAGATGG + Intergenic
1000962791 5:167620095-167620117 CCTTCTGAGAGGTCAATAGTCGG + Intronic
1002719360 5:181248331-181248353 CCTTGTGAGGAGACACCTGAGGG - Intergenic
1003155856 6:3593296-3593318 CCTCTTGAGAAGACAGTAGACGG + Intergenic
1003765254 6:9229439-9229461 CCTTCTTAGAAGACTAGAGAGGG - Intergenic
1005221935 6:23597074-23597096 CTTTCTGAGGGCAAAATAGATGG - Intergenic
1007845022 6:44747295-44747317 CCTTCTGAGTGGAAAAAAGAGGG - Intergenic
1008138367 6:47803101-47803123 CATTCTGTGGATAAAATAGAAGG + Intronic
1009025747 6:57998455-57998477 GCTGCTGAGTAGAGAATAGATGG - Intergenic
1009201310 6:60749924-60749946 GCTGCTGAGTAGAGAATAGATGG - Intergenic
1009833574 6:68969841-68969863 CCTTCTGTGGGTAGAATAGATGG - Intronic
1012788821 6:103666215-103666237 CCTGCTGAGGACAAAATAGATGG - Intergenic
1012864999 6:104608575-104608597 CTTTCTCAGGAATCAATAGAAGG - Intergenic
1013230642 6:108158412-108158434 ACTTATGAGGGGACAATAGCTGG - Intronic
1013337093 6:109174613-109174635 CTTTTTGAGGAGAAAAAAGATGG + Intergenic
1015499869 6:133920901-133920923 CCACCTGAGGAGACGATGGATGG + Intergenic
1018253315 6:161894079-161894101 CCATCTGAGGACACAGGAGAAGG - Intronic
1019078679 6:169412426-169412448 CCTTAAGAGGTGCCAATAGAAGG - Intergenic
1020985445 7:15128173-15128195 CCTTCAGAGGAGAAAACAGGTGG + Intergenic
1022267151 7:28768192-28768214 CCTTCTGAGGAAACAGAAGAAGG - Intronic
1022791594 7:33694593-33694615 TTTTCTGAGGAGACCATAGAGGG - Intergenic
1022971682 7:35523538-35523560 CCTTCTGAAGATACATCAGAAGG + Intergenic
1024003872 7:45211243-45211265 ACATCTCAGGAGACAATGGAGGG - Intergenic
1026656864 7:72264111-72264133 CCTTCTGAGAAGTCAGGAGACGG + Intronic
1027289470 7:76688830-76688852 GCATCAGAGAAGACAATAGATGG - Intergenic
1028430433 7:90740528-90740550 CCATGTGAGGACACAAGAGAAGG + Intronic
1035473471 7:159126578-159126600 TCTTCTCAGGAGACAACAGGCGG + Intronic
1037431389 8:18816949-18816971 CCATGTGAGTAGAAAATAGAAGG + Intronic
1039799792 8:40944358-40944380 CCTTCTGAGGAGCAGAGAGAAGG - Intergenic
1044572015 8:93730610-93730632 CTTTCTGAGGGGACAACAGGAGG + Exonic
1046906880 8:119583023-119583045 ACTTCTGTGGAGTCATTAGAGGG - Intronic
1046958292 8:120083876-120083898 CTTTCTGAGGAGAGAAAACAAGG - Intronic
1047113633 8:121817631-121817653 CCATCTGAGAAGAGAAGAGAAGG + Intergenic
1053102039 9:35379128-35379150 TCTTCTGAGGAGCCAACAGAAGG - Intronic
1057142235 9:92734615-92734637 CCTCCTGAGGAGACAAGATGGGG - Intronic
1057978585 9:99634425-99634447 TCCTCAGAGGAGACAATAAAGGG - Intergenic
1058103632 9:100945223-100945245 ACTTCTGAGCAGACAAAACAAGG - Intergenic
1058307547 9:103462257-103462279 CCTTCTAAGGATACATCAGAAGG + Intergenic
1060144099 9:121236068-121236090 CCCTCTGAAGAGGCAATGGAAGG + Intronic
1061563072 9:131419112-131419134 CCCTCTGATGTTACAATAGATGG - Intronic
1186705440 X:12135818-12135840 CCTTCTGAGAAGAGAACAGTTGG - Intergenic
1186859823 X:13661323-13661345 TCTTCTAAGGAGAAATTAGAAGG - Intronic
1188385455 X:29552042-29552064 CCTGCAGAGCAGACAATAGCTGG - Intronic
1192333827 X:70201264-70201286 CCATCACAGTAGACAATAGAAGG + Intronic
1193530122 X:82645974-82645996 CCTTCTCAGTGGACCATAGAGGG + Intergenic
1198571043 X:137957296-137957318 CCTTCTGAGAAGACAGTATGTGG + Intergenic
1201255338 Y:12102434-12102456 CCTTCTGATGATACCGTAGAAGG - Intergenic
1201451032 Y:14115626-14115648 ATTTCTGAGGAGACAGGAGAAGG - Intergenic