ID: 1168421586

View in Genome Browser
Species Human (GRCh38)
Location 19:56207679-56207701
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 2, 1: 9, 2: 42, 3: 124, 4: 493}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168421586_1168421589 -10 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421589 19:56207692-56207714 CATTTTTGTTGTCATTGTAGGGG 0: 1
1: 1
2: 1
3: 42
4: 461
1168421586_1168421595 18 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421595 19:56207720-56207742 GGGGTGTTGATAGCATCTAGAGG 0: 3
1: 1
2: 4
3: 45
4: 319
1168421586_1168421593 -2 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421593 19:56207700-56207722 TTGTCATTGTAGGGGGTGGTGGG 0: 1
1: 1
2: 4
3: 25
4: 214
1168421586_1168421597 22 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421597 19:56207724-56207746 TGTTGATAGCATCTAGAGGGTGG 0: 3
1: 1
2: 0
3: 14
4: 173
1168421586_1168421599 28 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421599 19:56207730-56207752 TAGCATCTAGAGGGTGGAGGCGG 0: 4
1: 0
2: 1
3: 18
4: 258
1168421586_1168421590 -9 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421590 19:56207693-56207715 ATTTTTGTTGTCATTGTAGGGGG 0: 1
1: 0
2: 3
3: 49
4: 602
1168421586_1168421591 -6 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421591 19:56207696-56207718 TTTGTTGTCATTGTAGGGGGTGG 0: 1
1: 0
2: 2
3: 30
4: 285
1168421586_1168421601 30 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421601 19:56207732-56207754 GCATCTAGAGGGTGGAGGCGGGG 0: 3
1: 6
2: 56
3: 388
4: 1069
1168421586_1168421596 19 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421596 19:56207721-56207743 GGGTGTTGATAGCATCTAGAGGG 0: 3
1: 1
2: 0
3: 24
4: 190
1168421586_1168421594 -1 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421594 19:56207701-56207723 TGTCATTGTAGGGGGTGGTGGGG 0: 2
1: 1
2: 1
3: 32
4: 328
1168421586_1168421598 25 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421598 19:56207727-56207749 TGATAGCATCTAGAGGGTGGAGG 0: 3
1: 1
2: 3
3: 43
4: 371
1168421586_1168421592 -3 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421592 19:56207699-56207721 GTTGTCATTGTAGGGGGTGGTGG 0: 1
1: 0
2: 3
3: 40
4: 364
1168421586_1168421600 29 Left 1168421586 19:56207679-56207701 CCATGTCTAGAGACATTTTTGTT 0: 2
1: 9
2: 42
3: 124
4: 493
Right 1168421600 19:56207731-56207753 AGCATCTAGAGGGTGGAGGCGGG 0: 3
1: 1
2: 20
3: 65
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168421586 Original CRISPR AACAAAAATGTCTCTAGACA TGG (reversed) Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901954226 1:12772336-12772358 AAAAAAAATCTACCTAGACATGG - Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902728908 1:18355816-18355838 AAAAAAAAAGAGTCTAGACATGG - Intronic
903530423 1:24026117-24026139 TACAAAAATGTAGCCAGACATGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
905491184 1:38345080-38345102 AATAAAAATGTCTCTCTCCAGGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906463352 1:46054863-46054885 AACAGAAATGTATCTATAGAAGG - Intronic
908367252 1:63438136-63438158 AAAAAAACTGGTTCTAGACACGG + Exonic
909212612 1:72843729-72843751 CACAAAAATATCTCTAAAAAAGG - Intergenic
909313150 1:74179611-74179633 AACAAAAATAACTCTTGAGAAGG - Intronic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911289335 1:96037959-96037981 AACAAAACTGTCTCCTGCCATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912346965 1:108972644-108972666 AAAAAAAATGTCTATAGGCCGGG + Intronic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
915812521 1:158929827-158929849 AACAAAAATGTCCTGAAACATGG + Intergenic
916198199 1:162244775-162244797 AACAAAAATTTTTTTAGATATGG + Intronic
917300900 1:173573080-173573102 AGCAAAAAGGGCTCTGGACATGG - Intronic
917417008 1:174820859-174820881 TACAAAAATTTCCCTAGGCATGG + Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918833482 1:189429539-189429561 AACAAAAATATATCTTGAAAGGG - Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
919683661 1:200460389-200460411 AACAAAAATTTGTAGAGACAGGG + Intergenic
919707567 1:200692623-200692645 AAAAAAAAAGTCCCTAGAAAAGG + Intergenic
920760037 1:208774777-208774799 AACAAATGTGTCTCTGGGCATGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921494357 1:215820231-215820253 GAAAAAAATGTGTGTAGACATGG - Intronic
921697968 1:218233974-218233996 CACATAAATGCCTCTAGTCAAGG + Intergenic
922139217 1:222865396-222865418 AACTTAAATGTTTCTATACAGGG - Intergenic
922489977 1:226008231-226008253 AAGAAAAAGTTCTCTAGAAAGGG + Intergenic
923034794 1:230278293-230278315 AAAAAAAATGTTTGTAGAGATGG + Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
924563568 1:245177387-245177409 CACAAAAATATCTCTAAATAGGG - Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065287016 10:24195956-24195978 AAAAAAAATTTCTGTAGACATGG - Intronic
1065330193 10:24587955-24587977 AAGAAAAATGCATCTAGAGAAGG + Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065501492 10:26387392-26387414 AACAAAGATGTCTCTGGGCCGGG + Intergenic
1066090904 10:32018857-32018879 TACAAAAATTTTTTTAGACAGGG - Intronic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068182510 10:53539695-53539717 AACAAAAAAGTCTATAGTGATGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069681182 10:70286588-70286610 AAGAAAAATGTCTGTAGAAGAGG - Intergenic
1070405168 10:76087967-76087989 AACAAAAAATTATCTGGACAAGG + Intronic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1071146609 10:82581910-82581932 AAAAAAAGTGTATCTAAACACGG - Intronic
1072280136 10:93858359-93858381 AACAAAAACCTCTCTAGGGAAGG - Intergenic
1072355567 10:94606520-94606542 AAAAAAAATTTCTTGAGACAGGG + Intronic
1074117917 10:110471465-110471487 AAAAAAAATGTTTCTAGGCTGGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076161844 10:128250155-128250177 AAGAAAAATATCTCTACTCAGGG - Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078182764 11:9026618-9026640 AAAAAAAATGTATAGAGACAGGG + Intronic
1078233496 11:9463076-9463098 AACATAAATGACCCTGGACAAGG - Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078872711 11:15363890-15363912 ATAAAAAATGTCTATGGACATGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083284480 11:61649443-61649465 AAAAAAAATTTTTCGAGACAGGG + Intergenic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084471528 11:69362335-69362357 AACAAAGAAGTCTCAAGACATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086549841 11:88042883-88042905 AACAGAAATGTCTTTACAGAGGG + Intergenic
1087195707 11:95302472-95302494 AACAAGTTTGTCTCTACACAAGG - Intergenic
1087200362 11:95338669-95338691 AACAAAAATGCTGCCAGACAGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090044362 11:123317721-123317743 AACAAAAAATTAGCTAGACATGG + Intergenic
1090324928 11:125877170-125877192 AACAAAGAAGTATCAAGACAAGG + Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092515244 12:9204735-9204757 AACAAACATGTTTATAAACATGG - Intronic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093772389 12:23032909-23032931 AACAAAAATGTTTATATATAAGG + Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095513716 12:42982720-42982742 CACCAAAATGTCTCTAAATAAGG + Intergenic
1096061291 12:48702827-48702849 AAAAAAAATGTAGCTAGGCATGG + Intronic
1096091405 12:48904249-48904271 AAGAAAAATGTCCCTAGAAAGGG - Exonic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1099682774 12:85848980-85849002 AACAAAAATTTATCCAGGCATGG - Intergenic
1099776421 12:87137347-87137369 AACAAACAAGACTATAGACATGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100634707 12:96424685-96424707 GACAAAAATGTCTGTGTACAAGG + Intergenic
1101010548 12:100444814-100444836 AACTATAATGTATCTACACAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101418601 12:104530415-104530437 TATAAAAAGGTCTCAAGACAGGG - Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1101987622 12:109460173-109460195 AAACAAAATGCTTCTAGACATGG - Intronic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108139384 13:47402865-47402887 GAGAAAAATGTATCTAGATAGGG - Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108780544 13:53825801-53825823 AATAAATATGTCTAGAGACAAGG - Intergenic
1108894152 13:55302149-55302171 AATAAAAATATTTCTAGGCAAGG + Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1111227913 13:85299558-85299580 AACTCAAATGTCCCTAGATAGGG - Intergenic
1111686156 13:91503291-91503313 AACAAAAATGACTCAAGGAAAGG + Intronic
1111863650 13:93740919-93740941 AACAAGAATGTTTCTGGAAAGGG + Intronic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112888701 13:104206205-104206227 AAAAAAAATTTAGCTAGACATGG + Intergenic
1112903756 13:104391840-104391862 AACAAAAATCTCTCTAGGTTTGG - Intergenic
1114200984 14:20519652-20519674 AACAAAAATATTTTTAGAGATGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115439113 14:33411476-33411498 AACAAAAATGCCTCCAGGCCGGG - Intronic
1115625091 14:35183141-35183163 AACAAACATTTATCTATACATGG - Intronic
1115733221 14:36294906-36294928 AACAAAAAGGACTCTAAAGATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116892470 14:50282133-50282155 ATTAAAAATGTCTCTAGGCTAGG - Intronic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1118616004 14:67574781-67574803 AACAAAAATGTCTTTAGGGCAGG - Intronic
1119142294 14:72278259-72278281 AACCAAATTGTTTCTGGACAAGG - Intronic
1119536529 14:75407436-75407458 AAAGAAAATGTATCTATACATGG - Intergenic
1119847746 14:77843180-77843202 AACAAAACTCTGGCTAGACAAGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120395674 14:83964183-83964205 AACAAAAATGTTTGTGGAAATGG + Intergenic
1121770785 14:96535724-96535746 AAAAACAATGTCTCTCTACATGG + Intronic
1121829845 14:97041614-97041636 AAGAAAAATGTCAATAAACATGG - Intergenic
1121959004 14:98241160-98241182 AAAAAAAATGTGTTTAGACTTGG + Intergenic
1123960354 15:25392374-25392396 AATACAAATGTCTCTAGATTTGG - Intronic
1124473660 15:30011573-30011595 AAAAAAAGTGCATCTAGACACGG - Intergenic
1124572155 15:30874131-30874153 AACAAAAATTTTTATAAACAGGG - Intergenic
1125045147 15:35236930-35236952 AACAAAAATATCTATCGACTAGG - Intronic
1126801467 15:52301536-52301558 AAAAAAAATTTATCTAGGCATGG - Intergenic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1127872618 15:63086123-63086145 TACAAAAATTTATCTAGGCATGG - Intergenic
1128091357 15:64921142-64921164 TACGAAAATGTCTGTAGAGATGG + Intronic
1129381733 15:75172119-75172141 AAAAAAAATGTTTGTAGAGAGGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1129944534 15:79527469-79527491 AACAATTATGTCCCTAAACAAGG + Intergenic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131530206 15:93184362-93184384 AAAAAAAAAGTCTCTAAATATGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133579989 16:7135222-7135244 AACAAAAAAATTCCTAGACAGGG - Intronic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133632671 16:7636609-7636631 AACAAAACTTGCTCTTGACAGGG - Intronic
1133700751 16:8306196-8306218 TACCAAAATGTCTCTTGACTAGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134614570 16:15641088-15641110 AACAAAAATTTTTTTAGAGATGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135232816 16:20725675-20725697 ATCAAAAATGTCCCTAGGCTGGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135851059 16:25964183-25964205 AAAAAAAAGGTCCCTAGAAATGG + Intronic
1135866860 16:26111249-26111271 AAAAAAAATGTTTGTAGAGATGG + Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136084827 16:27877407-27877429 TACAAAAATGAATCTAGACAGGG - Intronic
1136736344 16:32471036-32471058 AACAAAAAAGTGTCAAGAAAAGG - Intergenic
1137067871 16:35868541-35868563 AAGATAAATTTCTCTAGGCAAGG + Intergenic
1137262909 16:46845489-46845511 AACAAAAATGTGGCCAGGCACGG + Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137330900 16:47494468-47494490 AACAAAAATGCCTGTAAACATGG + Intronic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1138541583 16:57690882-57690904 AAAAAAAATATATCTAGGCATGG + Intergenic
1138621903 16:58218239-58218261 AAAATAAAGGACTCTAGACATGG + Intergenic
1139062195 16:63265523-63265545 AACAAAAATGTCGATAGCAAAGG - Intergenic
1140114885 16:72033490-72033512 AACAAAACTTTCTCTACACCTGG - Intergenic
1140248524 16:73273068-73273090 AAGAAAAATACCACTAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140611349 16:76602780-76602802 AAAAAAAATTTCACTGGACATGG - Intronic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141966475 16:87448386-87448408 AACAACAATGCGTCTCGACATGG + Intronic
1142154991 16:88528855-88528877 CACCAAAATCTCTCTACACATGG + Intronic
1203016725 16_KI270728v1_random:358539-358561 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1203035060 16_KI270728v1_random:631697-631719 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1143273353 17:5692031-5692053 TACAAAACTGTCTCTGGACTGGG - Intergenic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1146299017 17:31673746-31673768 AACAAAATTTTTTCGAGACAGGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147637679 17:41973990-41974012 AAAAAAAATGTCACAAAACAAGG - Exonic
1147695099 17:42346046-42346068 AAAAAAAATTTCTGTAGAGATGG + Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1149316824 17:55446241-55446263 AAAAAAAATTGCTCTTGACATGG + Intergenic
1149940097 17:60855236-60855258 AACAAAAAACTCTCTGGGCACGG - Intronic
1150246104 17:63676509-63676531 AATAAAAATGTCTCTTGTAAGGG - Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150421829 17:65043684-65043706 AACAAAAATATCTGTAGGCCAGG + Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151438080 17:74110688-74110710 AAAAAAAATGTGTATACACAGGG + Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152075332 17:78155992-78156014 AACAAAAATGTTTCTGGAATAGG - Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152764761 17:82130188-82130210 AAAAAAAATGTTTTGAGACAGGG - Intronic
1153748050 18:8200408-8200430 AACAACAATGTCTTGTGACAAGG - Intronic
1153846376 18:9053178-9053200 AACAAGAATGTATCTAAAAATGG - Intergenic
1153875159 18:9363779-9363801 TACAAAAAAGTATCTAGATATGG - Intronic
1154214261 18:12404169-12404191 AAAAAAAATGTTTTTAGAGACGG - Intergenic
1156200082 18:34820933-34820955 AAGAAAATTGTCTCTATACTGGG - Intronic
1156535367 18:37859037-37859059 GACAAAAATGTCACTATATAAGG - Intergenic
1156548156 18:37986556-37986578 AAAAATAATGTGTCAAGACAGGG + Intergenic
1156813446 18:41280080-41280102 AATAAGAATGTGTATAGACATGG - Intergenic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1156986143 18:43353451-43353473 AAGAAAAATGTTTCTTGCCAAGG - Intergenic
1157582473 18:48781568-48781590 AACAAAAATCTCGCTAGATATGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159265962 18:66079464-66079486 AACAAAAATAAATTTAGACAAGG - Intergenic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161922801 19:7279162-7279184 AATAAATATCCCTCTAGACAGGG + Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162713884 19:12616431-12616453 AACAAAAAGGACGCTAGGCATGG + Intronic
1163160827 19:15463239-15463261 AAAAAAAAAGTATCTAGGCATGG - Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164285573 19:23813056-23813078 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1164317871 19:24110388-24110410 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165573265 19:36793104-36793126 AAAAAAATTGTTTTTAGACAGGG + Intergenic
1166168049 19:41006311-41006333 AAAAAAAATGTAGCTAGACATGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
1202677825 1_KI270711v1_random:23772-23794 AAAAAAAATGTCTCTGACCAGGG - Intergenic
925960838 2:9013837-9013859 AAAAAGAATATCTCTAGAGAGGG - Intergenic
926215911 2:10905257-10905279 CCCAAAAATCTCTCTAGCCACGG + Intergenic
926624780 2:15082073-15082095 AACAAAAATGTGTGTAAAAATGG + Intergenic
926745009 2:16149575-16149597 AACAAAAATTTAGCTAGGCATGG - Intergenic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929296715 2:40256692-40256714 AAAAAAAATGTCTTTAGAGAAGG + Intronic
929396332 2:41527319-41527341 AACAAAAATATGTATAGCCATGG + Intergenic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929521751 2:42658900-42658922 AAAAAAATTTTCTGTAGACAAGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930538894 2:52680124-52680146 AACCAAAATCCCTCTTGACATGG - Intergenic
931206686 2:60153505-60153527 AAAAAAAATGCATCTAGATAAGG + Intergenic
933227958 2:79772735-79772757 AAAAAAAATGTGTAGAGACAGGG + Intronic
933516130 2:83304868-83304890 AACAAAAATGTGCCTAGAGATGG - Intergenic
934187510 2:89760162-89760184 AACAAAAAAGTGTCAAGAAAAGG - Intergenic
934309121 2:91847777-91847799 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
935024059 2:99259485-99259507 AACAAATATATTCCTAGACATGG - Intronic
935891397 2:107682693-107682715 CACAATAATGTATCTAGACATGG - Intergenic
936048564 2:109205389-109205411 AACAAAAAATTATCTAGGCATGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
938132944 2:128732846-128732868 AACAAAAAGGTTTGTAGTCAAGG + Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939109472 2:137990275-137990297 CAAAAAAATGAATCTAGACAAGG - Intronic
939413132 2:141857505-141857527 AAAAAAAATTTTTGTAGACATGG + Intronic
939614996 2:144352575-144352597 AACCTAAATGTCTCTCAACAGGG + Intergenic
939632796 2:144545611-144545633 AACAAAAAAGCCTCTAAAAAAGG - Intergenic
939775319 2:146379758-146379780 AAGAAAATTGTCTTTTGACAGGG - Intergenic
939874585 2:147563022-147563044 AACAAAAATTGAACTAGACATGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940179874 2:150919959-150919981 TACGAAAATGTCAGTAGACAGGG + Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
943178390 2:184508773-184508795 AAGATAAATGTCTCATGACAGGG - Intergenic
943280001 2:185919849-185919871 AACAATAATTTCACTGGACATGG + Intergenic
944593874 2:201244225-201244247 AACAAACATTTCTGTAAACATGG - Intronic
946629974 2:221656532-221656554 ATCAAAAATATTTCTAGAGATGG - Intergenic
946736346 2:222758085-222758107 AAAAAAAATTTTTTTAGACATGG - Intergenic
946972753 2:225113422-225113444 AACAAAAATGTTCCTGTACATGG - Intergenic
947302923 2:228708390-228708412 AACAAAAATGGCTCAAGGGATGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1168940821 20:1709761-1709783 AACAGAAATGTTTTTGGACAGGG - Intergenic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170906369 20:20518356-20518378 AACAAAACTATCTCTGGTCAGGG - Intronic
1170974615 20:21150428-21150450 CACAAAAATCTCCCTAGACGGGG + Intronic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1177011712 21:15738627-15738649 TACAAAATTGTCTCTGGAAAAGG - Intronic
1177398877 21:20575533-20575555 CATAAAAATGTCTCAAAACATGG + Intergenic
1177802972 21:25846618-25846640 AAAAAAAACTTCACTAGACATGG - Intergenic
1178418240 21:32421461-32421483 AAAAATAATGTCTCTTGAGATGG + Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179151442 21:38812269-38812291 AAGAAAAATGACCCTTGACAAGG - Intronic
1179363728 21:40736459-40736481 AACAGAAATGTATCTTGTCATGG + Intronic
1179446391 21:41433966-41433988 AACCAAGATGTCTCTAGACCTGG - Intronic
1180536206 22:16394891-16394913 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1180768643 22:18363008-18363030 TACATAAAAGACTCTAGACATGG + Intergenic
1180777669 22:18499383-18499405 TACATAAAAGACTCTAGACATGG - Intergenic
1180810394 22:18756694-18756716 TACATAAAAGACTCTAGACATGG - Intergenic
1180826517 22:18866232-18866254 TACATAAAAGACTCTAGACATGG + Intergenic
1181077234 22:20388854-20388876 TACATAAAAGACTCTAGACATGG + Intronic
1181170958 22:21009750-21009772 AACAAGAGTGTCTGTAGCCACGG - Intergenic
1181196538 22:21190949-21190971 TACATAAAAGACTCTAGACATGG - Intergenic
1181212991 22:21302175-21302197 TACATAAAAGACTCTAGACATGG + Intergenic
1181328013 22:22066117-22066139 AAGAAAAATGTAACTAGACCAGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181851414 22:25752661-25752683 AAAAAAAATTTTTTTAGACATGG + Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182363397 22:29761285-29761307 AAAAAAAATAGCTGTAGACAGGG + Intronic
1182729775 22:32478740-32478762 AACAAAAATGTAGCTGGACATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183811806 22:40263963-40263985 GAGCAAAATGGCTCTAGACAGGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184875453 22:47271774-47271796 AAAAAAAATGTGTCTAGGCCAGG - Intergenic
1203230261 22_KI270731v1_random:103896-103918 TACATAAAAGACTCTAGACATGG + Intergenic
1203276661 22_KI270734v1_random:92138-92160 TACATAAAAGACTCTAGACATGG + Intergenic
950828314 3:15848911-15848933 AGCAAAATTATCTCTAGTCACGG + Intronic
951679334 3:25278500-25278522 TACAACAGTGTCTCTATACAGGG + Intronic
951846864 3:27093932-27093954 AACCCAAATGTCTCTCAACAAGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952125529 3:30295725-30295747 AAAAAAATTGTCTCTAGACTAGG + Intergenic
952186888 3:30979364-30979386 AGCAAAAATGTTTGTAGACCAGG - Intergenic
952252552 3:31668892-31668914 AAAAAAAAAATCTCTAGAGATGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953621897 3:44540353-44540375 AAAAAAAAAGTCTATAGACGGGG + Intergenic
954044284 3:47916272-47916294 AACAGAAATGGCTCTGGGCAAGG - Exonic
954216459 3:49127279-49127301 AAAAAAAATTCCTCTAGACCAGG - Intronic
954566263 3:51602750-51602772 AACAAAAATGCCTCTCCTCATGG + Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955287477 3:57656800-57656822 TACAAAAATGTAGCCAGACATGG + Intronic
955288369 3:57667325-57667347 AAAAAAAATTTCACTAGAGATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956200075 3:66696593-66696615 AACTAAAATGTGTCAAGTCAGGG + Intergenic
956707787 3:72014178-72014200 AATAAAAATACCTCTAGATAGGG + Intergenic
957225629 3:77441687-77441709 AAGATAAATGTCTTTAGTCAAGG + Intronic
958265219 3:91430188-91430210 AACAAAAACTTCACTATACAAGG + Intergenic
958710665 3:97713201-97713223 AAACTAAATGTCTTTAGACAGGG - Intronic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
958943145 3:100336205-100336227 AACGCAAATGTCTCCAGAAAAGG - Intronic
959243956 3:103838818-103838840 AACAAAAAGTTCTGTTGACATGG + Intergenic
959509378 3:107192692-107192714 AATAAAAATTTCTCTTGAAATGG - Intergenic
959779836 3:110217438-110217460 AACAAAAGTGTATTTTGACAAGG - Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
959975730 3:112456872-112456894 AACAATAATATCACTAGGCATGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960839411 3:121941044-121941066 AAAAAAAATGCTTCAAGACAGGG - Exonic
960890147 3:122439358-122439380 AAAAAAAATGTTTTTAGAGATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962099804 3:132329900-132329922 AAAAAAAAAGTACCTAGACAAGG - Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962787464 3:138781442-138781464 AAAAAAAATTTCTGTAGAGATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963858348 3:150280005-150280027 AACAAAAGTATCTCTAGGCCAGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964086019 3:152819444-152819466 CAAAAAAATGAATCTAGACATGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964769955 3:160213860-160213882 AACAAAAACTTATCTAGACATGG - Intergenic
964835593 3:160935010-160935032 AATATAAATGTATCTAGATATGG + Intronic
964990354 3:162803143-162803165 CACAATAATGTATCTAGTCAGGG + Intergenic
965186354 3:165469481-165469503 CACAAACATATCTCTAAACAGGG + Intergenic
966957965 3:184903618-184903640 AAAAAAAAATTCTCAAGACAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967383028 3:188881595-188881617 AACAGAACTGTCTGTAGACATGG - Exonic
968243054 3:197110279-197110301 AATGAAAAATTCTCTAGACAAGG - Intronic
968465526 4:748188-748210 AAAAAAAAGTTCTCTAGACGTGG - Intronic
968796140 4:2706033-2706055 AAAAAAAATATCTGTAGAGATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969271069 4:6102709-6102731 AAAAAAAAAGTCTTTAGAGAGGG - Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970665873 4:18335547-18335569 AACAAAGTTATCTCTAGACCGGG + Intergenic
971219799 4:24694370-24694392 AACAGAAATGCCTCTACCCATGG - Intergenic
971796253 4:31232694-31232716 AGTAAAAGGGTCTCTAGACATGG + Intergenic
972358219 4:38302762-38302784 AATAAAATTGTCTCTGGAGATGG + Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
974629652 4:64469033-64469055 TATAAAAATGTCTAAAGACATGG + Intergenic
976001605 4:80380717-80380739 AACAAAAATGAGTCAAGGCATGG - Intronic
976155174 4:82136294-82136316 ATGAAAAATGCCTTTAGACATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976520334 4:86019342-86019364 ATCTTAAATGTCTCTAGAAAAGG + Intronic
977079897 4:92511904-92511926 AAATAAAAAGTCTCTAGAGAGGG - Intronic
977451075 4:97198765-97198787 GAGTAATATGTCTCTAGACACGG + Intronic
978207625 4:106097422-106097444 AGCATGAATGTCTGTAGACATGG + Intronic
978271754 4:106899469-106899491 AAAAAAAATGTGTAGAGACAGGG + Intergenic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
980238824 4:130146001-130146023 AAGAAAAAAGACTTTAGACATGG + Intergenic
980457412 4:133063371-133063393 GACAAAATTGTCTCTTTACAAGG + Intergenic
980677596 4:136109331-136109353 AACAATAATTTTTCTAAACATGG - Intergenic
981027063 4:140087334-140087356 GACAAAAATGTCTTTAGAATGGG - Intronic
981209128 4:142080819-142080841 AACAGAAATGTCACTATAGATGG - Intronic
981742017 4:148012566-148012588 AACCGAAATGTTTCTAAACAAGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983754427 4:171317169-171317191 AAAAAAAATGTTTTTAAACAAGG + Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984732607 4:183082406-183082428 AACAACAATATCTTTAGAAAGGG + Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
985175652 4:187196904-187196926 AAAAAAAAATTCTGTAGACATGG + Intergenic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
986959277 5:13193314-13193336 AACATAAATCTCTCTATAAATGG - Intergenic
987143092 5:14965220-14965242 AACTAATATGTGTCTTGACATGG + Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987459326 5:18189111-18189133 AATAAAAATGCCTTGAGACAAGG - Intergenic
988153367 5:27416299-27416321 AACAATCATGTCACTAGGCAAGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990364310 5:55054254-55054276 GACAGAAATGTTTCTAGCCAGGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991450086 5:66742440-66742462 AATAAAATTGTTTATAGACATGG + Intronic
991581366 5:68158563-68158585 AAAAAAAATGTTTTTAGAGAAGG - Intergenic
991699201 5:69301455-69301477 AAAAAAAATTTTTGTAGACATGG - Intronic
992355266 5:75975417-75975439 ATAAAATATGTCTATAGACATGG - Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993509202 5:88750376-88750398 AAAAAAAATGTTTGTAGAGATGG + Intronic
993976702 5:94491648-94491670 AACAATAATGCCTCAAGAAAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
996759839 5:126976178-126976200 AACAAAAATGTATCTTAACTGGG - Intronic
997054908 5:130430546-130430568 AAAAAAAATGAATCTAGACACGG + Intergenic
997433980 5:133860741-133860763 AACAAAAATTTGTATAGGCAAGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998248982 5:140536616-140536638 AACAAAAAGGGCTGTAGAAAGGG + Intronic
998323578 5:141257067-141257089 AACAAAAAGGAGTCTAGAAAAGG - Intergenic
998611569 5:143694844-143694866 AACAAAAATGTTTCTTAAAAGGG - Intergenic
999849811 5:155525740-155525762 TACAAAAAATTATCTAGACATGG + Intergenic
1000846157 5:166282851-166282873 TGGAGAAATGTCTCTAGACATGG + Intergenic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002002483 5:176205533-176205555 TACAAAAAAGTCTTTTGACAGGG + Intergenic
1002224118 5:177706079-177706101 TACAAAAAAGTCTTTTGACAGGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004781767 6:18916343-18916365 AAAAAAGATGTCTGTGGACAAGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1006970506 6:38039413-38039435 AACACAAATGTGTATAGAAAAGG - Intronic
1007130571 6:39469538-39469560 AAAAAAAATGTTACTAGAGATGG + Intronic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007753895 6:44086389-44086411 AAAAAAAATGTTTTTAGAGATGG - Intergenic
1008916473 6:56792911-56792933 TACAAAAATGTAGCTAGGCATGG + Intronic
1009015037 6:57890036-57890058 AATAAAAATGTCACTGGAGAAGG + Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009192636 6:60648024-60648046 AACAAAATTGTCTTTGGTCAAGG - Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009417282 6:63429744-63429766 AAAAAAAAAGTCTGAAGACAGGG + Intergenic
1009420990 6:63464868-63464890 AACAAAAAAGTAGCTAGGCATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1009733915 6:67649807-67649829 AACTAAAATTTTTCTAGAAATGG + Intergenic
1012248565 6:96954707-96954729 AATAAAAGTATCTCTAGACTGGG - Intronic
1012332217 6:98006853-98006875 AACAAAACTGTCTTTGGTCACGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013321337 6:108992815-108992837 TATAAAGATTTCTCTAGACATGG - Exonic
1013425414 6:110008266-110008288 AACAAAAGGGTCTCATGACAAGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1013975480 6:116073343-116073365 AATAAATATTTCTCTAGTCAAGG - Intergenic
1014164999 6:118214184-118214206 AACAAAAATGTATTTAAAAATGG + Intronic
1015291710 6:131545065-131545087 AACAAAAATTTGTGTAGAGAAGG + Intergenic
1016382269 6:143497131-143497153 AAAAAAAATTTTTGTAGACAGGG + Intronic
1016431876 6:143993597-143993619 AACTAAATTGTCTCAGGACAAGG + Intronic
1017556851 6:155581209-155581231 AACAAATATGTTTAAAGACATGG + Intergenic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1018572229 6:165223822-165223844 AAAAAATATGTCTTTAGACATGG + Intergenic
1019796367 7:3052150-3052172 TACAAAAATGTCAGTATACAAGG + Intergenic
1019844521 7:3484277-3484299 AAAAAAAATGTGTGTATACATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1020728583 7:11849432-11849454 CTCTAAAATGTCTCTGGACACGG + Intergenic
1021024925 7:15653933-15653955 AACAAGAATTTCTGTAGACATGG - Intronic
1021518155 7:21508794-21508816 AAAAAAAAAGTGTGTAGACAAGG - Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022356322 7:29618001-29618023 AAAAAAACTGTATCTATACATGG + Intergenic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1022778025 7:33547767-33547789 AACAATAATGTTTCAAAACAAGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024757202 7:52548768-52548790 AACAAAAATGTTACTAAACAAGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025826718 7:65016709-65016731 AAAAAAAATTTCTGGAGACAAGG + Intergenic
1026318931 7:69252178-69252200 AACAAAAATTTCTGTAGAGATGG + Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027651277 7:80871997-80872019 AAATTAAAGGTCTCTAGACAGGG - Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028039682 7:86035318-86035340 AAAAAAATTGGCTATAGACAAGG + Intergenic
1028827483 7:95290147-95290169 AATGAAGATGTCTCTAGAGAAGG + Exonic
1029062426 7:97811984-97812006 CACAAAAATACCTCTAGAGAAGG + Intergenic
1029119711 7:98259184-98259206 AAAAAAAATGTATAAAGACAAGG + Intronic
1029253060 7:99250726-99250748 AACAAAACTGTCTCAAAAAAGGG + Intergenic
1029371196 7:100151873-100151895 AAAAAAAATGTGTGGAGACAGGG + Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030296460 7:107933679-107933701 GACAAAACTCTCTCTACACAAGG + Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030634553 7:111934042-111934064 AACAAAAATATCTATATTCAAGG + Intronic
1031965900 7:128028235-128028257 AAGAAAGATGTCTGTAGAAATGG + Exonic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033080655 7:138294040-138294062 AAAAAAAAGGCGTCTAGACATGG - Intergenic
1033133660 7:138767139-138767161 AACAATAATGTCTCATTACATGG - Intronic
1033167890 7:139057183-139057205 AAAAAAAATGTTTCTAGAGATGG - Intronic
1033493542 7:141869910-141869932 AACAAAACTGGCACAAGACAAGG + Intergenic
1033640659 7:143260862-143260884 AACAAAAATGTAGCTGGGCATGG + Intronic
1033822306 7:145149098-145149120 ATCTAAAATGACTCTAGAGAAGG - Intergenic
1035890836 8:3340993-3341015 ATCAAAAATGTCTGTAGAATTGG + Intronic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036574746 8:10016724-10016746 AATAAAAATGACTCTAAAAATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036945831 8:13094095-13094117 AACTGAAATTTCTGTAGACAAGG + Intronic
1037280880 8:17240571-17240593 AACAAAGGTGTTTCTAGAAAAGG + Intronic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038793597 8:30690892-30690914 AAAAAAAATTTTTGTAGACATGG - Intronic
1039121665 8:34154805-34154827 GACAAAAATGGTTTTAGACAGGG + Intergenic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1039226875 8:35397949-35397971 AAAAAGAATGGTTCTAGACAGGG - Intronic
1039449932 8:37664666-37664688 AAAAAAAATGTCACTACACGAGG - Intergenic
1040938498 8:52807318-52807340 AAAAAAAATTTCTGTAGAGATGG + Intergenic
1041537807 8:58947584-58947606 AATAAAAATCTCTCTATACTAGG + Intronic
1042261784 8:66867148-66867170 AAAAAAAATTTTTTTAGACACGG - Intergenic
1042312747 8:67394981-67395003 AACAAACATCTCTCTAGCCAAGG - Intergenic
1042568545 8:70137331-70137353 AACAAAAATGGAGCTAGACGCGG - Intronic
1043058940 8:75475536-75475558 AATGAAACTGTCTCTAGGCAAGG + Intronic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1044446261 8:92280328-92280350 AACAAACATTTGTCTAAACAAGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045772006 8:105753170-105753192 AACAAAAAAGTCACTTGTCATGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046051833 8:109032783-109032805 AACAAAAATTTTTCTACAAAGGG + Intergenic
1046581198 8:116094568-116094590 AACAAAGATGTCTAGTGACATGG + Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1046805402 8:118474254-118474276 AATAAAAATAGCTCTAGACTAGG - Intronic
1047020546 8:120770908-120770930 AATTAAAATGTCTGTAAACATGG - Intronic
1047048367 8:121080335-121080357 AATACAAATGTCTTTTGACATGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047815668 8:128459883-128459905 TACAAAAATTTATCTAGGCATGG + Intergenic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050505085 9:6339932-6339954 AACAAAACTGGCACAAGACAGGG + Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050672506 9:8013402-8013424 AACAAAACTGCCTCTGGACCAGG + Intergenic
1052130665 9:24842655-24842677 AAGAAAAATGAATCTAGACACGG - Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1053217025 9:36280069-36280091 AATAAAAATGTCTCTGGGCATGG - Intronic
1054680920 9:67916806-67916828 AAAAAAAAAGTTTGTAGACATGG + Intergenic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1054937625 9:70705459-70705481 AACAAAATTATTTGTAGACATGG + Intronic
1054939316 9:70723452-70723474 AACAAAATTATTTGTAGACATGG + Intronic
1055075163 9:72206837-72206859 AACAAAAATGAATGAAGACAGGG - Intronic
1055357864 9:75455937-75455959 AACAGAAATACCTCTAGACTTGG - Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055519891 9:77070366-77070388 AATAAAAGTCTGTCTAGACATGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1055985150 9:82051139-82051161 CACAAAAATGTCTTTAAGCATGG + Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1058838606 9:108882763-108882785 TAAAAAAATGTTTTTAGACAGGG + Intronic
1059689483 9:116670987-116671009 AAAAAAAATGTATCTGCACAAGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060276936 9:122189589-122189611 AAAAAAAATTTTTATAGACAGGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185516830 X:706280-706302 AAAAAAAATTTTTGTAGACATGG + Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1186631932 X:11358935-11358957 CATTAAAATGTTTCTAGACATGG - Intronic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1186748288 X:12593422-12593444 AATAAAAATGTCTTTACACCTGG - Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187886971 X:23898060-23898082 AAAAAAAATCTACCTAGACATGG + Intronic
1188763161 X:34057186-34057208 GACAAAAATGTGTCTTGGCAGGG - Intergenic
1188794905 X:34451088-34451110 AATAAAACTGTCTCTATACATGG + Intergenic
1188877405 X:35447072-35447094 AAAATAATTGTCTCTAGAAATGG + Intergenic
1188993548 X:36853755-36853777 GAAAAAAATGACTCTAGACATGG - Intergenic
1189022738 X:37358425-37358447 AAAAAAAATGAATCTAGATATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189327920 X:40124261-40124283 AAAAAAAATGTATATAGAGATGG - Intronic
1189903286 X:45730695-45730717 AACAAAAGTGGCTCTAAACCCGG + Intergenic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1190995817 X:55607371-55607393 AACGAAAAAGCCTCTAGAAAGGG - Intergenic
1191067762 X:56368181-56368203 AAAAAAAATGTCTCTGGACTAGG - Intergenic
1192570418 X:72199237-72199259 AAAAACAATGTCTCTAGGCTGGG + Intronic
1193596335 X:83451050-83451072 AACAAAAAAGGCAGTAGACAGGG - Intergenic
1193624920 X:83806578-83806600 AGCAAAAATCTCTTTTGACAAGG + Intergenic
1193648836 X:84104559-84104581 AACAAAAATGTTTCTCGGAACGG - Exonic
1194164231 X:90495104-90495126 AAATAAAAAGTCTGTAGACAAGG - Intergenic
1194498486 X:94649685-94649707 GATAAAAATGTGGCTAGACATGG + Intergenic
1194775197 X:97954576-97954598 ATCAGTAATGTCTCTAGCCATGG + Intergenic
1194889596 X:99362235-99362257 TACAAAAATGTTTCTGGAGAAGG + Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198735284 X:139778025-139778047 AAAAAAAATTTCTGTAGAGATGG + Intronic
1198990114 X:142503686-142503708 AATAAAAAAGACTTTAGACAAGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199516677 X:148685066-148685088 TACAGAAATGTCTATAGTCAGGG - Intronic
1199749778 X:150804454-150804476 AACAAAGATCTCTCCAGGCACGG + Intronic
1200112369 X:153747746-153747768 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1200510492 Y:4072914-4072936 AAATAAAAAGTCTGTAGACAAGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic