ID: 1168426574

View in Genome Browser
Species Human (GRCh38)
Location 19:56244106-56244128
Sequence GGGGAAGCCACAGACTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168426574_1168426581 6 Left 1168426574 19:56244106-56244128 CCGCCACAGTCTGTGGCTTCCCC 0: 1
1: 0
2: 2
3: 25
4: 298
Right 1168426581 19:56244135-56244157 TCAACTTGGAAATCATGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1168426574_1168426576 -8 Left 1168426574 19:56244106-56244128 CCGCCACAGTCTGTGGCTTCCCC 0: 1
1: 0
2: 2
3: 25
4: 298
Right 1168426576 19:56244121-56244143 GCTTCCCCAGAAACTCAACTTGG 0: 1
1: 1
2: 1
3: 10
4: 164
1168426574_1168426580 5 Left 1168426574 19:56244106-56244128 CCGCCACAGTCTGTGGCTTCCCC 0: 1
1: 0
2: 2
3: 25
4: 298
Right 1168426580 19:56244134-56244156 CTCAACTTGGAAATCATGACTGG 0: 1
1: 1
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168426574 Original CRISPR GGGGAAGCCACAGACTGTGG CGG (reversed) Intronic
900367291 1:2316395-2316417 GGCGGCGCCACAGACTGAGGAGG + Intergenic
900475670 1:2875312-2875334 GGGCAAACCACATACTGTGGGGG + Intergenic
900782131 1:4625136-4625158 GGAGATGCCACTCACTGTGGAGG - Intergenic
901148210 1:7082576-7082598 GGGGAGGCACCAAACTGTGGAGG - Intronic
901404660 1:9038225-9038247 TGGGAACACACAGACTGTGCAGG - Intronic
901807643 1:11748357-11748379 GGGGGAGCCACGGAGCGTGGTGG + Intronic
902334390 1:15746773-15746795 GGGGAAGGCTCATCCTGTGGAGG + Intronic
903232365 1:21929743-21929765 GCTGAAGCCAAAGACTGTGGAGG + Intronic
904434163 1:30483413-30483435 GGGGAGGCCACAGTCTCTGCAGG + Intergenic
904480051 1:30787887-30787909 GTGGAAGCCAGAGACTGCGTGGG - Intergenic
904948225 1:34214789-34214811 GGGAAAGCCAGAGACAGTGGAGG + Intronic
905663238 1:39744782-39744804 GGGGACTCCACTGACTGTGATGG - Intronic
906054150 1:42901524-42901546 GTGGTAGCTACAGACTGTGTTGG + Intergenic
906072134 1:43024776-43024798 GGGGAAGCCTCTGGCTGTGGTGG + Intergenic
906639736 1:47434494-47434516 CGGGAAGCCACAGGCTCTGCGGG - Intergenic
906707337 1:47904297-47904319 GGGGGAAGCACAGAGTGTGGTGG + Intronic
907333571 1:53686559-53686581 GGGAAGCTCACAGACTGTGGGGG + Intronic
910260696 1:85290949-85290971 TAGGAAGCCACAGACTGTTTGGG + Intergenic
911174273 1:94803694-94803716 GGGTAAACCACAGACAGTGCTGG - Intergenic
911401930 1:97386042-97386064 GGGGCAGCCTCTGACTGGGGAGG + Intronic
912578734 1:110701054-110701076 GGGCAAGAGACAGACTGAGGAGG + Intergenic
913349569 1:117842659-117842681 GGGGAAGCCGCAGTATGGGGAGG - Intergenic
915067733 1:153240452-153240474 GGGGTGCACACAGACTGTGGTGG - Intergenic
916051228 1:161038441-161038463 GGGGAAGGCACTGATTATGGGGG - Intronic
919135740 1:193506128-193506150 GGGGAGGACACAGCCTTTGGAGG - Intergenic
919911633 1:202114621-202114643 GGGGAAGTCACAGCGTGGGGAGG + Intergenic
919994001 1:202730864-202730886 GGGCAAGGCACAGTCTGGGGTGG - Intronic
920676722 1:208043234-208043256 GGGGAAGCCCCAGTCGGGGGAGG + Intronic
922566588 1:226605390-226605412 GTGGACGGCACAGGCTGTGGGGG - Exonic
922808971 1:228405674-228405696 GGGAAAGCCCCAGACTGGGCAGG - Intronic
923545164 1:234918550-234918572 GAGGAGGCCACAGAGGGTGGGGG + Intergenic
924160646 1:241228105-241228127 GGGGAAGCCACTGACCATGGAGG + Intronic
1063253165 10:4296266-4296288 GCGGAAACCAAAGACTGTGGAGG - Intergenic
1063288728 10:4718057-4718079 AGGGAAGTAACAGAGTGTGGAGG + Intergenic
1064352069 10:14585463-14585485 GGTGAAGCCACGGACCCTGGGGG + Intronic
1065389021 10:25163330-25163352 AATGAAGCCACAGACTGTGGCGG + Intergenic
1067666951 10:48287259-48287281 GGGGAAGAAACAGACTGTTTGGG - Intergenic
1067726761 10:48776450-48776472 GGGCAAGCCAGAGACAGAGGTGG + Intronic
1068655265 10:59567985-59568007 GGGGAAGGCAAAAACTGTAGAGG - Intergenic
1069631072 10:69897344-69897366 GGGGAAGCCACAGGCTGGAATGG - Intronic
1070352324 10:75604938-75604960 GGGGCATACACAGACTGCGGTGG - Intronic
1071983981 10:91032378-91032400 GTGGAAGCTACAAGCTGTGGAGG - Intergenic
1072936266 10:99716612-99716634 GTGGAAGAGACAGCCTGTGGAGG - Intronic
1073618872 10:105026304-105026326 GGGGAACCCACAGAGTGGAGCGG - Intronic
1074469061 10:113710664-113710686 TGGGAAGCGACAAACTCTGGAGG + Intronic
1075727780 10:124619368-124619390 GTGCAAGCCACAGCCTGTGCGGG + Exonic
1076239003 10:128888133-128888155 TGGGAAGCCACAGCCTGAAGGGG + Intergenic
1077486125 11:2839149-2839171 GGGGAAGCCCCAGGCTGGGATGG - Intronic
1081204062 11:40254355-40254377 GGTGATGCCATAGATTGTGGAGG + Intronic
1083490478 11:63011808-63011830 TGGGGAGCCAGTGACTGTGGTGG - Intronic
1084205143 11:67586746-67586768 CAGGAAGCCACTGACTGTGCTGG - Intergenic
1084288847 11:68148770-68148792 GGTGCACCCACAGACTGTTGAGG + Intergenic
1085197568 11:74681786-74681808 GGGGCAGCCACAGCCTTAGGTGG - Intergenic
1085348791 11:75785059-75785081 GGGAAAGGCACAGGCTTTGGGGG - Intronic
1086639079 11:89128585-89128607 AGAGTTGCCACAGACTGTGGAGG + Intergenic
1086914988 11:92519580-92519602 TGAAAAGCCACAGACTGGGGGGG + Intronic
1087319738 11:96643538-96643560 AGTGAAGCCACAGACTCTTGTGG - Intergenic
1087968405 11:104448803-104448825 GGAAAAGCCTTAGACTGTGGTGG + Intergenic
1089220662 11:116868684-116868706 GGGGAACCAACATTCTGTGGAGG + Intronic
1094272067 12:28628028-28628050 GGAGAAGCCACTGAGTGTGAAGG + Intergenic
1094303840 12:28995779-28995801 GCGGAAGCCACTGGCTGGGGAGG + Intergenic
1096194019 12:49637405-49637427 GGCAGAGCCACAGACTGAGGGGG - Exonic
1096463446 12:51835413-51835435 GGGGAAGGAACATAGTGTGGCGG + Intergenic
1096541238 12:52308473-52308495 GGGGACGCTACTGACTCTGGTGG - Exonic
1102490160 12:113285793-113285815 AGGGAGGCTGCAGACTGTGGAGG + Intronic
1102901992 12:116646150-116646172 GGGGAAGGGAAAGGCTGTGGTGG + Intergenic
1103469110 12:121165827-121165849 ATGGAAGCCACAGTCTTTGGGGG + Intronic
1105064644 12:133185742-133185764 GGGGAAGCCAGAGACTGACTAGG + Intronic
1106185726 13:27408229-27408251 GAGGACGCCACACACTGTGCAGG + Intergenic
1106433825 13:29706740-29706762 GAGAAAGCCAAACACTGTGGTGG - Intergenic
1108273996 13:48789613-48789635 GGGGATTGCACAGACTGTGGGGG + Intergenic
1113670358 13:112171682-112171704 GGGGAAGCCACAGAGGATAGTGG + Intergenic
1113933350 13:113980310-113980332 GGAGAAGGCACAGACGGAGGAGG - Intronic
1115036009 14:28857637-28857659 CAGGAAGACACAGACAGTGGTGG - Intergenic
1119163372 14:72471667-72471689 GAGAAAGGCAGAGACTGTGGGGG - Intronic
1119767296 14:77198327-77198349 AGAGAGGCCACACACTGTGGAGG + Intronic
1120658695 14:87227569-87227591 GGGGAAGCAAGAGAGAGTGGGGG + Intergenic
1121050721 14:90817140-90817162 GGGGAAGGCACAGTCACTGGTGG + Intergenic
1121966752 14:98314238-98314260 AGGCAAGCCACAGACTAAGGGGG - Intergenic
1122286455 14:100655356-100655378 TGGGAAGCCACGGACAGGGGGGG - Intergenic
1122480029 14:102041237-102041259 GAGGAAGTGTCAGACTGTGGAGG + Intronic
1122650220 14:103221839-103221861 AGGCAGGCCACAGACTGGGGGGG + Intergenic
1123133444 14:106006842-106006864 AGGGAAGCCACAGTGTGTGCAGG - Intergenic
1123165186 14:106319520-106319542 AGGGAAGCCACAGTGTGTGCAGG - Intergenic
1123166436 14:106329631-106329653 GGGGAATCCAGAGACAGTGCAGG + Intergenic
1123169118 14:106354663-106354685 GGGGAATCCAGAGACAGTGCAGG + Intergenic
1123192672 14:106586216-106586238 GAGGAAGCCACAGACCCTGAAGG + Intergenic
1123495244 15:20817123-20817145 GGCGGAGCCGCAGGCTGTGGCGG + Intergenic
1123551733 15:21386216-21386238 GGCGGAGCCGCAGGCTGTGGCGG + Intergenic
1123583468 15:21737289-21737311 AGGGAAGCCACAGTGTGTGCAGG - Intergenic
1123620118 15:22179892-22179914 AGGGAAGCCACAGTGTGTGCAGG - Intergenic
1124614291 15:31230472-31230494 GGCCAGGCCACAGACTGTGCGGG - Intergenic
1126776491 15:52104821-52104843 GGAGAAGGCACAGCGTGTGGTGG + Intergenic
1126928731 15:53622595-53622617 GGGGAAAACACACACAGTGGGGG + Intronic
1128998688 15:72315914-72315936 GAGGAAGGCACAGCCTGAGGAGG + Exonic
1129606167 15:77026040-77026062 GGGTCAGACACAGACTGGGGTGG + Intronic
1130996416 15:88906982-88907004 GAGGAGGCCCCAGGCTGTGGAGG - Intronic
1131328012 15:91467803-91467825 GGGAAAGGCACAGATTGTTGAGG - Intergenic
1132396455 15:101478517-101478539 GGGGAAGCCACAGAAGAGGGAGG - Intronic
1202960078 15_KI270727v1_random:113458-113480 GGCGGAGCCGCAGGCTGTGGCGG + Intergenic
1132884154 16:2175194-2175216 GGGGCACCTACAGACTGGGGCGG - Intronic
1133982012 16:10640008-10640030 GGGGAAGAGAAAGACTGAGGAGG - Intronic
1133988778 16:10688887-10688909 GGGGAAGCCACAGGCTAAGAGGG + Intronic
1135425098 16:22328513-22328535 GGGGAAGCAGCAGTCTGGGGGGG - Exonic
1136615669 16:31397250-31397272 GGGGAAGCGAGACTCTGTGGGGG - Intronic
1139269159 16:65665894-65665916 GGTGCAGCCAGAGACAGTGGTGG + Intergenic
1139435165 16:66932716-66932738 GGGGAAGCCTCAGACTGCTTAGG + Intronic
1141340380 16:83198625-83198647 GAGGAAGCCACAGAGTGGGATGG - Intronic
1142352674 16:89587192-89587214 GGCGGGGCCACAGACTGAGGGGG - Intronic
1142352701 16:89587253-89587275 GGCGGGGCCACAGACTGAGGGGG - Intronic
1142352714 16:89587284-89587306 GGCGGGGCCACAGACTGAGGGGG - Intronic
1142377068 16:89711774-89711796 GGCGGAGCCAGAGGCTGTGGGGG - Intronic
1142414269 16:89932945-89932967 GGGCAGGCCAGAGACTTTGGAGG + Intronic
1143400379 17:6639197-6639219 GGGGAGGGGACAGGCTGTGGGGG - Intronic
1143706153 17:8698922-8698944 GGGGAAGACACAGACAGCAGCGG + Intergenic
1145229781 17:21165218-21165240 GGACAAGGCACTGACTGTGGTGG - Intronic
1145258634 17:21341723-21341745 GAGGAAGCCACAGACACTGTGGG + Intergenic
1145317992 17:21746282-21746304 GAGGAAGCCACAGACACTGTGGG - Intergenic
1145987634 17:29057805-29057827 GGGGGAGTCACAGAGTGGGGAGG + Intergenic
1146040323 17:29447198-29447220 GGGGAAGCCAGACATGGTGGTGG - Intronic
1147119390 17:38326994-38327016 GGGGAAGGCACAGGCTCAGGAGG - Exonic
1147452200 17:40512582-40512604 AGGGAAGCCACGGATTGGGGTGG + Intergenic
1148548211 17:48532693-48532715 GGGCAAGACACAGACTGCAGGGG - Intergenic
1149638073 17:58186095-58186117 TGGGAAGGACCAGACTGTGGAGG + Intergenic
1150417802 17:65001597-65001619 GGGGAAGAAACAGACTTGGGTGG - Intergenic
1150706520 17:67491929-67491951 GGAGAAGCCAAAAACTGTGCTGG + Intronic
1151337909 17:73450947-73450969 AGGGAAGCCTGAGACTGAGGTGG - Intronic
1152210895 17:79002633-79002655 GTGGTCGCAACAGACTGTGGAGG + Intronic
1152236178 17:79140047-79140069 GGGGAAGCCACAGGGCGGGGTGG - Intronic
1152595613 17:81236292-81236314 GGGGAACCCACAGCCTGGGAAGG + Intronic
1152727762 17:81956031-81956053 AAGGAAGCCACATTCTGTGGGGG - Intronic
1152921327 17:83067969-83067991 GGGAGAGCCACAGGCTGTGCAGG + Intergenic
1156519135 18:37706557-37706579 GGGGAACCCACAGACTGGCTGGG + Intergenic
1157257727 18:46153386-46153408 GAGGAGGCCACAGGCAGTGGAGG + Intergenic
1160864918 19:1252242-1252264 GGGGAAGCCACAGCGGCTGGAGG - Intronic
1162094340 19:8301857-8301879 GAGGAAGCCACAGTGGGTGGGGG + Intronic
1163454669 19:17399426-17399448 AGGAAATCCACAGAATGTGGAGG + Intergenic
1165361124 19:35337699-35337721 GGGGAATCCTCAGAGGGTGGAGG - Intronic
1165812129 19:38617997-38618019 GGGGAGGCCACAGCCCGCGGAGG - Intronic
1166313222 19:41975015-41975037 GGGGAAGCCAGGGACCCTGGGGG - Intronic
1166839153 19:45685851-45685873 GGTGAAGCCACAGGCTCTGGAGG + Intergenic
1167740735 19:51323605-51323627 GGGGAAGCCTCAGGCTGGGTGGG + Intronic
1168421320 19:56205977-56205999 GGGGATGGCATGGACTGTGGTGG - Exonic
1168426574 19:56244106-56244128 GGGGAAGCCACAGACTGTGGCGG - Intronic
926054732 2:9767951-9767973 GGGGGAGCCACAGACCAGGGAGG - Intergenic
926657751 2:15427326-15427348 TGGGAAGCCTCAGAATGTGTAGG - Intronic
928366246 2:30705717-30705739 GGGGAAGCCACAGCCTCAGGCGG - Intergenic
928366573 2:30707579-30707601 GGGGGAGGCACAGGATGTGGAGG - Intergenic
929453599 2:42051666-42051688 AGGGAAGCCCCAGACCCTGGTGG - Intronic
929528684 2:42731420-42731442 GGGGAAGTCTCAGAATCTGGTGG + Intronic
930280442 2:49362748-49362770 GTGGAAGCCCCAGGCTGTGGTGG - Intergenic
930724915 2:54673594-54673616 GGGGAAGCCACAGGCCTTGTGGG - Intergenic
930868297 2:56143704-56143726 GGGAAAGCTAAAGCCTGTGGGGG - Intergenic
930906569 2:56575930-56575952 AGGGAAGCAATAGGCTGTGGCGG - Intergenic
931012070 2:57929010-57929032 GGGCAAGACACAGACCATGGTGG - Intronic
931163478 2:59719527-59719549 GGGGAAGCCATAGAAAGTTGGGG + Intergenic
931900519 2:66783169-66783191 GGGGAAACCTCAGACTGGGGAGG + Intergenic
931941192 2:67253850-67253872 GAGGAAGCCACAGAGTGTGCAGG - Intergenic
932792901 2:74671400-74671422 GGGGAAGCAGCAGAGAGTGGGGG - Intronic
933719997 2:85391629-85391651 GAGGAAGCCCCAGCTTGTGGGGG - Exonic
934512807 2:94960873-94960895 GAGGAAGCCACAGACCCTGAAGG + Intergenic
935037870 2:99396541-99396563 TGGGAAGCAACAGAATGGGGAGG + Intronic
935097521 2:99959864-99959886 GGGGAAGCCATAGGCTATGCTGG - Intronic
936868988 2:117110222-117110244 GGGGAAGCTGCAGTATGTGGAGG + Intergenic
937059529 2:118971029-118971051 GGGGAGGCCACAGCCTCTGGAGG - Intronic
937866864 2:126759055-126759077 GAGGAACTCACAGACAGTGGGGG + Intergenic
938222923 2:129587300-129587322 GGGAAAGAGACAGTCTGTGGCGG + Intergenic
938563455 2:132495409-132495431 TTGGAAGCCCCAAACTGTGGGGG + Intronic
938594518 2:132774280-132774302 GTGGAAGTCACTGACTCTGGAGG - Intronic
938671837 2:133594235-133594257 GAGTCAGCCACACACTGTGGTGG - Intergenic
938923232 2:136014691-136014713 GGGGAAGCAGCAGAGTGGGGAGG - Intergenic
939113444 2:138033949-138033971 GGGGATGTCACTGGCTGTGGAGG + Intergenic
939424658 2:142019539-142019561 TGGGAAGCAATAGAGTGTGGTGG - Intronic
939577762 2:143916662-143916684 GGGGAAGTCTAAGACTGAGGTGG + Intergenic
942318632 2:174716883-174716905 GGGGAAGTTACAGACAGGGGTGG + Intergenic
948022614 2:234748435-234748457 GGTGAAGGTCCAGACTGTGGTGG + Intergenic
948213123 2:236209632-236209654 ATGGAAACCACAGGCTGTGGTGG - Intronic
948749300 2:240121620-240121642 AGTGAAGGAACAGACTGTGGTGG - Intergenic
1169306422 20:4494900-4494922 GGGGAAGGGAGAGGCTGTGGAGG - Intergenic
1169711558 20:8570308-8570330 GTGGAAGCCACAGACTTAGAGGG - Intronic
1170114194 20:12839130-12839152 TGGGCAGGCACAGACTCTGGAGG - Intergenic
1171297602 20:24032386-24032408 CGGGAAGACACAGGCTTTGGTGG - Intergenic
1171446030 20:25205574-25205596 TGGGAAGCCCCCGAGTGTGGTGG + Intronic
1171486555 20:25490181-25490203 GGGGTAGCCACAGTCTGGGTGGG - Intronic
1171499404 20:25581737-25581759 GGGGAAGCTACAGACACTGTTGG + Intronic
1172115802 20:32572807-32572829 AGGGAAGCCAGAGCCTGTGCAGG - Intronic
1172196501 20:33095330-33095352 GGGGAAGACACAGAGGGTTGAGG + Intronic
1172197068 20:33099277-33099299 TGCCAAGCCACAGAGTGTGGGGG + Intronic
1172250845 20:33478061-33478083 GGAGCAGCCACAGGCTGAGGTGG - Intergenic
1172445830 20:34993016-34993038 GGGGAAGTCAGGGACTGAGGAGG - Intronic
1173927196 20:46789630-46789652 GGGGCAGCCACAGACTGTGTAGG - Intergenic
1175183589 20:57165271-57165293 CGGGAAGCCACAGCATGTAGGGG - Intergenic
1175377415 20:58538271-58538293 GGAGAAGCCACAGAATGGGGTGG - Intergenic
1175471634 20:59234081-59234103 GGGGTAGCCACAGAACGTAGAGG + Intronic
1175895300 20:62333307-62333329 GGGGAAGCCAGGCACAGTGGGGG + Intronic
1176140737 20:63543634-63543656 TGGGCAGCCACAGGCTGGGGCGG + Intronic
1179586077 21:42375117-42375139 GGGGAAACCTGAGACGGTGGAGG - Intronic
1179902557 21:44401605-44401627 GGGGTGGCCAAAGCCTGTGGAGG + Intronic
1181447852 22:22992412-22992434 GTGGAAGCCCAAGGCTGTGGAGG + Intergenic
1181513071 22:23397468-23397490 TGGGAACCCACAGGCTGTGTCGG + Intergenic
1182833157 22:33320200-33320222 GATGAGGCCACAGAGTGTGGGGG - Intronic
1183225871 22:36549479-36549501 AGGGAAGCAACAAGCTGTGGGGG + Intergenic
1183263398 22:36810853-36810875 GGCTAAGCCACAGGCTGTAGGGG - Intronic
1183489576 22:38109318-38109340 TGAGAAGCCCCAGACTTTGGGGG + Intronic
1183853760 22:40614920-40614942 AGGTAAGCCACAGACTTGGGAGG - Intronic
1183865077 22:40697972-40697994 GAGGAAGGCAGAGACTGTGAGGG + Intergenic
1184388958 22:44192207-44192229 GAGAAAGCCACAGAATGTGAGGG - Intronic
1184476551 22:44725168-44725190 GGGGGACCCACGGACTGGGGTGG - Intronic
1184836177 22:47022454-47022476 GGGGAAGCCACGGCATCTGGGGG + Intronic
1184997791 22:48223163-48223185 GGGGAGGCCACAGATTGAGCTGG + Intergenic
950304595 3:11908210-11908232 GGGGAAGCCACAGAGTCACGGGG - Intergenic
951844725 3:27073083-27073105 GGGGAGGTCACAGACTGCAGAGG - Intergenic
953886215 3:46715684-46715706 GGAAAAGCCACAGGCTGAGGAGG + Exonic
954292095 3:49655127-49655149 CAGGAAGCCACACACAGTGGTGG + Exonic
955272962 3:57520047-57520069 GGGAAAGCCGGAGGCTGTGGCGG + Intronic
958593319 3:96189073-96189095 GGGTAATCCTCAGAATGTGGTGG + Intergenic
960603667 3:119482885-119482907 GGGGTAGCACCAGGCTGTGGTGG + Intronic
960937189 3:122911490-122911512 GAGGAGGCCACCGACTGTGCAGG - Exonic
961792309 3:129384961-129384983 CGCGATGCCACAGTCTGTGGCGG - Intergenic
961806327 3:129491858-129491880 CGTGATGCCACAGTCTGTGGCGG - Intronic
962386611 3:134937318-134937340 GGAGAACACACAGAATGTGGTGG + Intronic
962983047 3:140508053-140508075 ATGGAAGCCACAGACTGGTGAGG + Intronic
967234900 3:187374563-187374585 GAAGAAGCCACAGACTGAGAAGG - Intergenic
967931134 3:194691100-194691122 GGGGAGGGCACAGACGGAGGAGG - Intergenic
969461736 4:7332671-7332693 GGGGAAGTCACACCCTGTGCAGG + Intronic
969930574 4:10627206-10627228 GGAGTAGCTACAGACTGTGGAGG + Intronic
969939299 4:10714133-10714155 GTGGAAGCCACAGCCTGGGAAGG - Intergenic
970962159 4:21884825-21884847 AGGGAAGGCAGTGACTGTGGTGG - Intronic
972635773 4:40882773-40882795 CGGGAAGCAACAGGCCGTGGGGG + Intronic
973729899 4:53813193-53813215 AGGGAAGCCACACATTGAGGAGG - Intronic
974806096 4:66882752-66882774 GTGCAAGACACAGACTTTGGTGG + Intergenic
975369747 4:73570981-73571003 GGGGAAGCCACAGATTATGGTGG + Intergenic
975439917 4:74399145-74399167 CGGGAACCCACAGAGGGTGGGGG + Intergenic
975826037 4:78320395-78320417 AGGGACCCCACAGACTCTGGTGG + Intronic
976556974 4:86461324-86461346 GGGGAAGGCACAGGGTCTGGAGG + Intronic
978955552 4:114608212-114608234 TGGGAAGCCACAGTCTGAGGTGG - Intronic
979197877 4:117941792-117941814 GAGGCAGCCACAGCCTGTGCTGG + Intergenic
979777608 4:124610562-124610584 GGAGAAGACACAGTCAGTGGAGG - Intergenic
981210571 4:142098986-142099008 GGAGAAATCACAGAGTGTGGTGG + Intronic
985669939 5:1201970-1201992 GGAGAAGCCGCAGGGTGTGGGGG + Intronic
985726676 5:1519902-1519924 AGGGCAGCCACACCCTGTGGAGG - Intronic
986559473 5:9046374-9046396 GGGGAGGAGACAGACTGGGGTGG - Intronic
986720377 5:10556810-10556832 GGGGAAGCCAGGGATGGTGGGGG + Intergenic
986722659 5:10571101-10571123 GGCAAAGTCACAGACTATGGGGG - Intronic
990994633 5:61719372-61719394 GCTGAAGCCACAGACTTTGTGGG + Intronic
995376938 5:111484358-111484380 GGAGAAGCTGAAGACTGTGGAGG + Exonic
996230243 5:121054432-121054454 GGAGAAGCCACAAACTTTGTCGG - Intergenic
996709947 5:126534398-126534420 GGGGAAACCACATAGTCTGGGGG - Intergenic
997351133 5:133232289-133232311 GGGGAAGTCCCAGAAGGTGGTGG + Intronic
997569956 5:134919182-134919204 GGGCAAGACAAAGACTGTTGAGG - Intronic
997689048 5:135813220-135813242 GGGGAAGCCACAGGCTAAGAGGG + Intergenic
998006606 5:138661385-138661407 TGGGAGGCCACAGACTGGGCTGG + Intronic
1006212768 6:32411546-32411568 GGGAGAGCCAGAGAGTGTGGAGG + Intergenic
1007872587 6:45057808-45057830 GGGAAAGCCACAGTGTGAGGGGG + Intronic
1009240527 6:61180670-61180692 GGGGAAGCGCCAGTCTGTGGAGG - Intergenic
1011032327 6:82937288-82937310 GGGGAAACAACAGCCTGGGGAGG - Intronic
1011898696 6:92264518-92264540 GGAGAAGCCAGAGAGGGTGGAGG - Intergenic
1014958547 6:127652989-127653011 GGGGAGGCCTCAGAATCTGGTGG - Intergenic
1015758487 6:136632168-136632190 GGGGAAGCTACAGCCAGAGGGGG + Intronic
1018827662 6:167421769-167421791 TGGGGAGCCGCAGGCTGTGGGGG - Intergenic
1018928329 6:168222531-168222553 GGGTAAGCCCCAGCCTGAGGGGG - Intergenic
1019506419 7:1393723-1393745 GAGGAAGCCAGAGACAGTGGAGG + Intergenic
1019508149 7:1403764-1403786 GAGGAAGCCACAGGCGGTTGTGG + Intergenic
1019983308 7:4637683-4637705 GGGGTAGCCACACCCTCTGGCGG - Intergenic
1020059943 7:5144367-5144389 GGGGACGCCACAGGTAGTGGTGG - Intergenic
1020194618 7:6027301-6027323 GGGGGAGCCACAGAAGGTCGCGG + Intronic
1020257133 7:6508623-6508645 GGGTAAGCCTCAGGCTGTGAGGG + Intronic
1021258835 7:18428786-18428808 AGGGGAGCCACAGATTCTGGTGG - Intronic
1023051202 7:36252748-36252770 TGGTACGCCCCAGACTGTGGGGG + Intronic
1024116356 7:46197422-46197444 GCGGATGCCACTGACTGAGGAGG - Intergenic
1024252344 7:47515969-47515991 GGGGAAGCAGCAGAGCGTGGTGG - Intronic
1024883280 7:54113850-54113872 GGGGAATCCACAGGGTTTGGAGG - Intergenic
1026479236 7:70764167-70764189 GGGGAAAGCACAGTCTTTGGGGG + Intronic
1027237053 7:76304203-76304225 GGGGGAGGCACAGCCAGTGGCGG - Exonic
1032383115 7:131504219-131504241 GGGGAAGGGAAAGACTGGGGAGG - Exonic
1032462422 7:132122066-132122088 GGAGAAGCCACGGCCTCTGGAGG - Intergenic
1035245379 7:157559495-157559517 GGGGGGACCACAGACTGTGTGGG + Intronic
1035972859 8:4270819-4270841 GGGGAAGTCACGGAGTGTGGTGG - Intronic
1040988980 8:53328636-53328658 GGGGTAGACACACACTGTGGTGG + Intergenic
1042325416 8:67522792-67522814 GGTCCAGCCACAGGCTGTGGTGG + Intronic
1042867333 8:73367389-73367411 GGGGATGCCACATGCTGGGGAGG + Intergenic
1044780608 8:95739955-95739977 GTGGAAGCAACAGACTCTGCAGG + Intergenic
1046952290 8:120030151-120030173 GGGGAGGCCAAATACTATGGCGG + Intronic
1048247038 8:132816890-132816912 GGGGGATTCACAGGCTGTGGAGG - Exonic
1049520875 8:143089666-143089688 GTGGAAGCCACAGCCTCTGCAGG + Intergenic
1049621345 8:143599626-143599648 GAGGAGGCCACCGACTATGGAGG + Exonic
1049963184 9:755803-755825 TTGGAAGCCAAAGGCTGTGGAGG - Intergenic
1052251802 9:26407469-26407491 GGGGAATTCACAGCCTGTTGAGG + Intergenic
1052290125 9:26830661-26830683 AGTAAAGCCACAGACCGTGGTGG - Intergenic
1052658548 9:31398262-31398284 GGGGAAGCGAAAGAGTGAGGGGG - Intergenic
1053002098 9:34582742-34582764 GGGGAAGCCAGAGACAGAGAGGG + Intronic
1053598809 9:39589990-39590012 AGTGAAGCCACAGACTTTCGTGG + Intergenic
1053800710 9:41762671-41762693 GGCCAAGCCACAGCCTGTGTTGG - Intergenic
1053856562 9:42344507-42344529 AGTGAAGCCACAGACTTTCGTGG + Intergenic
1054144484 9:61552164-61552186 GGCCAAGCCACAGCCTGTGTTGG + Intergenic
1054189141 9:61974823-61974845 GGCCAAGCCACAGCCTGTGTTGG - Intergenic
1054464171 9:65483123-65483145 GGCCAAGCCACAGCCTGTGTTGG + Intergenic
1054649380 9:67613794-67613816 GGCCAAGCCACAGCCTGTGTTGG + Intergenic
1055054074 9:72007829-72007851 GGGGGAGGCACAGCCAGTGGCGG + Intergenic
1055954059 9:81757561-81757583 GGGGAAGGCTCTGACTGTGCTGG + Intergenic
1056870203 9:90270133-90270155 GAGGAAGCCAGAGACAGGGGAGG - Intergenic
1056965932 9:91162920-91162942 GCTGAAGCCACAGGCTGCGGGGG - Intergenic
1057001489 9:91513906-91513928 GGGGAAGGGACAGATTGAGGTGG + Intergenic
1060962582 9:127691525-127691547 GGGGCAGTGACAGGCTGTGGAGG - Exonic
1061706284 9:132455838-132455860 GGGGAGGCCACAGAATGTAGTGG + Intronic
1061716305 9:132520686-132520708 GGGGAAGGCACTGACTGAGAAGG - Intronic
1062245558 9:135564144-135564166 GAGGAAGCCACTTAGTGTGGTGG + Intronic
1062554942 9:137109695-137109717 TGGGAAGCCAGAGCCGGTGGCGG + Intergenic
1185446167 X:259036-259058 GGGGGAGCTAGAGACAGTGGGGG + Intergenic
1185446302 X:259586-259608 GGGGTAGCTAGAGACAGTGGGGG + Intergenic
1185446307 X:259605-259627 GGGGGAGCTAGAGACAGTGGGGG + Intergenic
1185446321 X:259659-259681 GGGGTAGCTAGAGACAGTGGGGG + Intergenic
1185446326 X:259678-259700 GGGGGAGCTAGAGACAGTGGGGG + Intergenic
1186650812 X:11558209-11558231 GGATAAGCCACAGACTTTTGGGG - Intronic
1189299772 X:39944072-39944094 GGAGAAGCCATTGACTATGGTGG + Intergenic
1189496770 X:41515701-41515723 GGGGGAGCCACTCACTGTGGAGG + Intronic
1191842930 X:65525839-65525861 TGGGAAGCCACTAACTCTGGAGG - Intronic
1192222137 X:69204488-69204510 GGGGAAACGAAATACTGTGGGGG - Intergenic
1192452356 X:71252378-71252400 GGGGTGGGCACAGGCTGTGGGGG - Intronic
1192552073 X:72062586-72062608 GGGTAAGCCACAGGGTGTGGTGG - Intergenic
1192684478 X:73289124-73289146 GGGGAAGCTGCAGTATGTGGAGG - Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196735095 X:118975708-118975730 GGGGGACCCATGGACTGTGGCGG + Intronic
1198266398 X:135013111-135013133 GGGGAAGCCACAGTTTGAGGAGG - Intergenic
1200062161 X:153488491-153488513 GAGAAAGCGCCAGACTGTGGCGG + Intronic
1200163610 X:154021218-154021240 GGAGGAGCCACAGCCTGCGGGGG + Intergenic