ID: 1168428303

View in Genome Browser
Species Human (GRCh38)
Location 19:56257310-56257332
Sequence CTGGGAGAACAAAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168428298_1168428303 -5 Left 1168428298 19:56257292-56257314 CCAGGTGACTGATCAGGGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 231
Right 1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG 0: 1
1: 0
2: 3
3: 55
4: 642
1168428293_1168428303 3 Left 1168428293 19:56257284-56257306 CCCTGGAACCAGGTGACTGATCA 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG 0: 1
1: 0
2: 3
3: 55
4: 642
1168428294_1168428303 2 Left 1168428294 19:56257285-56257307 CCTGGAACCAGGTGACTGATCAG 0: 1
1: 0
2: 1
3: 7
4: 152
Right 1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG 0: 1
1: 0
2: 3
3: 55
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168428303 Original CRISPR CTGGGAGAACAAAGGGAGGC AGG Intronic
900325085 1:2104670-2104692 CTGGGAGGAGAGAGGGAGGCTGG + Intronic
900860194 1:5223394-5223416 CTGGCAGGACACAGGGAGGGAGG + Intergenic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
900983620 1:6060415-6060437 TTCTAAGAACAAAGGGAGGCAGG - Intronic
901227869 1:7624884-7624906 TTGGAAGGATAAAGGGAGGCTGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901451089 1:9337499-9337521 ATGGGAGAACAGGGTGAGGCTGG + Intronic
901659755 1:10791347-10791369 CTGGGAAAAAGAAGGGAGGTGGG + Intronic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902627472 1:17684876-17684898 CTGCGAGTAGCAAGGGAGGCAGG - Intronic
902632838 1:17715858-17715880 CTGGGAGAATTCAGTGAGGCAGG - Intergenic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903215241 1:21840018-21840040 CTGGGAGAAAGCAAGGAGGCTGG + Intronic
904374329 1:30070439-30070461 CTGGGACAGCAAGGGCAGGCTGG - Intergenic
904478370 1:30778738-30778760 GTGGGTGAAGAAAGGAAGGCAGG - Intergenic
905101830 1:35531007-35531029 GTGGGAGACAAGAGGGAGGCAGG + Intronic
905415742 1:37802665-37802687 CTGGGGAAACCAAGGCAGGCAGG + Intergenic
905543410 1:38778411-38778433 GTGGGAGAACAGAGGTAGGTAGG - Intergenic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
907078225 1:51596986-51597008 CTGGGAGAGGAAAGGGGGTCAGG + Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
907412849 1:54294693-54294715 CTTGGAGATGGAAGGGAGGCTGG - Intronic
907622562 1:55996244-55996266 CTGGGAGCACTACGGGAGACTGG + Intergenic
907696784 1:56738942-56738964 CTTTGAGAACAAAAGAAGGCTGG + Intronic
908646513 1:66284138-66284160 CTGGAAGGACACAGGAAGGCAGG + Intronic
909136341 1:71805068-71805090 CTGGGAGCGCTAAGGGAGACTGG - Intronic
911215187 1:95185276-95185298 TTGGTAGAACAAGGGAAGGCAGG + Intronic
911259829 1:95672539-95672561 TGGGGAGAACAAATGGAGGCGGG - Intergenic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
911896100 1:103436838-103436860 CTGGGAGCACTACGGGAGACTGG + Intergenic
912303456 1:108540568-108540590 CTGGGAGCACTATGGGAGACTGG - Intergenic
912452053 1:109773284-109773306 CTGGGAGACCATGGGGAGGACGG + Intronic
912493426 1:110075833-110075855 CTGGGAGAGCACAGGGGGCCTGG + Intergenic
912807161 1:112766241-112766263 CTGGGAGCACTATGGGAGACTGG - Intergenic
913505234 1:119510834-119510856 GTGGGAGGATAAATGGAGGCTGG - Intronic
913966718 1:143382984-143383006 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914061095 1:144208591-144208613 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914118055 1:144757778-144757800 AAGGGAGAAGAAAGGAAGGCAGG + Intergenic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
915274765 1:154780815-154780837 CTAGAGGAAGAAAGGGAGGCGGG + Intronic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915801636 1:158799793-158799815 CTGAGAGAAGAAAGGGTGGCTGG + Intergenic
916857047 1:168760928-168760950 TTGGGAGAAGAACTGGAGGCAGG - Intergenic
917171818 1:172185015-172185037 TTGGAAAAAAAAAGGGAGGCTGG + Intronic
917923097 1:179767088-179767110 CTGGGAGAACGATGGCAGGGAGG - Intronic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918305230 1:183240017-183240039 CTGAGAGAAGAAAAGGAGCCAGG - Intronic
918744440 1:188182284-188182306 CTGGGAGAGCTACGGGAGACTGG - Intergenic
919518517 1:198557156-198557178 CCGGGAGAGGGAAGGGAGGCTGG + Intergenic
920058875 1:203213875-203213897 CTGGGTTAACAAAGGCAGCCAGG + Intronic
920074605 1:203327243-203327265 CTGGGCGTGCAAAGGCAGGCAGG + Intergenic
920347266 1:205314281-205314303 CAGGGAGGACAATGGCAGGCGGG + Intronic
920659973 1:207907420-207907442 CTGGATGAGCAAAGGTAGGCAGG - Intronic
922703711 1:227777788-227777810 CTGGGACATCCAAGGGAGGCTGG - Intronic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
923094096 1:230761105-230761127 CTGGCAGCACAAAAGGATGCTGG - Intronic
923960063 1:239070539-239070561 CAGGGAGAAGGAAGAGAGGCAGG + Intergenic
924001948 1:239563811-239563833 CTGGGAAAAAAAAGTGTGGCAGG + Intronic
924560573 1:245154413-245154435 CTCCGAGAACAAAGGGCGGGGGG + Intergenic
924932858 1:248746522-248746544 CTGAGAGGACACAGGAAGGCAGG + Intronic
1062817552 10:511840-511862 CTGTAAGAACAAAGTGAGCCTGG + Intronic
1063343948 10:5294242-5294264 CTGAGAGCAGAAAGGGAAGCTGG - Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065438575 10:25726467-25726489 GTGGGAAAATAAAGGGAGGGAGG - Intergenic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1066429751 10:35340368-35340390 GTGGGAGGAGAAAGGGAGGGAGG + Intronic
1066654131 10:37683362-37683384 CTGGGACAACATAGGGAAGCAGG + Intergenic
1066698481 10:38100377-38100399 CTGGGAGAACTATGGGAGACTGG + Intronic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1068515624 10:58022030-58022052 CTGGGAGCACTATGGGAGACTGG - Intergenic
1070523406 10:77274692-77274714 CTGGGATGACAAATGGAGTCGGG - Intronic
1070582921 10:77736846-77736868 CTGGGAGCACTATGGGAGACTGG - Intergenic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1073249753 10:102114406-102114428 CTGGGAGAACTGAGGGGGCCAGG + Intronic
1073273521 10:102287978-102288000 TTGGGAGAAGACAGGGAGACAGG - Intronic
1074401185 10:113142289-113142311 CTGGGATAAAAAGGGGATGCTGG - Intronic
1074674322 10:115831106-115831128 CTGGAAGAACAAGGGCAGGTGGG - Intronic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1075440796 10:122477919-122477941 ATGGCAGAAGGAAGGGAGGCTGG + Intronic
1075731727 10:124640378-124640400 CTGGGATAACAAGGGGAGTAGGG + Intronic
1076349770 10:129807998-129808020 CAGGGAGGAGAAAGGGAGGCAGG - Intergenic
1076394976 10:130131709-130131731 CTGGGAGAACCCAGCAAGGCTGG - Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1078293465 11:10040556-10040578 CTGGAAGAAAAAAGGGATGGGGG + Intronic
1078397890 11:10998083-10998105 CTGGGAGGAGGAAGGGAGGTTGG - Intergenic
1078646886 11:13148802-13148824 CCTGGAAAAGAAAGGGAGGCTGG + Intergenic
1078757529 11:14224915-14224937 CAGGGAGTAAAACGGGAGGCAGG + Intronic
1078782544 11:14453306-14453328 CTGGGAGAGGAAAGTAAGGCAGG + Intronic
1079165575 11:18038902-18038924 CTGGGAGAGGGAAGGGAGGGAGG + Intronic
1080203654 11:29704951-29704973 CTGGGAGCACTATGGGAGACCGG - Intergenic
1080262513 11:30364840-30364862 CTGGGAATAGACAGGGAGGCTGG - Intergenic
1081254075 11:40871053-40871075 CTGGGAGCACTACGGGAGACTGG - Intronic
1081295773 11:41387253-41387275 CTCTGAGGACAAATGGAGGCAGG + Intronic
1081461246 11:43274652-43274674 CTGGGAGCACTATGGGAGACTGG + Intergenic
1081567071 11:44266564-44266586 CAGGGAGAAGTAAAGGAGGCAGG + Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1084047625 11:66579135-66579157 CTGGCAGAACAACTGGAGTCGGG + Intergenic
1084196383 11:67525255-67525277 CTGGCAGAACGCAGGGAGGTGGG - Intergenic
1084244027 11:67843379-67843401 CTGGGAGCACTATGGGAGACTGG + Intergenic
1084334057 11:68446661-68446683 TTGGCAGAGCAGAGGGAGGCAGG - Intronic
1084445331 11:69200424-69200446 CTTGGAGAAAATGGGGAGGCAGG + Intergenic
1084901736 11:72314999-72315021 CTAGGGGAAGGAAGGGAGGCAGG + Intronic
1085319820 11:75567077-75567099 CTGTGACAACCCAGGGAGGCAGG + Intronic
1085510261 11:77084555-77084577 CTGGTCAAACAAAGGAAGGCAGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086385341 11:86301726-86301748 ATGGGAGAACTAAGTGAAGCTGG + Intergenic
1086820824 11:91433848-91433870 CATGGAGAACAAAGGAAAGCAGG - Intergenic
1087013108 11:93531805-93531827 CTTTGAAAAGAAAGGGAGGCAGG - Intronic
1087135609 11:94715471-94715493 AGGTGAGAACAAAGGAAGGCTGG - Intronic
1087379337 11:97384951-97384973 CAGGAAGGAAAAAGGGAGGCAGG - Intergenic
1087465068 11:98494153-98494175 CTGTGAGTAAAATGGGAGGCAGG + Intergenic
1087723082 11:101688695-101688717 CTGGGAGAACAGTTTGAGGCTGG - Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087792719 11:102423812-102423834 TTGGGAAGACAAAGGGAGGGAGG + Intronic
1088759200 11:112913204-112913226 CTGGGAGTAGAAAGCGAGGGAGG + Intergenic
1088967259 11:114736277-114736299 CTGGGAGCACTATGGGAGACTGG + Intergenic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089352916 11:117831567-117831589 TGTGGAGAAGAAAGGGAGGCTGG - Intronic
1089772681 11:120814942-120814964 CTGGGAGAAGGAAGGCAGGCAGG - Intronic
1089774573 11:120827321-120827343 CTGGGAGGAAGAAGGGAGGCTGG - Intronic
1090085035 11:123642976-123642998 GAGGGAGAACAAAGGCAGGCGGG + Intronic
1090222872 11:125045898-125045920 CTGGGAGCACTATGGGAGACTGG - Intergenic
1090996214 11:131868268-131868290 CTGGGACAAAAAAGGGTGGGTGG - Intronic
1091156332 11:133377549-133377571 CTGGGAGTTCAAAGGGAAGGTGG - Intronic
1091240261 11:134047328-134047350 GTGGGATAACAAAAGGAGGATGG + Intergenic
1092307627 12:7317815-7317837 CTGAGAGTACAGTGGGAGGCTGG - Intronic
1093406825 12:18814242-18814264 CTGAAAGGACGAAGGGAGGCAGG - Intergenic
1093560534 12:20533725-20533747 TTGGGAGTCCAAAGGGGGGCGGG - Intronic
1093772841 12:23037546-23037568 CAGGGAGAAAAAGGGGAAGCGGG + Intergenic
1093989373 12:25572811-25572833 CTGGCAGAAGGAAGGGAGGGAGG - Intronic
1094326752 12:29248700-29248722 CTGGGAGCACTATGGGAGACTGG + Intronic
1095087149 12:38069413-38069435 CTGGGAGAACTATGGGAGACTGG - Intergenic
1095202935 12:39406731-39406753 GTAGGAGAGAAAAGGGAGGCAGG - Intronic
1095575975 12:43739726-43739748 CTTGAAGAACAAAAGGATGCTGG + Intronic
1095930787 12:47623356-47623378 CTTAGAGAACAAAGGGAGTGGGG - Intergenic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1097245483 12:57605318-57605340 CTGGCACAGAAAAGGGAGGCGGG - Intronic
1097265184 12:57740240-57740262 CTGGGAGAACAAAGGGCTCCTGG - Intronic
1097833128 12:64246683-64246705 CTGGGAGAAGCATGGGAGGTGGG - Intergenic
1098971887 12:76865937-76865959 ATGGGGACACAAAGGGAGGCTGG + Intronic
1099117753 12:78648836-78648858 CTGGGAGCACTATGGGAGCCTGG - Intergenic
1099302891 12:80919775-80919797 CTGGCAGACCAAAGAAAGGCAGG + Intronic
1099342518 12:81455561-81455583 CTTGGATAATAAAGGGAGGAAGG - Intronic
1099721323 12:86365038-86365060 CTGGGAGCACTACGGGAGACTGG + Intronic
1100669822 12:96799504-96799526 GCTGGAGAACAAAGAGAGGCAGG - Intronic
1101787741 12:107900465-107900487 CTGGGAGGATAAAGGAAGGAAGG - Intergenic
1102257719 12:111425727-111425749 CTGGGAGACCACAGGTAGCCTGG - Intronic
1102308021 12:111821177-111821199 CTGGGAGCACTATGGGAGACTGG + Intergenic
1102386868 12:112517309-112517331 CCTGGAGATCAAAGGGAGGCAGG - Intergenic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1103344772 12:120241866-120241888 AGGGGAGATCAGAGGGAGGCAGG + Intronic
1103710515 12:122909046-122909068 TTGGGAGACCAAGGCGAGGCAGG - Intergenic
1103744780 12:123115082-123115104 TTGGGAGAATACAGGGAGGTGGG - Intronic
1104022758 12:125004706-125004728 CTGGGACAGAAAAGGGTGGCAGG - Intronic
1104087811 12:125492509-125492531 CTGGGAACACCAGGGGAGGCCGG - Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1104977520 12:132558876-132558898 CTGGCAGCACACAGGGAGGCCGG - Intronic
1105227662 13:18451444-18451466 CTGGGAGCACTACGGGAGACTGG + Intergenic
1105521568 13:21135753-21135775 CTGGGAGCACTACGGGAGACTGG + Intergenic
1105546150 13:21352421-21352443 CTGGGAGCAGAAAGTGAGGTGGG + Intergenic
1106390922 13:29335265-29335287 CTGGGAGCACTATGGGAGACCGG - Intronic
1106627983 13:31440850-31440872 CAGAGAGTACAAAGGGAGGGGGG - Intergenic
1106954202 13:34917651-34917673 CTGTGAAAACAAAGGGCTGCAGG - Intergenic
1107315423 13:39126424-39126446 CAGGGAGAAGAGAGGTAGGCAGG + Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107740632 13:43446331-43446353 CTGAGAGAACAAAATGAGCCTGG + Intronic
1110783238 13:79491110-79491132 CAGGGAGAAAGAAGGGAGGTAGG - Intronic
1111047602 13:82835147-82835169 GTGGGAGAAGGAAGGGAGGTGGG + Intergenic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112449334 13:99494716-99494738 CTGGGAGCACTATGGGAGTCCGG + Intergenic
1112746568 13:102533697-102533719 CTGGGAGCACTACGGGAGACTGG - Intergenic
1113119128 13:106907568-106907590 CTGGGAGATAAAAGACAGGCTGG + Intergenic
1115643049 14:35347568-35347590 GTGGGAGATCAAAGGGAGGAGGG + Intergenic
1115771310 14:36666162-36666184 CTGGGAGAGCAAAGGGGCGAAGG + Intronic
1116301789 14:43192458-43192480 CTGGGAGCACTACGGGAGACTGG + Intergenic
1118364718 14:65084894-65084916 TGGGGAGAAAAAAAGGAGGCAGG + Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1120768969 14:88358126-88358148 GTGTGAAAACCAAGGGAGGCAGG + Intergenic
1120955891 14:90081365-90081387 ATGGGGGAGCAAAGGGAGACTGG - Intronic
1121260149 14:92559924-92559946 CTGGGAGCACAGAGTGAGCCTGG + Intronic
1121638346 14:95468712-95468734 CTGGGAGAATATGGGGAGGAAGG - Intronic
1121902447 14:97706332-97706354 CTGGGAAAAAGCAGGGAGGCTGG + Intergenic
1122855233 14:104556839-104556861 CTGAGAGAAGACAGGGAGTCAGG + Intronic
1123690368 15:22833601-22833623 CTGGGAGCACTATGGGAGACTGG + Intergenic
1123864609 15:24505391-24505413 CTGGGAGCACTACGGGAGACCGG + Intergenic
1124026840 15:25974622-25974644 TGGGTAGAACAAAGGGAGGGAGG + Intergenic
1124515163 15:30361612-30361634 CAAGGAGATCAAAGGGACGCAGG - Exonic
1124727759 15:32169115-32169137 CAAGGAGATCAAAGGGACGCAGG + Intronic
1124851001 15:33338990-33339012 CTGGCAGATGGAAGGGAGGCAGG + Intronic
1125920568 15:43523109-43523131 CTGGCTGAACAAAGGGACACAGG + Exonic
1126276168 15:46884007-46884029 CTGGGAGCACTATGGGAGACCGG + Intergenic
1126850013 15:52790926-52790948 CTGGGAGGACGAAGGGTGCCGGG - Intronic
1127755108 15:62084509-62084531 CTGGGAGCACTATGGGAGACTGG + Intergenic
1128006490 15:64246900-64246922 GTGGGAGGAAAAAGGGAGGGAGG - Intronic
1128477188 15:68007298-68007320 CTGGGAGCACTATGGGAGACGGG - Intergenic
1128980170 15:72180025-72180047 GGAGGAGAAGAAAGGGAGGCTGG - Intronic
1129116314 15:73367362-73367384 CTGGGAGCTCCAAGAGAGGCAGG - Intronic
1129450786 15:75650055-75650077 CTGGGAGAGCACAGGGTGGCTGG - Exonic
1130838189 15:87672464-87672486 CTGGGAAAGTAAAGGAAGGCAGG - Intergenic
1130980866 15:88811067-88811089 CTTGGAGAACCAAGGGAGGAAGG - Intronic
1131293006 15:91123523-91123545 CCGGGAGAACTTAGGGAGACGGG + Intronic
1131307530 15:91258607-91258629 CTGAGAGAAGGAAGCGAGGCTGG - Intronic
1132209800 15:100011460-100011482 AGGAGAGAACAAAGGCAGGCAGG + Intronic
1132224242 15:100128188-100128210 GTGAGAGAACAAAGGGGAGCTGG + Intronic
1133458216 16:5961822-5961844 GTTAGAGAACAAGGGGAGGCGGG - Intergenic
1134234260 16:12453077-12453099 CTGGGAGAATGAAGGGTGGGAGG - Intronic
1135301139 16:21328497-21328519 CTGGGAGCACTATGGGAGACTGG - Intergenic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1135424101 16:22323858-22323880 CTGGGAGAGAGAAGGGTGGCTGG - Intronic
1135813505 16:25611027-25611049 CTGGGAGCACTATGGGAGACTGG + Intergenic
1136109090 16:28053454-28053476 CTGGGAGGACAGAGGGGGACTGG + Intronic
1136264540 16:29107258-29107280 CTTGGAGAAGGATGGGAGGCAGG + Intergenic
1136532000 16:30876042-30876064 CTGGAGGAACAAAGGAGGGCCGG + Intronic
1136775865 16:32871510-32871532 ATGGGAGACCAAAGACAGGCAGG - Intergenic
1136894751 16:33990002-33990024 ATGGGAGACCAAAGACAGGCAGG + Intergenic
1137039604 16:35598857-35598879 TTGGGAGAAGAAAGGGAAACAGG - Intergenic
1137582128 16:49639872-49639894 CTGGGAAAACAAAGGCACACAGG + Intronic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139497993 16:67335174-67335196 CTGGGAGCACTACGGGAGACCGG + Intronic
1139594884 16:67951685-67951707 CTGGGAGGACACTGGGGGGCTGG + Intronic
1139734157 16:68973002-68973024 GAGAGAGAACAAAGGAAGGCGGG + Intronic
1139940328 16:70600959-70600981 CTGGGAGAAGTAGGGGATGCTGG + Intronic
1140103671 16:71939750-71939772 CTGGGAGAAGAAAGAGAAGTTGG + Intronic
1140126606 16:72123517-72123539 ATGGGAGGAAAAAGGGAGGCAGG - Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140267482 16:73433257-73433279 CTGGGAGAACAAGGGGGTGGAGG - Intergenic
1140921482 16:79542526-79542548 CTTGGATAACAAAAGGAAGCAGG + Intergenic
1141848496 16:86627635-86627657 CTGAGAGACCACAGTGAGGCTGG + Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1141942112 16:87283927-87283949 CTAGGGGAGCAATGGGAGGCAGG + Intronic
1142285753 16:89170880-89170902 CTCGGGGAACAAGGGGATGCTGG + Intergenic
1142298633 16:89243244-89243266 CTCGGGGAACAAGGGGATGCTGG + Intergenic
1203078281 16_KI270728v1_random:1133619-1133641 ATGGGAGACCAAAGACAGGCAGG - Intergenic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1145779109 17:27550378-27550400 CTGGGAGAACAGGCAGAGGCTGG - Intronic
1146946694 17:36878223-36878245 CTGGGAGAGGACAGGAAGGCTGG - Intergenic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1147445726 17:40474286-40474308 GTGGGAGAAGAGAGGGAGGGAGG + Intergenic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1148700432 17:49583477-49583499 CTGGGAGACCAACAGGAGACAGG - Intronic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1148808106 17:50274340-50274362 CTGGGAGGAGGAAGGGAGGAAGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149485188 17:57037013-57037035 CTGGGTGGAGAAAAGGAGGCTGG + Intergenic
1149569920 17:57665137-57665159 CTGGGAAGACTAATGGAGGCTGG - Intronic
1151185310 17:72359875-72359897 TTGGGGGAGCAAAGGGAGCCAGG + Intergenic
1151313899 17:73310689-73310711 CTGGGAAAACACAGGGAACCTGG + Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151864681 17:76793217-76793239 CTGGGAGCACTATGGGAGACTGG + Intergenic
1151871650 17:76840832-76840854 CTGAGGGAACAGAGGGAGTCAGG - Intergenic
1152554936 17:81048478-81048500 CTTGGGGAACAAAGGGAGAGTGG - Intronic
1152599514 17:81254890-81254912 CTAAGTGAAGAAAGGGAGGCTGG + Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153291324 18:3504921-3504943 TGGGGAGAGCCAAGGGAGGCTGG + Intronic
1153485502 18:5593679-5593701 CTGGGAGCACTATGGGAGACTGG + Intronic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153796002 18:8622742-8622764 CTGGGAGCACTACGGGAGACTGG + Intronic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1154396220 18:13992308-13992330 CTGGGATAACATAGACAGGCAGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155854511 18:30816091-30816113 CTGGGAGCACTATGGGAGACTGG - Intergenic
1156171329 18:34490071-34490093 CTGGGAGCCCAAAGGCAGTCAGG + Intergenic
1156654322 18:39265833-39265855 GTGGGAGAAGATAGGGAGTCAGG + Intergenic
1157043186 18:44063482-44063504 CTGGAAGAATAAAATGAGGCTGG + Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157673887 18:49553708-49553730 CTGGGAGCGCTAAGGGAGACTGG + Intergenic
1158580016 18:58672248-58672270 CTGGGAGACCTAAGGAAGGCTGG + Intronic
1158640101 18:59196367-59196389 CTGGAAGTTCAAAGGGAAGCAGG - Intergenic
1158828518 18:61251887-61251909 CTGGGAGACAGCAGGGAGGCTGG - Intergenic
1158866837 18:61646096-61646118 CTTGGAGTACATAGGCAGGCAGG - Intergenic
1158930634 18:62322454-62322476 ATGGTAGCACAAAGGGAGGGAGG + Intergenic
1159470722 18:68852094-68852116 CCGGGAGAAGAAAAGAAGGCAGG - Intronic
1159764247 18:72468381-72468403 CTGGGAGAACAAAGAGGGCCTGG - Intergenic
1159798609 18:72869776-72869798 CGGGGAGAGAAAAGAGAGGCAGG + Intergenic
1159850168 18:73517419-73517441 CTGGGAGCACTATGGGAGACTGG + Intergenic
1160198447 18:76776878-76776900 CTCTGAGTACAATGGGAGGCAGG + Intergenic
1160219121 18:76959709-76959731 CTGGGAGCTCAAAGAGGGGCCGG - Exonic
1160580857 18:79884047-79884069 CTGGGAGAAGAAAAGATGGCAGG - Intronic
1160715284 19:573516-573538 CTGGGAGAACACCCGGGGGCAGG - Intronic
1161450883 19:4344598-4344620 CTGGGAAACCACAGGAAGGCCGG - Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162497300 19:11030475-11030497 CTGGGAGAACTAGAGGAGGTGGG - Intronic
1162515016 19:11142615-11142637 GAGGGAGAACAAACGGGGGCGGG + Intronic
1162529898 19:11229720-11229742 ATGGGAGAAGAACGTGAGGCTGG + Intronic
1162562789 19:11427102-11427124 GTGGGAGAAGGAAGGGAGGAAGG - Intronic
1163019124 19:14473302-14473324 CTGGGACGACAAAGGGCGGGAGG + Intronic
1163041861 19:14608591-14608613 TTGGGAGAAAAAAGGGAGGGTGG + Intronic
1163738671 19:18997292-18997314 CTGGGAGAGGAAAGGGAGAAGGG + Intronic
1164172118 19:22734501-22734523 CTGGGAGCACTATGGGAGGCTGG - Intergenic
1164218042 19:23168347-23168369 CTGGGAGCGCTAAGGGAGACTGG - Intergenic
1164365653 19:27579285-27579307 CTGGGAGCACTATGGGAGACTGG - Intergenic
1164378733 19:27712681-27712703 CTGGGAGCACTATGGGAGACTGG + Intergenic
1164426666 19:28147748-28147770 TAGGGAGAGCTAAGGGAGGCTGG + Intergenic
1165008397 19:32824743-32824765 CTGGAGGAAGAAAGGGCGGCGGG - Intronic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165405056 19:35624929-35624951 CTGGGAGAGTAAAGGGACTCTGG - Exonic
1165665414 19:37623321-37623343 CTGGGAGCACTATGGGAGACTGG - Intronic
1165693178 19:37879703-37879725 CTGGGAGAAAGATGGGAGGCTGG + Intergenic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1167665463 19:50820907-50820929 GTGGGAGAGAAAAGGGAGGGAGG + Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1202700502 1_KI270712v1_random:160479-160501 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
925073214 2:987714-987736 CTAGGAAACCAAGGGGAGGCTGG + Intronic
925641680 2:5991541-5991563 CTGGGAGGACACAGGAATGCAGG + Intergenic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926009555 2:9397394-9397416 CTGGCAGGAAAAAGGGAAGCAGG + Intronic
926128400 2:10285772-10285794 CTGGGCGGACCCAGGGAGGCTGG - Intergenic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
926511189 2:13781529-13781551 CAGGGAGAGAAAGGGGAGGCAGG - Intergenic
926556320 2:14362336-14362358 CTGGGAGCACTATGGGAGACTGG + Intergenic
926671501 2:15581202-15581224 TTGGGAGACCAAGGGGAGGTAGG + Intergenic
926697695 2:15782302-15782324 CCTGGAGAACAAAGGCGGGCGGG + Intergenic
926859117 2:17290445-17290467 CTGGGAGCACTACGGGAGACTGG + Intergenic
927078220 2:19601494-19601516 CTGGGAGAAGAAACGAGGGCTGG - Intergenic
928362269 2:30674910-30674932 CTGGGAGAAGAGAGAAAGGCAGG + Intergenic
929104731 2:38353490-38353512 GAAGGAGAACAAAGTGAGGCTGG + Intronic
930094935 2:47559861-47559883 CTGGTAGAAAACAGGGAGGAAGG + Intronic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930643488 2:53878682-53878704 CTGGGAGCACTACGGGAGACCGG - Intronic
931441587 2:62294061-62294083 CTGGGAGAGGAAGGTGAGGCGGG - Intergenic
931566025 2:63616369-63616391 CTGGGGGAATTAAGGGAGGGAGG + Intronic
931641307 2:64383127-64383149 CTGGGCCTACAAAGGGTGGCTGG + Intergenic
932223952 2:70024437-70024459 CTGAGAGAACAGAGAGGGGCCGG + Intergenic
932336075 2:70932128-70932150 CAGAGAGAACAAAGGGAGAGAGG + Intronic
932489802 2:72113514-72113536 CTGGGCCAAGAAAGGGAGGTGGG + Intergenic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
933205697 2:79504980-79505002 CTGGGAGAAGACAGGAAGGCAGG + Intronic
933333094 2:80920002-80920024 CTGGGAGCACTATGGGAGACTGG - Intergenic
933611860 2:84444684-84444706 CTGGGAGCACTACGGGAGACTGG + Intronic
933727350 2:85434388-85434410 AGGGGAGAAGAGAGGGAGGCAGG + Intronic
933823299 2:86134966-86134988 CTGGGAGAACTCAGGAAGCCTGG + Exonic
934107220 2:88706500-88706522 CAGTGAGAACACATGGAGGCAGG + Intronic
934171430 2:89543952-89543974 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934281739 2:91618270-91618292 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936572071 2:113625804-113625826 CTTGGAATAGAAAGGGAGGCAGG - Intergenic
937016238 2:118608552-118608574 CTGGGACAACAAAGTGAGAGAGG + Intergenic
937637257 2:124170163-124170185 CTGAAAGAATAAAGAGAGGCAGG + Intronic
937679899 2:124632897-124632919 CTGGGGGAAGAGAGGCAGGCAGG + Intronic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
939998852 2:148947479-148947501 CTGGGAGAACCAGGGAATGCAGG - Intronic
941544154 2:166826529-166826551 CTAGGAGAAAAAAGGGAGGTTGG - Intergenic
941571149 2:167172476-167172498 CTGGGAGCACTATGGGAGACTGG + Intronic
942380814 2:175388252-175388274 CTGGGAGCACTATGGGAGACTGG - Intergenic
942498637 2:176565063-176565085 CTGGTAGGACATTGGGAGGCAGG - Intergenic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
943606622 2:189984213-189984235 CTGGGAGCACTATGGGAGACTGG + Intronic
944244963 2:197521554-197521576 CTGGGAGCACTATGGGAGACTGG + Intronic
944780074 2:203008612-203008634 CTGGGAGCACTATGGGAGACTGG - Intronic
944878585 2:203987858-203987880 TGGGGAGAAGAATGGGAGGCGGG + Intergenic
944997198 2:205307083-205307105 CTTGGTGAGGAAAGGGAGGCAGG - Intronic
945536550 2:211025255-211025277 CTGGGAGCACTACGGGAGACCGG + Intergenic
946209757 2:218137989-218138011 CTAGGGGAAAACAGGGAGGCAGG + Intergenic
946406176 2:219493132-219493154 CAGGGAGAACCAAGGAAGGTGGG + Exonic
946433041 2:219635650-219635672 CTGGGGGAACAAGGGGCTGCTGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947864637 2:233387917-233387939 CTGGGAGGACACTGGGACGCGGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948729828 2:239955873-239955895 CTGAGAGACCAAAGTGGGGCAGG + Intronic
948846995 2:240687936-240687958 CTGTGAGGACACAGGGAGCCTGG + Intergenic
949035969 2:241815883-241815905 CTGGGAGGACTCAGGGCGGCTGG + Intronic
1169082075 20:2803651-2803673 TTGGGAGACCAAGGCGAGGCGGG + Intergenic
1169731780 20:8793841-8793863 CTGGGAGCACTATGGGAGACTGG + Intronic
1169738719 20:8866711-8866733 CAGGGAGAGCAAACTGAGGCAGG - Intronic
1170166307 20:13363245-13363267 TTTGGAGAAGAAAGAGAGGCTGG + Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170757263 20:19214972-19214994 CGGGGGCAACACAGGGAGGCTGG - Intronic
1170856542 20:20061702-20061724 CATGGGGAACACAGGGAGGCGGG - Intronic
1171777433 20:29382242-29382264 CTGGGAGTGCTATGGGAGGCTGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172264388 20:33598276-33598298 CTGGGAGCACTATGGGAGACTGG + Intronic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1173475998 20:43360163-43360185 CTGGGAGAGGGAAGGCAGGCAGG + Intergenic
1173665504 20:44760131-44760153 CTGGGAGAGCAGAGGAAGTCAGG + Intronic
1174126246 20:48309161-48309183 CTGGGAGAACTAGGGGAAGCTGG - Intergenic
1174341774 20:49901624-49901646 CTGGGAGAGCTAAGGAAGCCAGG - Intergenic
1174628400 20:51935108-51935130 CTGGGAGGACAATGGGAAGAGGG + Intergenic
1175579025 20:60084824-60084846 CTGGAAGAAGATAGGGAGGCAGG - Intergenic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1175767827 20:61603426-61603448 CTAGGAAAACAAATGCAGGCAGG + Intronic
1176287296 21:5024849-5024871 CATGGAGAACAGAGGCAGGCAGG + Intronic
1176421877 21:6522702-6522724 CTTGCAGTAGAAAGGGAGGCAGG + Intergenic
1176771705 21:13080455-13080477 CTGGGAGCACTACGGGAGACTGG + Intergenic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179261661 21:39763441-39763463 CTGGGAGATGAAAAGGAGGGAGG - Intronic
1179697367 21:43131018-43131040 CTTGCAGTAGAAAGGGAGGCAGG + Intergenic
1179869885 21:44238626-44238648 CATGGAGAACAGAGGCAGGCAGG - Intronic
1180867292 22:19126917-19126939 CTGTGAGAACATGAGGAGGCAGG - Intergenic
1181176105 22:21037026-21037048 CTGGGAGAACAAATAAAAGCGGG + Intergenic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181571640 22:23771164-23771186 CTGGGCCAAGAAAGGGAAGCGGG - Intronic
1181606825 22:23985144-23985166 CTGGGAGCACTATGGGAGACTGG + Intergenic
1181624537 22:24114304-24114326 CTGGGAGATCACAGGCAGGCTGG + Intronic
1181874223 22:25927411-25927433 CTGGGAGAGCTATGGGAGACTGG - Intronic
1181959679 22:26613994-26614016 CTGGGAGAGCTATGGGAGACTGG - Intronic
1182099215 22:27646058-27646080 CTGGGAGAAACTAGGGAGGATGG + Intergenic
1182822030 22:33224779-33224801 CTAGAAGAACAAGGAGAGGCAGG + Intronic
1183257329 22:36770920-36770942 CTGGAAGAAGAAGGGAAGGCTGG + Intronic
1183573970 22:38675217-38675239 CAGTGAGAGCAAAGGGAGCCTGG - Intergenic
1183684976 22:39356556-39356578 CAGGGAGAAAAAACAGAGGCTGG + Intronic
1183781302 22:40000752-40000774 ATGGGAGAAAAGAGGGAGGCAGG - Intronic
1184276800 22:43413227-43413249 CTGGGGGAACAAAAGTGGGCTGG + Intronic
1184402678 22:44282889-44282911 CTGGGACACCACATGGAGGCTGG + Intronic
1184425356 22:44406033-44406055 CTGGGAGAATGAAGGGAGATGGG - Intergenic
1185428120 22:50785076-50785098 CTTGGAATAGAAAGGGAGGCAGG + Intergenic
950138442 3:10599441-10599463 CTGGGAGAACAAGGTGATGTGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951398442 3:22200667-22200689 CTGGGAGCACTATGGGAGACTGG + Intronic
951399616 3:22215497-22215519 CTGGGAGCACTATGGGAGACTGG - Intronic
952277793 3:31894296-31894318 CAAGGAGGACAAGGGGAGGCAGG + Intronic
952934031 3:38381695-38381717 CTGGGAGCACTATGGGAGACTGG - Intronic
953750630 3:45605926-45605948 CTGGGACAAAGAAGGGAGACTGG - Intronic
954424615 3:50436841-50436863 CTGGGAGAACAGGGTGGGGCTGG - Intronic
954618450 3:51982578-51982600 CTGGGAGTACAAAGGGCAGCTGG + Intronic
955206474 3:56900129-56900151 CTGTGACAACAAAGGGAGTTGGG - Intronic
955634240 3:61008448-61008470 TTGGGAGAACAAAAGGAGTCTGG + Intronic
956816221 3:72910847-72910869 GTGGCGGAACAAAGGGAAGCTGG + Intronic
958684207 3:97371875-97371897 CTGGGAGCACTATGGGAGACCGG - Intronic
958752882 3:98213379-98213401 CTGGGAGCACTATGGGAGACTGG - Intergenic
959118817 3:102208826-102208848 CTGGGAGCACTATGGGAGACTGG + Intronic
959938979 3:112060384-112060406 CTGGGAGCACTAAGGGAGACTGG + Intronic
960531677 3:118772555-118772577 GAGGGAGAACTAAGGGAGCCAGG - Intergenic
960596514 3:119412511-119412533 CTAGAAGGACAAAGGGAAGCTGG + Intronic
960674598 3:120182030-120182052 AGGGGAGAACAAAGGCAGGCTGG + Intronic
960889849 3:122436159-122436181 CTGGGAGCGCTAAGGGAGACCGG - Intronic
961553503 3:127682006-127682028 CTGGGGGAGGAAAGGAAGGCTGG + Intergenic
961824864 3:129593738-129593760 GTGTGGCAACAAAGGGAGGCGGG + Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
961923669 3:130452772-130452794 CTGGGAGCACTATGGGAGACTGG + Intronic
962259683 3:133894959-133894981 CTTGGAGAACGAAGCGAAGCTGG - Intronic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962290400 3:134131503-134131525 CTGGGAGCACTATGGGAGACTGG + Intronic
962323065 3:134407104-134407126 CTGGGAGACCCAAGCGGGGCAGG + Intergenic
962599382 3:136979450-136979472 CTGTAACAGCAAAGGGAGGCAGG + Intronic
962694286 3:137932222-137932244 GTGGGAGTACAAAGGGAGTGGGG + Intergenic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
963231492 3:142912537-142912559 CAGAGAGAAGAAAGGGAGTCAGG + Intergenic
963744836 3:149115618-149115640 TTGGGAGAGCAAATGGAGGTGGG - Intergenic
963923333 3:150926032-150926054 CTGCGAGAAGAGAGGGAGACCGG + Intronic
964754478 3:160081292-160081314 CTGGGAGCACTATGGGAGACTGG + Intergenic
965796803 3:172448546-172448568 CTTGGAGAAGAAAGAGAGGGAGG + Intergenic
966142580 3:176772553-176772575 CTGGGAGCACTATGGGAGACTGG - Intergenic
966151298 3:176869833-176869855 CTGGGAGCACTATGGGAGACTGG + Intergenic
967567156 3:190986657-190986679 CTGGGAGCACTATGGGAGACTGG - Intergenic
968026780 3:195449324-195449346 CTGGGAGAAAAAAGGAATACTGG - Intergenic
968420974 4:484628-484650 CTGGGAGCACTATGGGAGACTGG - Intronic
969559882 4:7939978-7940000 CTGAGGGAACAAAGGGAGGTTGG + Exonic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
971365825 4:25976420-25976442 CTGGGAGCACTATGGGAGACTGG - Intergenic
971577930 4:28300906-28300928 CTGTGAGAACACAGGGACACAGG + Intergenic
972357073 4:38289785-38289807 CAGGGAGAAGAAAAGGAGCCTGG + Intergenic
973585884 4:52390668-52390690 CTGGGAGCACTATGGGAGACTGG - Intergenic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
974017050 4:56656868-56656890 CGGGGAGCACACAGTGAGGCAGG - Intronic
974289600 4:59913004-59913026 CTTGGAGAAAGAAGGGAGGGTGG - Intergenic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
976437427 4:85034063-85034085 CTGGGAGCACTATGGGAGACTGG - Intergenic
976444566 4:85116023-85116045 CTGGGGGGACAGAGAGAGGCAGG - Intergenic
976784495 4:88802681-88802703 AGGGGAGAAGAAAGGGATGCAGG - Intronic
977627511 4:99203326-99203348 CTAGGAGAACTAAGAGGGGCTGG + Exonic
977879385 4:102186836-102186858 CTGTGAGTACAAAGGGATGGTGG + Intergenic
977979943 4:103309568-103309590 CTGGGAATACAAAGGCAGTCGGG + Intergenic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
978752512 4:112267356-112267378 CTGGCAGAAGGAAGGGAGACAGG - Intronic
982807868 4:159789101-159789123 CTGGGAGCACTATGGGAGACTGG - Intergenic
983940903 4:173533137-173533159 GTGGGAGAAGAAAGGGAGAAAGG + Intergenic
984827206 4:183936723-183936745 CTCTGAGAACACAGGCAGGCTGG - Intronic
984908253 4:184649318-184649340 CTGGGAGAACGCAGGGAGCGGGG + Intronic
985932455 5:3069169-3069191 CAGGCAGAACCAAGGGAGGGAGG - Intergenic
987074933 5:14372226-14372248 GTGGGGGAAGAAAGAGAGGCGGG + Intronic
988717732 5:33844492-33844514 CTGGGAGCACTATGGGAGACTGG - Intronic
989317881 5:40103520-40103542 CTGGGAGCACTATGGGAGACTGG - Intergenic
989572287 5:42955712-42955734 CTGGGAGCACTATGGGAGACTGG + Intergenic
989624354 5:43415221-43415243 CTGGGAGCACTATGGGAGACTGG - Intergenic
990346416 5:54876184-54876206 CTGGGAGCACTATGGGAGACTGG - Intergenic
991443958 5:66680381-66680403 CCTGGAGGACAAAGGGAGTCAGG - Intronic
993320540 5:86463842-86463864 CTGGCAGCACAATGCGAGGCAGG + Intergenic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
993628687 5:90257593-90257615 CTTGGAGAACAAAGGGAAAGGGG + Intergenic
995115247 5:108471659-108471681 CTGGCAGATCTAGGGGAGGCAGG - Intergenic
995593967 5:113729175-113729197 CTGGGAGTGCTAAGGGAGACTGG + Intergenic
995915116 5:117236245-117236267 CTGGGAGGGCAAAGGGAGTTGGG + Intergenic
996893172 5:128447444-128447466 CTGGGAGCACTAAGGGAGACCGG - Intronic
997089752 5:130843154-130843176 CTGGGAGCACTATGGGAGACTGG - Intergenic
997197072 5:131987448-131987470 TGGGGAGCACATAGGGAGGCAGG + Intronic
997748447 5:136320633-136320655 CAGGGAGAAAATGGGGAGGCTGG - Intronic
997964760 5:138348178-138348200 CTGAGAGACCATAGGGAGGTTGG + Exonic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998940016 5:147271711-147271733 CTGGGAGCACTATGGGAGACTGG - Intronic
998985920 5:147756635-147756657 CTGAGAGAAGAAAAGGAGGGTGG + Intronic
999369374 5:151044621-151044643 GCGGGAGGACAAGGGGAGGCAGG + Intronic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
999695174 5:154182434-154182456 GTGGGAGTAGAATGGGAGGCAGG - Intronic
999937377 5:156501806-156501828 CTGGGATTACAATGGGAGCCTGG + Intronic
1000471783 5:161652072-161652094 CTGGGAGCACTATGGGAGACTGG + Intronic
1000475706 5:161704310-161704332 CTGGGAGGACACAATGAGGCTGG + Intergenic
1000615259 5:163419118-163419140 CTGGGAGCACTATGGGAGACTGG - Intergenic
1001189765 5:169618868-169618890 CTGGGAGCACTACGGGAGACTGG - Intergenic
1001304140 5:170559467-170559489 CTTAGAGGACAAAGGGAGGGTGG - Intronic
1001536715 5:172503234-172503256 CTGGGAGAAGAAAGAGAAGATGG - Intergenic
1001711303 5:173780559-173780581 TTTGGAGAACAAAAGGAGGAAGG - Intergenic
1001902869 5:175445469-175445491 CTGGGGCAACCAGGGGAGGCTGG - Intergenic
1002098187 5:176844366-176844388 CCAGGAGAACAGAGTGAGGCTGG - Intronic
1002615172 5:180448620-180448642 CTGGGAGAACAGGTGCAGGCCGG + Intergenic
1002636583 5:180611809-180611831 TTGGGAGAACTTAGCGAGGCTGG - Intronic
1002719099 5:181247029-181247051 CTGGGTCAGCAAAGGGAGCCCGG + Intronic
1003426219 6:5999920-5999942 CGGGGAGAAGAGAGGCAGGCAGG - Intronic
1003940571 6:11021281-11021303 TTGGGAGAACAAGGGGGGCCAGG - Intronic
1004360354 6:14965403-14965425 CTGGGAGAACAAAGACAGCTAGG - Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005501620 6:26433896-26433918 CTGGGAGCGCAACGGGAGACCGG - Intergenic
1005885668 6:30095871-30095893 CTGGGAGAACAATGGATGTCCGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006046806 6:31305820-31305842 CCTGGAGAAGAAAGGGAAGCTGG + Intronic
1006238394 6:32656191-32656213 CTGGGAGCACTACGGGAGACTGG + Intergenic
1006284125 6:33080323-33080345 CTGGGAGAAAAAACAGGGGCGGG - Intronic
1006642490 6:35496486-35496508 CCGGGAGTCCAAAGGGCGGCGGG + Intronic
1006826633 6:36940634-36940656 GAGGGAGAAGAAAAGGAGGCGGG + Intergenic
1008078442 6:47170090-47170112 TTGGGAGCACACAGGGAGTCAGG + Intergenic
1008100482 6:47385316-47385338 CTGGGAGCACTATGGGAGACTGG - Intergenic
1008585471 6:52944510-52944532 CTGGGAGCACTATGGGAGACTGG - Intergenic
1008909706 6:56720080-56720102 CTGGGAGCACTATGGGAGACTGG + Intronic
1008957014 6:57226698-57226720 ATGGGAGAGCAATGGAAGGCCGG + Intergenic
1009296533 6:61957554-61957576 CTGGGAGCACTACGGGAGACCGG - Intronic
1010102988 6:72131772-72131794 CTGGGAGCACTATGGGAGACTGG + Intronic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1011420723 6:87169335-87169357 CTGGAAAAAAAAAAGGAGGCTGG - Intronic
1011494443 6:87924778-87924800 CTGGGAGAATAAAAGGTGGGTGG + Intergenic
1011959802 6:93073525-93073547 CTGGGAGCACTATGGGAGACTGG - Intergenic
1012216506 6:96592170-96592192 CTGGGAGCACTATGGGAGACTGG + Intronic
1012460694 6:99457030-99457052 CTGGGAGCACTATGGGAGACTGG - Intronic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1015890823 6:137968051-137968073 CTGGGAGATCAAAGTGATGGTGG - Intergenic
1016586811 6:145697541-145697563 CTGGGAGCACTATGGGAGACTGG + Intronic
1016632012 6:146243806-146243828 CTGGGAGCACTACGGGAGACTGG + Intronic
1016834134 6:148460054-148460076 CAGACAGAACAAAAGGAGGCAGG + Intronic
1016866630 6:148773946-148773968 CGGGGAGGACAGAGGGAAGCTGG - Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017456333 6:154604479-154604501 CTGGGAGGGGACAGGGAGGCAGG - Intergenic
1017791721 6:157805474-157805496 CTGGGAGCCCACATGGAGGCAGG - Intronic
1018137414 6:160790667-160790689 TTGGGAGAAGAAAGGGAAACGGG + Intergenic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1018828550 6:167424531-167424553 TTTGGGGAACAAAAGGAGGCCGG - Intergenic
1018907847 6:168085602-168085624 CTGTGAGAACAAAGGGACCAAGG + Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019478628 7:1255956-1255978 CTGGCAGATCAGAGGCAGGCGGG + Intergenic
1019896762 7:3989084-3989106 ATAGGATAACAGAGGGAGGCCGG - Intronic
1020048476 7:5062666-5062688 CTGGGAGCACTATGGGAGACTGG + Intronic
1020387759 7:7626445-7626467 CTGGGAGCACTATGGGAGACTGG + Intergenic
1021102355 7:16598469-16598491 TTGGGGGAAAAAAGGCAGGCAGG - Intergenic
1021130053 7:16900475-16900497 CATGGAGAACAAAGAGAAGCAGG - Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1022506626 7:30911787-30911809 GGGGGAGCACAAAGGGAGGAAGG - Intergenic
1022740071 7:33112243-33112265 CTGGGAGAACATATGGGGGCAGG - Intergenic
1023484383 7:40668993-40669015 CTGAGACCACATAGGGAGGCTGG + Intronic
1024497434 7:50064467-50064489 CTGGGAGCACTATGGGAGACTGG + Intronic
1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG + Intergenic
1024942364 7:54776093-54776115 CTGGGAGCACTATGGGAGACTGG - Intergenic
1025600153 7:62986705-62986727 CTGGGAGCACTATGGGAGACTGG + Intergenic
1025760065 7:64381451-64381473 CTGGGAGCACTATGGGAGACTGG - Intergenic
1027239398 7:76317607-76317629 CTGGGATACCAAAGAGAGGCAGG + Intergenic
1028470735 7:91203940-91203962 CTGAAAGAACAAGGGTAGGCTGG + Intronic
1028524418 7:91767904-91767926 CGGGGAAAAAAAAGGGAGACAGG + Intronic
1028719217 7:94010606-94010628 CTGGAAGAAAAAAGGAAGGAAGG - Intergenic
1028787045 7:94807337-94807359 CTGGGAGCACTATGGGAGACTGG + Intergenic
1028842103 7:95439811-95439833 CTGGGAGAAAAGAGGGGAGCAGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029714578 7:102318938-102318960 ATGGGGGAACAAAGGGTGGGTGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030688443 7:112509335-112509357 CTGTCAGCAGAAAGGGAGGCTGG + Intergenic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1032063105 7:128741277-128741299 GTTGGAGAACACAGGCAGGCAGG + Intronic
1032539922 7:132694421-132694443 ATGGGTGGAGAAAGGGAGGCTGG - Intronic
1032723503 7:134570175-134570197 CTGGGAGCACAACAGGAGTCCGG - Intronic
1033257742 7:139816797-139816819 CTTGGAGAACTAAGGAAGGCAGG - Intronic
1033644314 7:143288755-143288777 TGGGTTGAACAAAGGGAGGCTGG - Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1033999104 7:147389301-147389323 TTGGGAGGTCCAAGGGAGGCTGG - Intronic
1034004368 7:147452938-147452960 GAGGGAGAAGAAAGGGAGGGAGG + Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034860645 7:154592052-154592074 CTGCGAAAGCAAAGGGAGCCTGG - Intronic
1034959034 7:155352804-155352826 CTGGGAGAACAGGGGAAGCCTGG + Intergenic
1035123675 7:156591482-156591504 CTGGGAGCACTATGGGAGACTGG - Intergenic
1035236457 7:157500707-157500729 CGGGGAGAACAAGGGGAGGGAGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035471727 7:159114273-159114295 ATGGGAGGAGAAGGGGAGGCAGG + Intronic
1035686890 8:1530159-1530181 CTGGGAGCACTATGGGAGACTGG + Intronic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1037109771 8:15152238-15152260 CTGGAAGAACAAAGCAAGGCAGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1038786569 8:30622624-30622646 CTGGGAGCACTATGGGAGACTGG + Intronic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1039475928 8:37839408-37839430 CTGGGAGAGCCACGGGGGGCAGG - Intronic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040538857 8:48333395-48333417 CTGGGAGCACTATGGGAGACTGG + Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041963315 8:63645660-63645682 CTGGATGAACAAACAGAGGCTGG + Intergenic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045351731 8:101347250-101347272 CTGAGAGGAGAAAGGGAGGAAGG + Intergenic
1045366891 8:101484822-101484844 CTGGAAGAAGGAAGGGAGGAAGG - Intergenic
1045593834 8:103629899-103629921 CTGGCAGTACAAAGGAAGGCAGG + Intronic
1045595639 8:103651245-103651267 CTCAGAGAACAAAGAGAAGCAGG - Intronic
1046076669 8:109320238-109320260 CTGGGAGCACTATGGGAGACTGG + Intronic
1047944158 8:129858348-129858370 CTGGAAGAACCAAAGGAAGCTGG + Intronic
1048382849 8:133883373-133883395 CTGTGAGAGCAAAGGTTGGCAGG + Intergenic
1048825723 8:138423786-138423808 CTGGGAGCACTATGGGAGACTGG + Intronic
1049448225 8:142641403-142641425 GTGTGAGAAGAAGGGGAGGCTGG + Intergenic
1049588193 8:143441470-143441492 CTGGCAGCACAGAGGGAGCCCGG + Intronic
1049610741 8:143553634-143553656 CTGGGAGGAGGGAGGGAGGCCGG - Exonic
1049733213 8:144189706-144189728 CAGGGAGAACAATGGCAGGGCGG - Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1051824376 9:21203036-21203058 ATGGCAGCACAAAGGTAGGCAGG + Intergenic
1052004259 9:23327349-23327371 CTGGGAGAAGAAAAGGAGAGAGG + Intergenic
1052354879 9:27494094-27494116 CTGGGAGCACTATGGGAGACTGG - Intronic
1052410968 9:28120574-28120596 TGGGGTGAAGAAAGGGAGGCGGG - Intronic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055784842 9:79861817-79861839 CTGGGAGCACTATGGGAGACTGG - Intergenic
1055908054 9:81316412-81316434 CTGGGAGCACTATGGGAGACCGG + Intergenic
1056811839 9:89771147-89771169 CTGTGAGAATAAAGGGAGTGAGG + Intergenic
1057442061 9:95090287-95090309 CCAGGAGAACAAACGGATGCCGG + Intergenic
1057705522 9:97392431-97392453 CTGGGAAGTGAAAGGGAGGCTGG - Intergenic
1058268431 9:102937236-102937258 CTGGGAGCACTATGGGAGACTGG - Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058743429 9:107966689-107966711 CTGGGAGGACAGAGGAGGGCTGG + Intergenic
1058922619 9:109631832-109631854 CTGGGAGCACTATGGGAGGCTGG - Intergenic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060549134 9:124476964-124476986 AGGGGAGGACAGAGGGAGGCAGG - Intronic
1061571925 9:131483159-131483181 CAGGGAGAAAGAAGTGAGGCTGG + Intronic
1061624436 9:131833448-131833470 CTGAGGGAACAAAAAGAGGCTGG - Intergenic
1061738872 9:132684572-132684594 GCGGGAGGACAAAGGGAGGAAGG - Intronic
1061999489 9:134208719-134208741 CTGGCAGAACACAGTGTGGCAGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062430558 9:136525238-136525260 CAGAGAGAACAAGGGGAGCCAGG + Intronic
1185577971 X:1188574-1188596 CTTTGAGTACAATGGGAGGCAGG + Intronic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1185798192 X:2985112-2985134 CTGGGATAACAGAGCAAGGCTGG - Intergenic
1186132071 X:6478718-6478740 CTGGGAGCACTATGGGAGACTGG - Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187933950 X:24318090-24318112 CAGGGATCACAAAGGGAAGCTGG + Intergenic
1189538687 X:41963774-41963796 CTGGGAGAAGAATGAGAGGCAGG + Intergenic
1190034484 X:47008761-47008783 CTGGGAGGAGACAGGGAAGCAGG + Intronic
1190616298 X:52236532-52236554 CTGGGAGCACTATGGGAGACTGG - Intergenic
1191148399 X:57193261-57193283 CTGGGAGCACTATGGGAGACTGG - Intergenic
1191803114 X:65103128-65103150 CTGGGAGCACTATGGGAGACCGG + Intergenic
1192077634 X:68016655-68016677 CTGGGAGCACTATGGGAGACTGG - Intergenic
1192081097 X:68048710-68048732 CTTGGAGAACCCAGGGAAGCTGG + Intronic
1192579175 X:72266769-72266791 TTGGGAGAAAAAAGGGAGGGTGG - Intronic
1192903018 X:75520952-75520974 CTGGGATAAACTAGGGAGGCAGG - Intronic
1194194942 X:90881523-90881545 CTGGGAGCACTATGGGAGACTGG - Intergenic
1194535921 X:95105853-95105875 CTGGGAGCACTATGGGAGACTGG - Intergenic
1194800772 X:98269696-98269718 CTGGGAGCACTACGGGAGACTGG - Intergenic
1195052024 X:101105734-101105756 CTGAGATATCAAAAGGAGGCTGG - Intronic
1195580989 X:106502421-106502443 CTAGGACAACAAAGGGAGACAGG - Intergenic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1195734296 X:107997090-107997112 CTGGGAGCACTATGGGAGACTGG - Intergenic
1196843817 X:119882450-119882472 CTGAGAGTACATTGGGAGGCTGG - Intergenic
1197252424 X:124229638-124229660 CAGGGAGAAATAGGGGAGGCTGG + Intronic
1197659468 X:129154582-129154604 GCTGGGGAACAAAGGGAGGCAGG + Intergenic
1198215355 X:134549897-134549919 CGGGGAGAAAAAACGGAGGATGG + Intergenic
1198466726 X:136910136-136910158 CTGGCAGAACAAAAAGAGACTGG - Intergenic
1198912444 X:141629605-141629627 CTGGGAGCACTATGGGAGACTGG - Intronic
1199316098 X:146379687-146379709 CTGGGAGAAAAAAGGTACCCTGG + Intergenic
1199337719 X:146640136-146640158 CTGGGAGCACTACGGGAGACTGG - Intergenic
1200016279 X:153166089-153166111 CTGGGAGCACTATGGGAGACTGG - Intergenic
1200104023 X:153702528-153702550 GTGGGAGACCAAAGACAGGCAGG + Intronic
1200541563 Y:4463931-4463953 CTGGGAGCACTATGGGAGACTGG - Intergenic
1201768719 Y:17596978-17597000 CTGGGAGCACTATGGGAGACTGG - Intergenic
1201832835 Y:18309007-18309029 CTGGGAGCACTATGGGAGACTGG + Intergenic
1202238237 Y:22737580-22737602 CTATGTGAACAAAGGGAGACAGG - Intergenic
1202328771 Y:23722570-23722592 CTGGGAGCACTATGGGAGGCTGG - Intergenic
1202542000 Y:25947484-25947506 CTGGGAGCACTATGGGAGGCTGG + Intergenic