ID: 1168430899

View in Genome Browser
Species Human (GRCh38)
Location 19:56279066-56279088
Sequence CCCTTTCAGCAGAAGACGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 2, 2: 12, 3: 18, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168430895_1168430899 -6 Left 1168430895 19:56279049-56279071 CCAAACCACTCAGGCTTCCCTTT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG 0: 1
1: 2
2: 12
3: 18
4: 123
1168430892_1168430899 15 Left 1168430892 19:56279028-56279050 CCCAAACATTCTAATCAAATGCC 0: 1
1: 3
2: 16
3: 32
4: 219
Right 1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG 0: 1
1: 2
2: 12
3: 18
4: 123
1168430891_1168430899 25 Left 1168430891 19:56279018-56279040 CCTGGGGCAGCCCAAACATTCTA 0: 1
1: 4
2: 10
3: 30
4: 158
Right 1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG 0: 1
1: 2
2: 12
3: 18
4: 123
1168430893_1168430899 14 Left 1168430893 19:56279029-56279051 CCAAACATTCTAATCAAATGCCA 0: 1
1: 3
2: 16
3: 37
4: 242
Right 1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG 0: 1
1: 2
2: 12
3: 18
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168430899 Original CRISPR CCCTTTCAGCAGAAGACGGA TGG Intronic
901445136 1:9303910-9303932 CCCTGTCAGCAGAAAAGGGATGG - Intronic
904323833 1:29714275-29714297 CCCTTAGAGCACAAGACAGATGG - Intergenic
905294807 1:36947422-36947444 GCTTTTGAGCAGAGGACGGATGG - Intronic
906244227 1:44261945-44261967 CTCTTTCAGCAGAACAGGAAGGG + Intronic
908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG + Intergenic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
910407432 1:86904173-86904195 CACATCCAGCAGAAGAAGGACGG + Intronic
910510098 1:87993840-87993862 CCCTTTGTGCAGTAGACAGAGGG - Intergenic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
916602340 1:166305341-166305363 ACCTTTCAGCAGAGGCTGGAAGG + Intergenic
917041398 1:170809810-170809832 TCCTTTCAGCAGAAGACCCTGGG - Intergenic
919023349 1:192136575-192136597 CGCTTTTAGCAGAAGACTCAGGG - Intergenic
922415156 1:225414814-225414836 TTCTCTCAGCAGAAGACAGATGG + Intronic
1071600391 10:86956043-86956065 CCCTTTCATCAAAAGGCGGAAGG + Intronic
1075604355 10:123793542-123793564 CCCTTTCAGGAGAAGCCTGGTGG - Intronic
1077922232 11:6650303-6650325 CCCTTTCACCAGGAGACACAGGG + Intronic
1079528557 11:21420677-21420699 CCCTGTCATCAGAAGACTGGAGG + Intronic
1079777931 11:24557879-24557901 TCCTTTCAGCAGAAGAGAAACGG - Intronic
1079849915 11:25519038-25519060 TCCTCTCATCAGAAGAAGGAAGG + Intergenic
1081378866 11:42390487-42390509 CTCTTTCAACAGCAGACTGATGG + Intergenic
1085481087 11:76823604-76823626 CCCTTTCAGGAGAAGGAGGTGGG + Intergenic
1086807843 11:91267547-91267569 CCCTTTCAGCAGAAAAGGGTTGG + Intergenic
1087688295 11:101290240-101290262 TTCTTTCAGCAGAAGAGGGATGG - Intergenic
1090407807 11:126487884-126487906 CCCTTTCAGGACAGGACAGAAGG - Intronic
1093272722 12:17084166-17084188 CTCTTTCAGCAGAAGAGGAATGG - Intergenic
1095732493 12:45521187-45521209 CCCTTTCAGCAGAAGAGGGGTGG + Intergenic
1100193362 12:92217088-92217110 CCATTTCAGAATAAGAAGGAAGG - Intergenic
1101158558 12:101951181-101951203 CACTTGGAGCAGAAGACAGAGGG - Intronic
1101992689 12:109500442-109500464 CCCTTGCAGCAGAAAACTAAAGG + Intronic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1105753506 13:23444019-23444041 CCCTTTCAGCAGAAGAGGGATGG - Intergenic
1105836958 13:24220700-24220722 TCCATTCATCAGAAGACTGATGG - Intronic
1106653726 13:31719698-31719720 CCCTTTCAGAAGAAGACAGGCGG + Intergenic
1107869577 13:44734685-44734707 CCCTCTCAGCAGCCGAGGGAAGG - Intergenic
1108409276 13:50130672-50130694 CCCTTCCAGAAGAAAACTGAAGG + Intronic
1108841917 13:54628213-54628235 CCCTTTCAACAGAAGTGAGATGG + Intergenic
1109388641 13:61665889-61665911 CCCTTGCAGCAGAAGAGGATGGG + Intergenic
1111034140 13:82648409-82648431 CCATTTCAGCAGAAGATGTCAGG + Intergenic
1112311016 13:98317628-98317650 CACTTACAGCAAAAGACAGAGGG - Intronic
1114320528 14:21543692-21543714 TTCATTCAGCAGAAGATGGAAGG + Intergenic
1116778781 14:49212762-49212784 CCCTTTCAGCGGAAGAGGGATGG - Intergenic
1120249928 14:82050974-82050996 CCCTTTAAGCAGAAGACAAAGGG - Intergenic
1121021345 14:90582057-90582079 CCTTTTGAGCTGAAAACGGAGGG - Intronic
1121623337 14:95365751-95365773 TCCTGTCAGCAGAAAAGGGAGGG - Intergenic
1127731422 15:61805774-61805796 CCCCTTCAGGAGAAAAGGGATGG + Intergenic
1128873984 15:71187055-71187077 CCTTTTCAGCAGAGGAAGGCGGG + Intronic
1129452776 15:75659994-75660016 CCCTTTCAGCAGGAGATTGGGGG + Exonic
1129534479 15:76300907-76300929 ACCTTTCAGCAGAAAACCTAAGG - Intronic
1130029282 15:80296860-80296882 TCCTTTCAGCAGAAGAGGAATGG + Intergenic
1130124636 15:81082809-81082831 CCCTTACAGAATAAGACGTAAGG - Intronic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1131610654 15:93958035-93958057 CCCTTACAAAAGAAGACTGAGGG - Intergenic
1133379320 16:5316740-5316762 CCCTTTCAGCAGAAGAGAGATGG - Intergenic
1135246099 16:20858330-20858352 CCCTTTCCTCACAAGAGGGAGGG - Exonic
1135622399 16:23967309-23967331 CCCTGACAGCAGAAGACAAAAGG + Intronic
1136579749 16:31144002-31144024 CCCTGTAAGCAGAAGGCCGATGG + Intronic
1138836383 16:60441144-60441166 ACCTTTGAGCAGAAGATGAAAGG + Intergenic
1140253719 16:73317257-73317279 CCCTTTAAACAGAAGCCGGGGGG + Intergenic
1140923800 16:79564224-79564246 TTGTTTCAGGAGAAGACGGAAGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143265345 17:5632685-5632707 CCCTTTCAGCAGGTGAAGGACGG + Intergenic
1143269954 17:5668111-5668133 CCCTCTTAGTAGTAGACGGATGG - Intergenic
1143377856 17:6477995-6478017 CCCTGCCAGCAGCAGCCGGAAGG - Exonic
1147779043 17:42926440-42926462 TCCATTCACCAGAAGACTGATGG + Intergenic
1147837672 17:43346550-43346572 CCCTTTCCTCACAAGAGGGAGGG + Intergenic
1148811343 17:50293836-50293858 CACTTTCAGCAACAGACAGATGG + Intergenic
1148978181 17:51547776-51547798 ACCGTTCAGCAGAACACAGAGGG + Intergenic
1150021721 17:61621841-61621863 CCCCTTCAGCAGAAGAGAGATGG + Intergenic
1150133624 17:62682223-62682245 CCCTTTCCGCAGAGGACTGGGGG + Exonic
1151318353 17:73337616-73337638 CCCTTTAAAGAGAGGACGGATGG + Exonic
1151470780 17:74316455-74316477 CCATTCCAGCATCAGACGGAGGG + Intergenic
1152241885 17:79165231-79165253 CCCTTTCAGAAGATGACACAAGG - Intronic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1153895840 18:9558883-9558905 CCCTTTCAACAGAACACACAAGG - Intronic
1155182689 18:23361696-23361718 CCCATCCTGCAGGAGACGGAAGG + Intronic
1155678493 18:28459593-28459615 CCCTGTCAGTAGAAGAGGGATGG + Intergenic
1160210985 18:76879564-76879586 CCCATCCAGAAGAAAACGGATGG - Intronic
1161778902 19:6278955-6278977 TCCCTGCAGCAGAAGACCGAAGG + Intronic
1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG + Intronic
926743865 2:16134823-16134845 ACCTTTCAGCAGGATAGGGATGG + Intergenic
927567206 2:24123576-24123598 CCCTTCCAGCCGCAGTCGGACGG + Intronic
933140473 2:78786946-78786968 CCCTTGCATCAAAAGAGGGATGG - Intergenic
935316272 2:101837397-101837419 TCCTGCCAGCAGAAGACAGAGGG - Intronic
937361691 2:121234114-121234136 CCCCTGCAGCAGAAGCGGGACGG - Exonic
940063570 2:149600069-149600091 TCCTTTCAGCGGAAGAGCGAAGG + Intergenic
1171458056 20:25282983-25283005 CCCTCTCAGAAGAGGAAGGAGGG + Intronic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1173434348 20:43019274-43019296 CCCTTTTAGCAGAAATGGGATGG - Intronic
1174328883 20:49801935-49801957 CACTTTCAGCTGAGGACTGACGG + Intergenic
1175329894 20:58156290-58156312 CCCTTTGAGCTGAGGACTGAAGG + Intronic
1178158161 21:29879159-29879181 AACTTTCAGTAGAAGACAGAGGG + Intronic
1184839192 22:47042694-47042716 CCCTCTCAGCAGTGGACAGATGG - Intronic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
949805719 3:7953267-7953289 CCCTTTCAGCAGAAAAGGGAAGG + Intergenic
954196213 3:48998687-48998709 GCCTTTCAGGACAAGAGGGAGGG - Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
957140940 3:76355924-76355946 CCCTTACAGCAGCAGCCTGATGG + Intronic
957586991 3:82145800-82145822 CTCTTTTAGCAGAAAAGGGATGG - Intergenic
957758478 3:84523173-84523195 CCATTTCAGCACAAGACGCAAGG + Intergenic
959829353 3:110841961-110841983 CCATTTAAGCAGAAGTCAGATGG + Intergenic
965844463 3:172945981-172946003 CCCTTTCTGAAGCAGAAGGAAGG - Intronic
966989191 3:185211452-185211474 CCATTACAGCAGAAGAAGAAGGG - Intronic
967690343 3:192466513-192466535 CCTCCTCAGCAGAAGACGAAAGG + Intronic
969902590 4:10363439-10363461 CCCCATCAGCAGAAGATGGTTGG + Intergenic
973716844 4:53685276-53685298 CCCTTGCTGGAGAAGAGGGAGGG - Intronic
974633892 4:64533455-64533477 CCCTTTCAGGGGAAGTGGGATGG - Intergenic
981713662 4:147732512-147732534 CTCTCTCGGCAGGAGACGGAGGG + Intronic
986142077 5:5040392-5040414 CCATTTTAGAAGAAGAAGGAAGG + Intergenic
986501392 5:8403624-8403646 GCCTGTCATCAGAAGACAGAAGG - Intergenic
987199653 5:15563090-15563112 CCTTTCCAGCAGAAGACATATGG - Intronic
988308778 5:29529763-29529785 CCAATTCAGCAGATGATGGAAGG + Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
990308521 5:54517282-54517304 CTCCTTGAGCAGAAGAGGGAAGG + Intergenic
996831498 5:127745137-127745159 TCCTGTCTGCAGAAGACAGATGG - Intergenic
996976518 5:129440826-129440848 CCCTTTCAGCAGAAGCAGAATGG + Intergenic
998059766 5:139110777-139110799 CCCTGTCTTCAGAAGAGGGAAGG + Intronic
998855176 5:146387736-146387758 CCATTTGAGGAGAAGAAGGAAGG - Intergenic
1000292658 5:159885065-159885087 CCCTCTCATCAGAAGATGCAGGG + Intergenic
1000369482 5:160520913-160520935 CCCTTGCAGCAGAAGAGGGAAGG - Intergenic
1001100888 5:168813485-168813507 TCCTTTCAGCAGAAGCTGAAGGG + Intronic
1002539066 5:179894123-179894145 CCAGTTCAGCAGAAGAGGGCAGG + Intronic
1003110380 6:3247991-3248013 CCGTTTCAGCAGGAGAGAGACGG + Intronic
1008246356 6:49178739-49178761 CTCCTTCAGCAGAAGAAAGATGG - Intergenic
1011442017 6:87397673-87397695 CCCTTTCTGCAGACCACAGAAGG - Exonic
1015129783 6:129796213-129796235 CTCTTTCAGCAGAAGAGTGGGGG - Intergenic
1015254422 6:131162136-131162158 CCCCTTCCGGAGAAGACTGATGG + Intronic
1016594950 6:145788642-145788664 TCCTTTCAGCAGAAGAGGGATGG - Intergenic
1017444943 6:154499141-154499163 TCCTTTCTGCAGAATAGGGAGGG - Intronic
1019142033 6:169954438-169954460 CTCTTTTGGCAGAAGAGGGATGG - Intergenic
1019956386 7:4418119-4418141 CGCTTTCAGGAGAAGAGGGAGGG - Intergenic
1020497646 7:8876286-8876308 CCCTTTCAGCAGAAGAGGACAGG + Intergenic
1020718704 7:11713491-11713513 CCCTTTCAGCAGATTACTCATGG + Intronic
1024163801 7:46709260-46709282 CCCTTTCAGCAGAAGACAGGTGG - Intronic
1025236320 7:57237117-57237139 CCCTTTGAGCAGAGGCCTGAAGG - Intergenic
1026900408 7:74033823-74033845 CCCTTTCAGCAAAAGCAGTAAGG + Intronic
1028249411 7:88523300-88523322 CATTTACAGCAGAAGACTGAAGG - Intergenic
1030586680 7:111429358-111429380 ATCTTTCAGCAGAAGAGGCAAGG + Intronic
1031201719 7:118696996-118697018 CCCTTTCAGCAGAAGAGGCATGG - Intergenic
1031449242 7:121894184-121894206 TCCTGTCAGCAGTATACGGAAGG + Intronic
1035339924 7:158153607-158153629 CCGTTTCAACAGGACACGGAGGG + Intronic
1035674211 8:1443469-1443491 CTCTTGCAGGAGAAGACTGAGGG - Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036506005 8:9356673-9356695 CTCTTTCAGCCGTAGACTGAGGG + Intergenic
1038290395 8:26244112-26244134 CCCTTTAATCAGAACAAGGAAGG - Intergenic
1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG + Intronic
1038521516 8:28236245-28236267 CCCTTCCAGCAGGAGAAGGGAGG - Intergenic
1042732669 8:71954593-71954615 CTCTTTCAGCACAAGAGAGAAGG - Intronic
1052168519 9:25364196-25364218 CCCTTTTAGCAGAAGAAAGATGG - Intergenic
1056543567 9:87594813-87594835 CCCTTTCACCAGTAGCCAGAAGG + Intronic
1060549784 9:124479474-124479496 CCCATTCGACAGAAGACGGATGG - Intergenic
1061321494 9:129833489-129833511 CCCTTTCAGATGAAGACAGGTGG - Exonic
1191111222 X:56804273-56804295 CCCTTCTAGCAGAAGAAGGTCGG + Intergenic
1192990307 X:76446356-76446378 CACTTTCAGCATTAGACAGATGG - Intergenic
1195247073 X:103004551-103004573 CCCTTTCCCCAGCAGACAGATGG + Intergenic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1199987381 X:152962435-152962457 CCATGTCAGCAGAATACTGAAGG - Intronic