ID: 1168435076

View in Genome Browser
Species Human (GRCh38)
Location 19:56310229-56310251
Sequence CCCTCCACACAGGCAGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168435076_1168435083 4 Left 1168435076 19:56310229-56310251 CCCTGGACTGCCTGTGTGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1168435083 19:56310256-56310278 GAACTGGGTCCTTTAAGGAATGG 0: 1
1: 0
2: 1
3: 26
4: 188
1168435076_1168435087 22 Left 1168435076 19:56310229-56310251 CCCTGGACTGCCTGTGTGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1168435087 19:56310274-56310296 AATGGCACCTGGGTGCCCAGAGG 0: 1
1: 0
2: 2
3: 25
4: 215
1168435076_1168435085 12 Left 1168435076 19:56310229-56310251 CCCTGGACTGCCTGTGTGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1168435085 19:56310264-56310286 TCCTTTAAGGAATGGCACCTGGG 0: 1
1: 0
2: 0
3: 10
4: 120
1168435076_1168435088 27 Left 1168435076 19:56310229-56310251 CCCTGGACTGCCTGTGTGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1168435088 19:56310279-56310301 CACCTGGGTGCCCAGAGGCATGG 0: 1
1: 0
2: 4
3: 31
4: 407
1168435076_1168435084 11 Left 1168435076 19:56310229-56310251 CCCTGGACTGCCTGTGTGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1168435084 19:56310263-56310285 GTCCTTTAAGGAATGGCACCTGG 0: 1
1: 0
2: 0
3: 13
4: 143
1168435076_1168435082 -1 Left 1168435076 19:56310229-56310251 CCCTGGACTGCCTGTGTGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1168435082 19:56310251-56310273 GTAATGAACTGGGTCCTTTAAGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168435076 Original CRISPR CCCTCCACACAGGCAGTCCA GGG (reversed) Intronic
900163775 1:1236682-1236704 GGCCCCACACAGCCAGTCCAAGG - Intergenic
900471156 1:2855591-2855613 CCCTCCACTCAGGGAGCGCACGG + Intergenic
900875257 1:5337982-5338004 CACTACAGACAGGAAGTCCAGGG - Intergenic
904272852 1:29361956-29361978 CCCTGCACACAGGGAGGACAGGG - Intergenic
904475522 1:30762308-30762330 CCCCTCAGCCAGGCAGTCCAGGG + Intergenic
904600048 1:31668155-31668177 CCTTACTCACAGGCAGTCCTGGG + Exonic
905174081 1:36125368-36125390 CCCTCCACACACGCGCTCCCGGG + Intergenic
905390492 1:37633240-37633262 CCCTCCCCACACCCAGTCCTGGG - Intronic
905404304 1:37722866-37722888 CCCTCCACCCAGAAAGTCCCTGG - Intronic
905731723 1:40303093-40303115 CCCTCCTCACAGTCAGTTCGAGG - Intronic
906580322 1:46930433-46930455 CCCTGCACACATACAGCCCATGG + Intronic
906795640 1:48694528-48694550 CCCACCACAAAGTCAGCCCATGG + Intronic
907459527 1:54597177-54597199 CCCTCCCCACAGGCAGCCCTGGG - Intronic
907589142 1:55649286-55649308 CCCTCCCCACACACAGTCCCCGG + Intergenic
908456503 1:64309603-64309625 GCCTCCACACTGACAGTGCAGGG + Intergenic
908483073 1:64563101-64563123 CCCTGCACACATACAGTTCAGGG + Intronic
912152511 1:106878028-106878050 CTCTCCACACAGTCACCCCAGGG + Intergenic
919906562 1:202082478-202082500 CCTCCCAAAAAGGCAGTCCAGGG - Intergenic
920960031 1:210655848-210655870 CCCCCCAGAAAGTCAGTCCAAGG - Intronic
922191239 1:223320444-223320466 CCTTCCACACAGGCATACCCTGG + Intronic
923634266 1:235679845-235679867 TCTTCCACAGAGGCTGTCCAAGG + Intronic
924377842 1:243431604-243431626 GTGTCCACAAAGGCAGTCCAGGG + Intronic
1065101164 10:22334685-22334707 CCCTCCACAGCGGCAGGCCGAGG + Intergenic
1066006511 10:31150825-31150847 ACCTCCACACAGGCCTGCCAGGG - Intergenic
1068388024 10:56358328-56358350 CCTTCCACACTTGCAGTCCAGGG + Intronic
1073498145 10:103912613-103912635 CTCTGCACACAGGCACTCCAAGG - Intronic
1076043292 10:127269845-127269867 CCCACCACCCATGCAGTCCTTGG + Intronic
1076364575 10:129913796-129913818 CCCTGCACACAGGCAGGACTCGG + Intronic
1076573632 10:131449356-131449378 CCCTCCCCACAACCAGGCCAAGG - Intergenic
1076686894 10:132202242-132202264 CCGTCCACACAGCCTGTCCCAGG + Intronic
1076808338 10:132871304-132871326 CACTGCACCCATGCAGTCCATGG + Intronic
1076815654 10:132913592-132913614 GCCTCCACCCAGCCAGTCCGTGG + Intronic
1077330698 11:1982698-1982720 CCCTCCACACAGGCTGTGTGGGG + Intronic
1078265803 11:9755744-9755766 CACCACACACAGGCAGTCCATGG + Intergenic
1079110606 11:17603067-17603089 CCCTCCACAAAGCCCTTCCATGG - Intronic
1079308352 11:19344255-19344277 CCCACCACACAGGGTGCCCAAGG - Intergenic
1081220772 11:40458207-40458229 ACACACACACAGGCAGTCCATGG - Intronic
1081568633 11:44276045-44276067 CCTTCCACCCAGGGAGGCCATGG - Intronic
1081733956 11:45390876-45390898 TCCTCCAAACAGGCACTCCATGG + Intergenic
1082002972 11:47403860-47403882 CCCTCCACTCTGGCAATCGAGGG - Intergenic
1082636378 11:55599392-55599414 AACTCCAGACAGGCAGACCATGG + Intergenic
1084649897 11:70483001-70483023 CACTCCACTCGGGGAGTCCAGGG - Intronic
1085031475 11:73273510-73273532 CCAGCCACACAGGGAGTCGAGGG - Intronic
1085405722 11:76260604-76260626 CACGCCACACAGGCCGTCCTGGG - Intergenic
1088096353 11:106105407-106105429 CCCTCCAAACAGGCAGCCTTAGG - Intergenic
1088560878 11:111114977-111114999 CCATCCACACAGGTAGTAGAAGG - Intergenic
1089326613 11:117661768-117661790 CCCTCCATCCAGGCAGTGCCAGG - Intronic
1089604481 11:119634032-119634054 CCCCAAACACATGCAGTCCAAGG - Intronic
1090282791 11:125470599-125470621 CACTGGACACAGGCAGTGCAAGG + Intronic
1092059646 12:5537961-5537983 ACCTCCACACAGGCTGTGGAGGG + Intronic
1092225353 12:6744879-6744901 CCCCCAACACAGGCTCTCCAAGG + Intergenic
1100090214 12:90958828-90958850 CCCTCCACACGGCGTGTCCACGG - Intergenic
1102162437 12:110780653-110780675 CCATCCACACAGGAGGTGCAAGG - Intergenic
1106824476 13:33504791-33504813 CCCTGCACATTGGCAGGCCAAGG - Intergenic
1110635820 13:77766192-77766214 CCCTCTAAAGAGGCAGCCCAAGG + Intergenic
1113240924 13:108336084-108336106 CCAGCAACACAGGCAGCCCAGGG + Intergenic
1113933614 13:113981630-113981652 CCCACTACACTGGCCGTCCAGGG + Intronic
1117932264 14:60855570-60855592 CGCTCCACCCAGGAAGTGCAAGG - Intronic
1120788232 14:88556033-88556055 CACACCACACACGCAGTACAAGG + Intergenic
1121424928 14:93843550-93843572 ACCTCAAAACAGGAAGTCCAAGG - Intergenic
1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG + Intergenic
1122265489 14:100544790-100544812 CCCGCCACTCAGGCAGCACAGGG + Intronic
1123123533 14:105929060-105929082 CCCTCCACACAGGCATCCTCAGG + Intronic
1123406176 15:20020561-20020583 CCCTCCACACAGGCATCCTCAGG + Intergenic
1123515506 15:21027209-21027231 CCCTCCACACAGGCATCCTCAGG + Intergenic
1123758854 15:23417157-23417179 CCCCACACCCAGGCAGTCCGAGG - Intergenic
1127608089 15:60610221-60610243 CACTACACACACACAGTCCAGGG + Intronic
1127917459 15:63466957-63466979 CCCTCCACAAAGGTGGGCCAGGG + Intergenic
1128258839 15:66217755-66217777 CTGTCCACACAGCCAGTCCCTGG + Intronic
1128469144 15:67937439-67937461 TCCTGCACAGAGGCAGTCCTTGG + Intergenic
1129491530 15:75930963-75930985 TCCTCCTCCCTGGCAGTCCAGGG - Intronic
1130245922 15:82248616-82248638 TCCTCCAAACAGGGAGACCAAGG - Intronic
1131144092 15:90000588-90000610 CCCTCGAGTCAGGCCGTCCAGGG + Intergenic
1132476947 16:144278-144300 CCCTCAACACAGTCAACCCAAGG + Intergenic
1132598195 16:762662-762684 CCCTCCACAGACACAGACCATGG + Exonic
1132941426 16:2510313-2510335 CCCACCACAGAGGCAGGCCCTGG + Intronic
1133104064 16:3495418-3495440 CCCACCACACTGGCCCTCCATGG - Exonic
1133536652 16:6708752-6708774 CCTTCCCCACAGCCAGTCGAAGG - Intronic
1136019356 16:27430134-27430156 CCCTCCCCACCCGCAGACCACGG - Intronic
1137053363 16:35731494-35731516 TCCTCAACCCAGGCAGTCTAAGG - Intergenic
1138202960 16:55103771-55103793 CACTCCACGTAGGCAGTCCCGGG + Intergenic
1138667852 16:58586907-58586929 CCCTCCCCACTGCCAGTCCCTGG - Intronic
1139536754 16:67580446-67580468 CCCTCCTCCCAGGCCATCCAAGG + Intronic
1139675245 16:68519138-68519160 TCCTCGTCACAGGCAGTCCCTGG - Intergenic
1140409586 16:74733917-74733939 CCCTCCTCCCAGGCAATACAGGG - Intronic
1140534553 16:75697713-75697735 CCCGGGCCACAGGCAGTCCATGG + Intronic
1140709898 16:77667720-77667742 ACATAAACACAGGCAGTCCAGGG + Intergenic
1142047809 16:87936863-87936885 CCCTCCTCACATGCACACCATGG - Intergenic
1142065227 16:88058554-88058576 CCTCTCACACAGGCAGTACAGGG + Intronic
1142343289 16:89537893-89537915 CCCACCTGGCAGGCAGTCCACGG - Intronic
1142929116 17:3267276-3267298 CACTCTACCCAGGAAGTCCAGGG - Intergenic
1146399387 17:32491565-32491587 ACCTCGACACAGGGAGTCTAGGG - Intergenic
1147890648 17:43714236-43714258 CCCTCCATCCAGCCACTCCAGGG + Intergenic
1148328166 17:46796076-46796098 CCCTCCACGCCTGCAGGCCAGGG + Intronic
1148709104 17:49663363-49663385 TCCTCCACAAAACCAGTCCATGG + Intronic
1151512714 17:74571070-74571092 CCCTCCCCACTGGCACTCAAGGG + Intergenic
1151539579 17:74758237-74758259 ACCTCCACCCACGCAGTCCAGGG - Intronic
1152067872 17:78121442-78121464 TCCTCCACCCAGCCAGCCCAGGG - Intronic
1152472980 17:80500482-80500504 GCCTCCCCACAGGCAGCCCCTGG - Intergenic
1153675448 18:7452569-7452591 TCCTCCACACAGGGTGCCCAAGG + Intergenic
1154161869 18:11986468-11986490 CCCTCCACACAGTGGGTCCTTGG + Intronic
1154337574 18:13477803-13477825 CCCTGCTGACAGGCAGTCAAGGG + Intronic
1157335851 18:46736896-46736918 CCCTCCACCCACACAGTCCAGGG + Intronic
1160514388 18:79470534-79470556 CCATCCCCACAGGCAGCACAGGG + Intronic
1160594451 18:79964374-79964396 CGCTCCGCACGGGCAGTGCATGG - Intergenic
1162142866 19:8595315-8595337 TCCTCCAGACAGGGAGTCCCTGG + Intronic
1163760690 19:19134877-19134899 CCCTCCCCCCAGGCGGTCCTCGG - Exonic
1163813129 19:19447163-19447185 CCCTCCACACATGCCCCCCAGGG - Intronic
1165159412 19:33807030-33807052 GCCATCACACAGGCAGTGCAGGG - Intronic
1165520722 19:36311891-36311913 CCCCCCAAACCGGCAGTCCCAGG - Intergenic
1165742372 19:38211642-38211664 CCCTCCACCCAGCCAGGCCTTGG + Intronic
1166730782 19:45057916-45057938 CCCTCCCCACCTGCAGTCCCTGG + Intronic
1167649999 19:50723919-50723941 CCCTCCCAGCAGGCAGTCCTAGG - Exonic
1167740801 19:51323907-51323929 CCCTCCACCCAGCCAGGCCCCGG - Intronic
1168435076 19:56310229-56310251 CCCTCCACACAGGCAGTCCAGGG - Intronic
925107688 2:1307052-1307074 TCCCCCACACACACAGTCCATGG - Intronic
926017705 2:9469321-9469343 CCCTCCCCACAGGCTATCCTGGG + Intronic
927849811 2:26491762-26491784 CCCTGCACACAGGCAGGCTCAGG + Intronic
929056018 2:37876432-37876454 CCCTCCACACCAGCAGCCCCAGG - Intergenic
931927125 2:67085679-67085701 CCCACCAGACAGGGTGTCCAGGG + Intergenic
932417086 2:71580098-71580120 CCCACCACAAAGGGACTCCATGG - Intronic
933800538 2:85956894-85956916 CACTCCCCACAGGAAGTCCTTGG + Intergenic
934612660 2:95752668-95752690 CCCTCCAGACAGCCAGGCTAGGG + Intergenic
934648254 2:96071755-96071777 CCCTCCAGACAGCCAGGCTAGGG - Intergenic
936269937 2:111041728-111041750 CCCTGCACACAGGGAGTCCGTGG + Intronic
936346591 2:111680196-111680218 TCTTGCTCACAGGCAGTCCAAGG + Intergenic
937766636 2:125668920-125668942 CCATCCACACTGCCAGTCTAGGG - Intergenic
938778152 2:134560027-134560049 ACCTCCCCACAGCCAGGCCACGG + Intronic
945448484 2:209966037-209966059 CCATCCACACATGCATTCCTAGG + Intronic
946146184 2:217732905-217732927 CCCACCACACAGGCCAGCCATGG + Intronic
946634081 2:221705351-221705373 CCATCCACACAGGCACTGAATGG + Intergenic
947217562 2:227763341-227763363 CCCAGCACACTGGGAGTCCAAGG + Intergenic
947896651 2:233680636-233680658 CCTTGCACAGAGGAAGTCCATGG - Intronic
948051632 2:234983198-234983220 CACTCCACACAGCCCGTTCAAGG + Intronic
948554256 2:238796398-238796420 CCTGCCACACAGGCAGTGCTGGG - Intergenic
948755439 2:240157100-240157122 CCCACCACACAGCCATGCCAGGG - Intergenic
1168790869 20:574826-574848 CCCTCCCCCCAGGCATTCCCTGG - Intergenic
1169350888 20:4867111-4867133 CCTTCCACTCAGGCAGTCTGTGG + Intronic
1171323408 20:24267313-24267335 CCCTCCACACTGCTAGTCCAAGG + Intergenic
1171353943 20:24529209-24529231 CCTCCCACACACACAGTCCATGG - Intronic
1172180827 20:33002469-33002491 CCCACCACCCCTGCAGTCCAGGG + Intronic
1173904906 20:46619472-46619494 TCCTCCACATAAGCAGTCAAAGG + Intronic
1174387341 20:50194955-50194977 CCCTCCTTAGAGGCAGCCCAAGG - Intergenic
1174884420 20:54316451-54316473 CCCGCCACACAGCCAGTCTTGGG - Intergenic
1178716992 21:34974262-34974284 ACCTCCACACAGGCTGGCCAGGG + Intronic
1179971141 21:44837136-44837158 CCCGGCACCCAGGCAGTCCCCGG + Intergenic
1180009813 21:45041724-45041746 CCCTCCGCACAGGCACCGCAGGG - Intergenic
1180949116 22:19713395-19713417 CCCTCCACCCAGGGAGCCCACGG + Intergenic
1180996880 22:19970263-19970285 CCCTGCAGGCAGGCAGACCACGG - Exonic
1182276899 22:29195523-29195545 CCCTCCTGACAGGCAGCCCTTGG - Intergenic
1183512932 22:38246377-38246399 CCCTGCCCACAGGAAGGCCAAGG + Intronic
1183640660 22:39090613-39090635 CCCTCCACCCAGGAAGCCCTCGG + Intergenic
1184214460 22:43057582-43057604 CCCACCACACACACACTCCACGG + Intronic
1184473188 22:44707340-44707362 TCCTCCACACAGGCCCTCCCTGG - Intronic
1185126343 22:49012838-49012860 CCTTCCAGGCAGGCAATCCAGGG + Intergenic
1185185929 22:49400300-49400322 CTCTGCACACAGGCTGTGCATGG + Intergenic
954377244 3:50201654-50201676 CCCTCCACACTTGCTGGCCATGG - Intergenic
954582800 3:51712164-51712186 CCCTCCACCCAGGCCTTCCTTGG + Intronic
954678857 3:52330725-52330747 CCCTCCCCACAGGCTGCCCCTGG - Intronic
954745508 3:52785386-52785408 CCCTCCACACAGGCATCCTGGGG + Intronic
955068773 3:55554932-55554954 CCCACCTCACAGGCAGCCCAAGG - Intronic
959146367 3:102550593-102550615 CCCCACATACAGGCACTCCATGG - Intergenic
961017106 3:123476843-123476865 CCTTTCACACAGCCAGGCCATGG + Intergenic
961378941 3:126484734-126484756 CCCTGCACCTGGGCAGTCCATGG + Intronic
961450371 3:126999780-126999802 CCCTCCCCACAGATAGGCCAGGG - Intronic
961818979 3:129565633-129565655 CCACCCACACAGGCACTCCTGGG - Intronic
962554650 3:136535410-136535432 CCCAGCACACAGGAAGGCCAAGG + Intronic
962925570 3:139989782-139989804 CCCACCACCCGGCCAGTCCATGG + Intronic
966206953 3:177414575-177414597 CCCTCAAGACAGGCAATTCAGGG + Intergenic
967878202 3:194281005-194281027 TCCTCCACACAGGCACCCCAGGG - Intergenic
968392477 4:205018-205040 GCCTCTCCACAGGCAGCCCATGG + Intergenic
968552096 4:1229084-1229106 GCCTCCACTCAGCCAGTACATGG + Intronic
968874354 4:3257502-3257524 TCCTTCACACAGGCAGGCCGAGG - Intronic
968926177 4:3549597-3549619 ACATCCACACAGGCAGACCGGGG - Intergenic
968977142 4:3827874-3827896 CCTGCAACACAGGCAGCCCAGGG + Intergenic
969444190 4:7234834-7234856 CCCTCCAGGCAGCCTGTCCACGG + Intronic
969530694 4:7728702-7728724 CCCTCCATGCACACAGTCCAGGG + Intronic
971772351 4:30913463-30913485 CTCTCCACACAGAGAGTTCAAGG - Intronic
975027786 4:69574478-69574500 CCCTCCACATAGGGATCCCATGG + Intergenic
985010121 4:185573668-185573690 GCCTCCAGACAGGAAGTCAAAGG - Intergenic
985508978 5:301147-301169 AGCTCCACACAGTCAATCCAGGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
985650896 5:1106989-1107011 CCTTCGACACAGTCAGTACAGGG - Intronic
985739144 5:1604767-1604789 AGCTCCACACAGTCAGTCCAGGG - Intergenic
985859543 5:2460026-2460048 CCCTCCACACAGGCATGCACAGG - Intergenic
986086534 5:4457029-4457051 ACCTACACACATGGAGTCCATGG + Intergenic
986670531 5:10139364-10139386 CCCTCCTCACTAGCAGCCCAGGG - Intergenic
986811201 5:11361444-11361466 ACCTTCACACAGGCTGGCCATGG - Intronic
988851528 5:35185795-35185817 CCCTCCCCACAAGCAATCAATGG - Intronic
990449305 5:55919853-55919875 CCAGCCACAGAGGCAGTCCCTGG - Intronic
992446509 5:76839080-76839102 CCCTCCAGAGAGGCATTCCAAGG - Intergenic
992847365 5:80764611-80764633 CCCAACACACTGGGAGTCCAAGG - Intronic
992886439 5:81165018-81165040 CCCTCCACACTGGCAGGCTGCGG - Intronic
995612732 5:113927260-113927282 CTCTCCTCCCAGGCATTCCAAGG - Intergenic
997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG + Intronic
998117538 5:139549483-139549505 CCCTCCACAGCGGCTGGCCAGGG - Intronic
999243554 5:150140965-150140987 CCCACGACACAGGCAGGCCAGGG + Intronic
1003459439 6:6316940-6316962 ACCTCTACAAAGGCAGTGCAGGG - Intronic
1004700882 6:18078413-18078435 CCCTCTACAAAGGCAATTCAAGG + Intergenic
1006026686 6:31151458-31151480 CTCTCCACACCTGCAGGCCAGGG + Intronic
1006215199 6:32435985-32436007 GCCCCCATACAGCCAGTCCATGG - Intergenic
1006734356 6:36262094-36262116 CCCTGCAGCCAGGCAGTGCAAGG + Intronic
1006781025 6:36632318-36632340 CCCTCCTCACAGGCTGTGAAAGG - Intergenic
1007090520 6:39181599-39181621 GACTCCACACAGGATGTCCATGG - Intergenic
1007749443 6:44063058-44063080 CCCCCCACACAGGCACGCCCTGG - Intergenic
1008437255 6:51490864-51490886 CCCTCCACAAAGGCCGTCTTAGG - Intergenic
1008487702 6:52053376-52053398 CCCTGCACCCAAGCAGTCCTGGG + Intronic
1010444264 6:75933531-75933553 CTCTCCACAGAGACAGTCCAGGG + Intronic
1011512962 6:88121609-88121631 CCCTCAACATATCCAGTCCAGGG - Intergenic
1012448617 6:99331719-99331741 CCCTCGACAGAGGCCCTCCAAGG - Intronic
1016985109 6:149889220-149889242 CTCTCCAGACAGGAAGCCCACGG + Intronic
1018358049 6:163038438-163038460 CCCTGCACACAGCCAGTGAAGGG + Intronic
1018394835 6:163370190-163370212 CCCGCCACACAGGAAGTGGAAGG - Intergenic
1018394846 6:163370241-163370263 CCCGCCACACAGGAAGTGGAAGG - Intergenic
1019474792 7:1238846-1238868 GCCTCCCCACAGGCCGGCCAGGG + Intergenic
1019526187 7:1481558-1481580 CACTGCACACAGGCAGCCCCAGG - Intronic
1019597210 7:1863691-1863713 CCCTCCACCCAGGAGCTCCAGGG - Intronic
1019751682 7:2734759-2734781 CGCTCAACACAGGCAGTGCTGGG - Intronic
1020153288 7:5700759-5700781 CCTTCCACAAGGACAGTCCAAGG + Intronic
1020257267 7:6509148-6509170 CCCTCCCCACAGCCAGGCCCCGG - Exonic
1022047124 7:26630794-26630816 CACTCCAAACAGCCAGTGCATGG - Intergenic
1022530731 7:31065427-31065449 CCCTCCTCAAAGGCAGCCCCAGG - Intronic
1022533552 7:31081778-31081800 CCCTCCCTCCAGCCAGTCCATGG - Intronic
1025182289 7:56829438-56829460 TCCTCCAGTCAGCCAGTCCAGGG - Intergenic
1025204678 7:56985396-56985418 CCCACCACTCAGGCAGGCCTTGG + Intergenic
1025667259 7:63591539-63591561 CCCACCACTCAGGCAGGCCTTGG - Intergenic
1025689637 7:63747557-63747579 TCCTCCAGTCAGCCAGTCCAGGG + Intergenic
1026463636 7:70635452-70635474 CCCTCCCCACAGCCCGTCCCAGG + Intronic
1026895911 7:74010035-74010057 CCGTCCACACAGGCTGTCTGTGG - Intergenic
1029609289 7:101618174-101618196 CCCTGCCCAGAGGCAGTCCATGG - Intronic
1034832206 7:154319092-154319114 GGCTGCACACAGGCATTCCATGG - Intronic
1035281692 7:157782451-157782473 CCCTCCACAGAGGGGGTCCAGGG + Intronic
1035572671 8:683380-683402 CCCGTCTCACAGGCAGTCCTTGG - Intronic
1036393027 8:8341418-8341440 CTCCACACACAGGCAGTACAAGG + Intronic
1036940975 8:13051588-13051610 CCATCCACACAGGATCTCCATGG + Intergenic
1038054076 8:23841615-23841637 CCCACCACATAGGCAGTTCTGGG - Intergenic
1040905267 8:52463341-52463363 TCCTCCACACAACCAGTCCCTGG - Intergenic
1040968886 8:53112759-53112781 CACTTCACACAGGAAGTGCAAGG - Intergenic
1042116302 8:65435328-65435350 CCCTCCACACATGCACTCAGAGG + Intergenic
1042215659 8:66428529-66428551 CCCACACCACAGGCAGTCCCAGG + Intergenic
1042989745 8:74626032-74626054 CCCTCCACACTAGCACTCCCTGG + Intronic
1045500243 8:102739034-102739056 CCCTCCATACAGACCCTCCACGG - Intergenic
1045558354 8:103236760-103236782 CCTGCCACACAGGCCATCCAAGG - Intergenic
1045815506 8:106271832-106271854 CCTTCCATAGAGGGAGTCCACGG - Intronic
1047552743 8:125894279-125894301 CCCTTCACATAGACAGTCTATGG - Intergenic
1049420102 8:142512689-142512711 CCCTCCTCACAGCCAGTCCTGGG - Intronic
1053141015 9:35682765-35682787 CCCTCTGCACAGGCACTCCCTGG - Intronic
1054189538 9:61977153-61977175 ACATCCATACAGGCAGACCAGGG - Intergenic
1054648977 9:67611456-67611478 ACATCCACACAGGCAGACCAGGG + Intergenic
1056546047 9:87614827-87614849 ACCACCAAACAGGCAGTCCCAGG - Intronic
1057800163 9:98186038-98186060 CCCTGCCCACAGGCAGTGCAGGG - Intronic
1060402816 9:123358115-123358137 CCCTCCCGGCAGGCAGTCTAGGG - Intronic
1061051996 9:128202352-128202374 CCTTTCACACAGACAGACCATGG - Intronic
1061382098 9:130264917-130264939 GCATCCACACATGCAGCCCATGG + Intergenic
1061444442 9:130630037-130630059 CGGTCTACACAGGCAGTGCAAGG - Intronic
1061990838 9:134157724-134157746 CCTTCGACACAGGGAGCCCAGGG - Intronic
1062322352 9:135996617-135996639 CCCTCCACACAGCAACACCACGG + Intergenic
1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG + Intergenic
1062474827 9:136721779-136721801 CCCCTCACACAGGCAGTGCCGGG - Intronic
1203783465 EBV:114296-114318 CTCTTCACTAAGGCAGTCCAGGG - Intergenic
1185854346 X:3520283-3520305 TCCTCCCCACAGGCTTTCCAAGG - Intergenic
1186441707 X:9592635-9592657 CCCTCCCCACACTCAGTCCCTGG + Intronic
1193865469 X:86725702-86725724 CACACCACACCAGCAGTCCAGGG - Intronic
1197702534 X:129610103-129610125 ACCTCTTCACAGGCAGTCGAGGG + Intergenic
1199613911 X:149640135-149640157 CTCTCCCCACAGCCAGCCCAGGG + Intergenic
1200809151 Y:7464214-7464236 TCCTCCCCACAGGCTTTCCAAGG + Intergenic