ID: 1168435682

View in Genome Browser
Species Human (GRCh38)
Location 19:56315181-56315203
Sequence CTGGGAATAAGGCGGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168435669_1168435682 27 Left 1168435669 19:56315131-56315153 CCGAGCCCTGTAGTTTAGGGTTG 0: 1
1: 0
2: 1
3: 23
4: 146
Right 1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1168435670_1168435682 22 Left 1168435670 19:56315136-56315158 CCCTGTAGTTTAGGGTTGTTTTG 0: 1
1: 0
2: 0
3: 30
4: 422
Right 1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1168435671_1168435682 21 Left 1168435671 19:56315137-56315159 CCTGTAGTTTAGGGTTGTTTTGC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1168435674_1168435682 -4 Left 1168435674 19:56315162-56315184 CCAGCGAGACGCCGGAAGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168435682 Original CRISPR CTGGGAATAAGGCGGGACCA GGG Intronic
900109313 1:998866-998888 CTGGGAGGAGGGCGGGACCCCGG + Intergenic
902578658 1:17394508-17394530 ATGGGAAGCAGGCGGGGCCAGGG - Intronic
902839111 1:19064294-19064316 CTGAGAAAAAGGCTGGCCCAGGG - Intergenic
906676516 1:47697512-47697534 CTGGGAATCATGGGAGACCATGG + Intergenic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
908863540 1:68519246-68519268 CTGAGAATAAGGGGGAACTATGG - Intergenic
915593498 1:156883648-156883670 CTGGGAATAAGGCTTGGACAGGG + Intergenic
915597046 1:156901848-156901870 CTGGGAAGATGGCTGGAGCAGGG + Intronic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
920457128 1:206109924-206109946 CTATGAATATGGCAGGACCAGGG + Exonic
921947249 1:220894596-220894618 CAGGGAAGATGGCGGGACCCAGG - Intergenic
1062975917 10:1682561-1682583 CTGGGATTAAGCCGGGTTCAGGG + Intronic
1063251102 10:4275951-4275973 CTGTGGATAAGGCAGGACTATGG + Intergenic
1063461066 10:6215350-6215372 GTGGGAATAAGGCTGGGCCGCGG + Intronic
1063807155 10:9658644-9658666 CTGAGACTAAGTCTGGACCAGGG + Intergenic
1071449061 10:85777268-85777290 CTGGGAGAAAGGAGGGCCCAGGG - Intronic
1073432076 10:103493566-103493588 CTGGGAATAAGGCCAGCCCCGGG + Intergenic
1074024554 10:109620953-109620975 CTAGGAATCAGGTGGCACCAAGG + Intergenic
1075286730 10:121193559-121193581 CTGGGAACAGGGTGGGTCCAAGG + Intergenic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1080852066 11:36078588-36078610 GTGGGAGTAAGGGGGGCCCAGGG + Intronic
1083555491 11:63622939-63622961 CTGGGGAGAAGGAAGGACCAGGG - Intergenic
1089056451 11:115589433-115589455 CTGGGACTAACGCAGGACCTTGG - Intergenic
1091540636 12:1458097-1458119 CTGGGCATTTGGCAGGACCATGG + Intronic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1092214449 12:6671207-6671229 CTGGCCATAAGGTGGGGCCAAGG - Intronic
1094001075 12:25694879-25694901 CAGTGAATAAGGGGGGACTATGG + Intergenic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1095835682 12:46637090-46637112 CTGGGAGTGATGCGGGGCCAAGG + Intergenic
1096220808 12:49827479-49827501 CTGGAGATAACGCGGGACCTTGG + Intronic
1098069527 12:66657290-66657312 CGGCGAATGGGGCGGGACCAGGG - Intronic
1100105447 12:91165860-91165882 CTGGGAATATAGCAGGACCAAGG + Intronic
1100587982 12:95997080-95997102 ATGGTAATAAGGCGGGTGCAGGG - Intergenic
1100908866 12:99335480-99335502 CTGGGAACCAGGTGGGAGCAGGG - Intronic
1108269873 13:48749013-48749035 ATGGGAATCAGGCAGGTCCAAGG - Intergenic
1122203117 14:100134498-100134520 CTGGGTATGAGAAGGGACCATGG - Intronic
1124972659 15:34504434-34504456 CTGGGAAGAATGTGGGAGCAGGG + Intergenic
1128671639 15:69578271-69578293 CTGGGGAGAAGGCGGGACTTTGG + Intergenic
1129908531 15:79207084-79207106 CTGGGAAAGAGGCCTGACCAGGG - Intergenic
1132665918 16:1081270-1081292 CTGGGCAGACGGCGGGAGCACGG - Intergenic
1133917676 16:10124006-10124028 CTGGAAAGAAGGTGGGAACAAGG - Intronic
1135546147 16:23368047-23368069 GTGGGACTGAGGGGGGACCAAGG + Intronic
1135678590 16:24438206-24438228 CTGGGAATAAGGTGGGATGCAGG + Intergenic
1139572033 16:67818970-67818992 CTGGGAATCAGGCGTGAGCTGGG + Intronic
1145159220 17:20563195-20563217 CAGGAAATAAAGTGGGACCAGGG + Intergenic
1147442503 17:40456070-40456092 CTGGGATTAAGGTAGGACCAGGG - Intronic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1152549033 17:81020084-81020106 GTGGGGATACGGAGGGACCATGG + Intergenic
1154253759 18:12765758-12765780 CTGGGCACCAGGCAGGACCACGG + Intergenic
1157469596 18:47979012-47979034 CTGGGAACAAGGAGGGGCCCTGG - Intergenic
1159292359 18:66439611-66439633 CTGGGAATGGGGAGAGACCAGGG - Intergenic
1161453387 19:4358850-4358872 CTGGGGATGAGGCCGAACCAGGG + Intronic
1161875025 19:6901731-6901753 CTGGGAAGAAGGGGGGAACATGG + Intronic
1165772533 19:38387603-38387625 CTGGGAAGAGGGCGGGACCCAGG - Intronic
1167697880 19:51025667-51025689 CTGGGAACAAGGAGGGACATGGG + Intronic
1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG + Intronic
1168636139 19:57998993-57999015 CTTGGGATCAGGCGGCACCAGGG - Intronic
928178292 2:29049943-29049965 CCTGGAATAAGGAGGAACCAGGG - Intronic
929671161 2:43877192-43877214 ATGGGAATATGGGGAGACCATGG + Intronic
929789771 2:45014022-45014044 CCAGGACTAAGGCGGGACCGCGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
933972981 2:87485153-87485175 CTGAGTATAAGTGGGGACCAAGG + Intergenic
934063336 2:88317525-88317547 CTGGCAACAAGGCCGGACCAAGG - Intergenic
936320740 2:111465060-111465082 CTGAGTATAAGTGGGGACCAAGG - Intergenic
937249577 2:120515073-120515095 CTGGGAAGAAGGTGGTGCCAGGG - Intergenic
937687987 2:124720124-124720146 CTGGGATGATGGAGGGACCAAGG - Intronic
941858324 2:170252849-170252871 GTGGGAATGAGGTGGGAACATGG + Intronic
942539002 2:176995923-176995945 CTGGGAATGAGGCCCGAGCATGG - Intergenic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
947169075 2:227293026-227293048 CTGGGAATAAGACGGCCACATGG - Intronic
948231817 2:236354672-236354694 GTGGGGACAAGGCGGGACCAGGG - Intronic
948251278 2:236531850-236531872 CTGCCAATAAGGAGGGACCATGG - Intergenic
948401074 2:237685830-237685852 CTTGAAGGAAGGCGGGACCAAGG - Intronic
948572880 2:238928289-238928311 CTGGGAATGTGGAGGGAGCAGGG + Intergenic
1170663722 20:18366846-18366868 GTGGGAATAAGCCAGGAGCAGGG + Intergenic
1170967699 20:21090508-21090530 GTGGGAATTAGGCCGGACCCCGG - Intergenic
1173848146 20:46201005-46201027 CCGGGAAGAAGGCGGAACAAAGG - Intronic
1174299041 20:49568585-49568607 GTGGGAAGACGGCGGGACGATGG + Intergenic
1174806596 20:53608803-53608825 CTGGGAAGAAGGTGAGGCCAAGG - Intronic
1180137801 21:45872330-45872352 CTAGGAAAAATGCGGGACCAGGG - Intronic
1180148176 21:45933513-45933535 CTAGGACTCAGGCAGGACCAAGG + Intronic
1185114070 22:48921149-48921171 GTGGGAATGAAGGGGGACCACGG + Intergenic
950171980 3:10844987-10845009 CTGGGAAGTAGAGGGGACCATGG + Intronic
950500249 3:13359111-13359133 CTGACCATAAGGCAGGACCAAGG + Intronic
955281266 3:57597039-57597061 CTGCGAGTCAGGCGGGACCTGGG - Intronic
957116558 3:76034197-76034219 CTTTGAATAAGGCAGGAGCATGG + Intronic
957278708 3:78122563-78122585 CTGGGAGTAAGATGGGACCCAGG - Intergenic
961654827 3:128435467-128435489 CTGTGAATCAGGCTGGGCCAGGG - Intergenic
961673290 3:128549838-128549860 CTTGGAATAAGAGGGGACAAAGG + Intergenic
963641610 3:147867204-147867226 TGGGGAATAAGGAGGGAACATGG - Intergenic
964602832 3:158521358-158521380 CTGGGGATAAGGCAGGACAAGGG - Intronic
966916674 3:184588067-184588089 CTGGGAAGAAGGCAGGAGCAGGG - Intronic
968449236 4:667332-667354 CTGGGGAGAAGGTGGGACAAGGG + Intronic
972218114 4:36920238-36920260 ATTGGAATAAGGTGGGACCCAGG - Intergenic
973163950 4:47053661-47053683 CTGGAAAGAAGGTGTGACCATGG + Intronic
978208044 4:106103885-106103907 CTGGGAATAACATGGAACCAGGG + Intronic
978592471 4:110340421-110340443 GTGGGGAGAAGGAGGGACCAGGG - Intergenic
986229091 5:5845120-5845142 CTTCGAATAATGCAGGACCAGGG - Intergenic
989350295 5:40478372-40478394 ATGGGAATAACACAGGACCAAGG + Intergenic
992088951 5:73301203-73301225 CGGGGAACAAGGCGTGCCCAGGG - Intergenic
993996628 5:94730769-94730791 CTGGGAATAGGGTGTTACCAAGG - Intronic
999065222 5:148678496-148678518 CTGAGAATGAGGAGGGCCCAAGG - Intergenic
999714571 5:154349864-154349886 CTGGAATTCAGGAGGGACCAGGG - Intronic
1001043951 5:168356823-168356845 CTGGGAATAAGGGAAGCCCATGG + Intronic
1002512598 5:179732802-179732824 CTCGGAAGAAGGCGGGGCCTCGG - Intergenic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1006416410 6:33906819-33906841 CTGGGAGAAGGGTGGGACCAGGG + Intergenic
1006812013 6:36826224-36826246 CTGGGAAGTGGGCAGGACCAGGG - Intronic
1006875190 6:37289408-37289430 CTGGTAATCAGGGGAGACCATGG - Intronic
1008448460 6:51621230-51621252 CTGGGCATAATGAGGGAGCAAGG - Intronic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1018874759 6:167812033-167812055 CGGGGAAGAAGGCAGCACCATGG - Intergenic
1019082781 6:169446374-169446396 CCGGGCACAAGGCGGGACCAGGG + Intergenic
1024226722 7:47330998-47331020 CTGGGAGTAGGGCTGGTCCAGGG - Intronic
1025996337 7:66529779-66529801 CAGGAAATAAGACGGGAGCAGGG + Intergenic
1026988349 7:74568996-74569018 CAGGAAATAAGACGGGAGCAGGG + Intronic
1032515151 7:132501464-132501486 CAGGGAGTGAGGCGGGACCCAGG - Intronic
1044824038 8:96179484-96179506 CTGGGAACAATGCCGGACCGGGG + Intergenic
1047706456 8:127504492-127504514 CTGGTAATGAGGCTGGGCCAGGG + Intergenic
1048610833 8:136021191-136021213 CTTGGAATAAGATGGGAACAGGG + Intergenic
1049653592 8:143788135-143788157 CTGGGAAGCAGGGGTGACCAGGG - Intergenic
1058550376 9:106108390-106108412 CTGGGAATAATCCAGGACAACGG - Intergenic
1062026771 9:134344208-134344230 CTGGGAAAAAGGGAGGCCCAGGG - Intronic
1062555318 9:137111179-137111201 CTGGGAGTAAGACAGGAGCAGGG + Intronic
1190110270 X:47585021-47585043 CTGGGAAAGAGGCGGGGGCAGGG - Intronic
1191662378 X:63665091-63665113 CTGGGAAGAATTGGGGACCAAGG - Intronic
1199747449 X:150782548-150782570 CTGGGAACACGGCGTGAACATGG - Intronic
1201860585 Y:18593348-18593370 CTGAGAATAATGCAGTACCAAGG - Intergenic
1201872738 Y:18727033-18727055 CTGAGAATAATGCAGTACCAAGG + Intergenic
1202165464 Y:21982674-21982696 CTGAGAATAACGCAGTACCAAGG + Intergenic
1202225893 Y:22603698-22603720 CTGAGAATAACGCAGTACCAAGG - Intergenic
1202317220 Y:23591963-23591985 CTGAGAATAACGCAGTACCAAGG + Intergenic
1202553545 Y:26078095-26078117 CTGAGAATAACGCAGTACCAAGG - Intergenic