ID: 1168437040

View in Genome Browser
Species Human (GRCh38)
Location 19:56326545-56326567
Sequence TTAATATTCCACATATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 533}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168437035_1168437040 29 Left 1168437035 19:56326493-56326515 CCCCTGGTAACTGCCATTCTACT 0: 10
1: 133
2: 793
3: 2560
4: 4938
Right 1168437040 19:56326545-56326567 TTAATATTCCACATATAAATGGG 0: 1
1: 0
2: 6
3: 74
4: 533
1168437037_1168437040 27 Left 1168437037 19:56326495-56326517 CCTGGTAACTGCCATTCTACTCT 0: 5
1: 60
2: 312
3: 1055
4: 2442
Right 1168437040 19:56326545-56326567 TTAATATTCCACATATAAATGGG 0: 1
1: 0
2: 6
3: 74
4: 533
1168437038_1168437040 16 Left 1168437038 19:56326506-56326528 CCATTCTACTCTCTGTTACTACT 0: 1
1: 0
2: 17
3: 228
4: 1237
Right 1168437040 19:56326545-56326567 TTAATATTCCACATATAAATGGG 0: 1
1: 0
2: 6
3: 74
4: 533
1168437036_1168437040 28 Left 1168437036 19:56326494-56326516 CCCTGGTAACTGCCATTCTACTC 0: 6
1: 54
2: 306
3: 944
4: 2237
Right 1168437040 19:56326545-56326567 TTAATATTCCACATATAAATGGG 0: 1
1: 0
2: 6
3: 74
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168437040 Original CRISPR TTAATATTCCACATATAAAT GGG Intronic
900949636 1:5851151-5851173 TTTGTATTCCACATCTAATTAGG + Intergenic
902085678 1:13859645-13859667 TTAGCATACCATATATAAATGGG - Intergenic
906562068 1:46765822-46765844 TTTATACTCCTCATAGAAATAGG + Intronic
906975282 1:50563567-50563589 TCAATATTGCATATCTAAATTGG - Intronic
908180745 1:61602759-61602781 ATTAAATTACACATATAAATGGG + Intergenic
908489557 1:64629693-64629715 CTAATATGCCAAATATAAAAAGG + Intronic
908540553 1:65118052-65118074 ATAATAGTCCATATTTAAATTGG - Intergenic
908580171 1:65507007-65507029 TTAAGATTCCACATAAAAGTGGG + Intronic
908867940 1:68573103-68573125 TTAGGATTCCACATATAATTGGG + Intergenic
909155810 1:72074897-72074919 TTAATGTTTCTAATATAAATAGG + Intronic
909272658 1:73643887-73643909 TTAATATCCCAAATATAGAATGG + Intergenic
910302882 1:85727511-85727533 ATCACATTCCACAGATAAATGGG + Intergenic
910850860 1:91648736-91648758 TTAATATTCCAAAAACATATTGG + Intergenic
911114198 1:94227657-94227679 GTGATATTCCACATGAAAATGGG + Intronic
911178074 1:94837101-94837123 TTTAGATTCCACATACAAGTGGG - Intronic
911248019 1:95540920-95540942 TTTAGATACCTCATATAAATGGG - Intergenic
911353954 1:96793191-96793213 TTAAAATTGCACATATAAAGAGG - Intronic
911432278 1:97806333-97806355 TTAATATTCATCATACAAGTGGG + Intronic
911838936 1:102657507-102657529 TTAATTTTAGACATTTAAATAGG - Intergenic
912052515 1:105547707-105547729 TTTATATTCCACATATAAGTGGG - Intergenic
913086661 1:115444430-115444452 TCAATATTCTAAATATCAATAGG + Intergenic
913096229 1:115518525-115518547 CTAATATTCCAATTAAAAATGGG - Intergenic
913541347 1:119823898-119823920 TTTAGATTCCACATATGAGTGGG - Intergenic
915207692 1:154283046-154283068 TTAAGATTCCATATATAAGTGGG - Intergenic
915775374 1:158478984-158479006 TTATTATTACAAATATAACTGGG + Intergenic
916277541 1:163011364-163011386 TTTAGATTCCACATATAAGTGGG + Intergenic
916841533 1:168606741-168606763 TTAATCTTTCACACTTAAATGGG + Intergenic
917018923 1:170564949-170564971 TTAAAAATCCACATAGAATTGGG + Intergenic
917168389 1:172140909-172140931 CTAATATTCAACCTATAATTTGG - Intronic
917493327 1:175517236-175517258 TTTATATTCCAGAAAAAAATAGG + Intronic
917757510 1:178117523-178117545 TTAACTTTCAACATATGAATTGG - Intronic
918916913 1:190653313-190653335 TTTAGATTCCACATACAAGTGGG - Intergenic
919067198 1:192707556-192707578 TTAGTATTTCACATTTGAATTGG + Intergenic
919173934 1:193995345-193995367 TAAAAATTGCACATATATATGGG - Intergenic
919395365 1:197040243-197040265 GAAATATTGCACGTATAAATTGG + Intronic
919402321 1:197134725-197134747 TAAAAATTCCTCATATGAATTGG + Intronic
919452781 1:197790071-197790093 TTTAGATTCCACATATATGTGGG + Intergenic
919461138 1:197879016-197879038 TTTATATTCAACATATATTTTGG + Intergenic
920538802 1:206761517-206761539 TTGATAATACACAGATAAATGGG + Intergenic
921758500 1:218885190-218885212 TTAAAATTCCACATGAAATTTGG + Intergenic
922130876 1:222776461-222776483 ATAATCTTCCAAATATTAATAGG + Intergenic
922177119 1:223205318-223205340 TTAAATCTCAACATATAAATTGG + Intergenic
922815816 1:228448250-228448272 TTTAGATTCCATATATAAGTTGG - Intergenic
923349654 1:233091489-233091511 TTTATATCTTACATATAAATAGG - Intronic
923886144 1:238158591-238158613 TTTAAATTCCACAAATAAGTGGG + Intergenic
924137031 1:240979026-240979048 TTGAAATTCAAAATATAAATGGG - Intronic
924309930 1:242729997-242730019 TTAATTATCCATAGATAAATAGG + Intergenic
924490257 1:244529494-244529516 ATAATAATCCAAATAAAAATGGG - Intronic
1063359133 10:5434873-5434895 TTAATATTTTATATATAATTTGG - Intronic
1063857142 10:10267443-10267465 TTAAAATCCCAAATACAAATGGG + Intergenic
1064689308 10:17897807-17897829 TTAATATTCTAAATATAGTTTGG + Intronic
1064912427 10:20416987-20417009 TTAAATTTCAACATATGAATGGG - Intergenic
1064946848 10:20800190-20800212 TTCAGATTCCACATATAAGTGGG + Intronic
1064990651 10:21254109-21254131 TTAAAATTCTACATATGAAAGGG - Intergenic
1065456803 10:25915282-25915304 TTAGTATACCACAGATAAATTGG - Intergenic
1065828177 10:29590628-29590650 TAAATATAAAACATATAAATAGG - Intronic
1066126644 10:32348225-32348247 TTTATATTACACATGAAAATGGG + Intronic
1066476791 10:35755120-35755142 TTAATATTCTATAGATATATTGG - Intergenic
1067310627 10:45110238-45110260 TTTACATTCCACATATAAGTGGG + Intergenic
1068020678 10:51579573-51579595 TTTGTATTCCAAATAAAAATTGG - Intronic
1068208509 10:53889694-53889716 TTAATATTACAAATATACTTAGG - Intronic
1068236980 10:54249824-54249846 TTAAAATTCCACCTATAATTTGG - Intronic
1068244661 10:54348888-54348910 TTTAGATTCCACATACAAGTGGG + Intronic
1068465184 10:57380761-57380783 GTAATATACCATTTATAAATTGG + Intergenic
1068778506 10:60893612-60893634 GTAATATTTAACATATAACTAGG + Intronic
1068806314 10:61197793-61197815 TTATTTTTTCACATAAAAATGGG + Intergenic
1069126404 10:64640601-64640623 TTACTTTTTGACATATAAATTGG - Intergenic
1069128540 10:64669356-64669378 ATAATATTTTACATATATATGGG + Intergenic
1069164110 10:65128200-65128222 TTTAGATTCCACATATAAGAGGG - Intergenic
1069447693 10:68488872-68488894 TTTTTTTTCCACATATAAAGTGG - Intronic
1070098756 10:73365254-73365276 TTAGGATTCCACATATGAATAGG - Intergenic
1070414205 10:76174476-76174498 TTAACATTCTAAATGTAAATAGG + Intronic
1071538906 10:86461509-86461531 TTAATATTATACATATATATAGG + Intronic
1071819825 10:89268436-89268458 TTAATAATCAGCAAATAAATTGG - Intronic
1073066353 10:100761656-100761678 TTAATTTTCCACATAAACAAAGG - Intronic
1074583759 10:114746306-114746328 TTTAGATTCCACATATAAGCAGG + Intergenic
1074667502 10:115746351-115746373 TAAATACTCCACATGTAAATGGG - Intronic
1077520876 11:3033433-3033455 TTAAATTTCCAAATTTAAATTGG - Intronic
1078519961 11:12054925-12054947 TTCAGCTACCACATATAAATGGG + Intergenic
1078999515 11:16739419-16739441 TTAATATCCGACATCAAAATGGG - Intronic
1079204605 11:18403435-18403457 TTTATATTTCAAATATACATGGG + Intronic
1079348379 11:19672486-19672508 TTAATTTTCCACCCATAAAGGGG + Intronic
1079769465 11:24441319-24441341 TTAATATATAATATATAAATAGG + Intergenic
1079884508 11:25970099-25970121 TTAAAATTCCATATTTACATAGG - Intergenic
1080193995 11:29586456-29586478 TAAAATTTCAACATATAAATTGG - Intergenic
1080284150 11:30588420-30588442 TTCATAATCCAAATATAACTTGG - Intergenic
1080956108 11:37098019-37098041 TTAAACTTCAATATATAAATAGG - Intergenic
1081075146 11:38663352-38663374 TGAATATTCCACTTATATAGTGG - Intergenic
1081286591 11:41277956-41277978 TTTAGATTCCACACATCAATGGG - Intronic
1081337067 11:41879915-41879937 TTAAGTTTTAACATATAAATTGG - Intergenic
1081347360 11:42006653-42006675 TTTAGATTCCACATATAAGTGGG + Intergenic
1082111028 11:48274209-48274231 TTAAGATTCCACATATAAGTGGG + Intergenic
1082186971 11:49194469-49194491 TTAAAATTATGCATATAAATTGG + Intronic
1084297459 11:68222210-68222232 TTAAAATTCCAAATCTAAACAGG + Intergenic
1084540199 11:69781819-69781841 TTAATATTTCAAATAAAAAATGG + Intergenic
1085378592 11:76091240-76091262 ATAATATTTCACATACAAAAAGG - Intronic
1085817358 11:79753841-79753863 ATAATATTTCACATATTTATGGG - Intergenic
1086670212 11:89537483-89537505 TTTATATACCATATATAAAAGGG - Intergenic
1086679367 11:89650919-89650941 TTAAAATTATGCATATAAATTGG - Intergenic
1086802797 11:91197989-91198011 TTAATATTTCAAATAGAAATTGG + Intergenic
1087032522 11:93719986-93720008 TTAATATCTCAAATATAATTAGG + Intronic
1087085024 11:94209191-94209213 TAAAAATTACACATATAAGTGGG - Intergenic
1087121480 11:94579428-94579450 TTAATTTTTCACACAGAAATTGG - Intronic
1087890703 11:103534721-103534743 TTTAGATTCCACATATGAGTGGG - Intergenic
1087972486 11:104501705-104501727 TTGCTATTTCACATACAAATTGG + Intergenic
1088334491 11:108688608-108688630 TTAGTATTCCACATCTCATTAGG - Intronic
1088781586 11:113139841-113139863 TGAATATTCCACATTTCTATGGG - Intronic
1088878307 11:113953954-113953976 TTTAGCTCCCACATATAAATGGG + Intergenic
1089852306 11:121510230-121510252 TTAATTTTTCACATATAATTTGG - Intronic
1090112102 11:123923743-123923765 TTTAGATTCCACATGTAAGTTGG + Intergenic
1091067666 11:132531369-132531391 TTAATAATTCACAATTAAATTGG - Intronic
1091619846 12:2078504-2078526 TTTAGATACCTCATATAAATAGG - Intronic
1092171985 12:6379357-6379379 TTAATAGACCACAAATAAATGGG - Intronic
1092445747 12:8555490-8555512 TTAATTTTTCACTTATAAAATGG - Intergenic
1093113500 12:15181288-15181310 TTAATATTTCACATATTGTTTGG - Intronic
1093560694 12:20535368-20535390 TTATTCCTCCACATATGAATGGG - Intronic
1093601766 12:21034943-21034965 TTAATAATCCATTTAAAAATGGG - Intronic
1093816968 12:23560350-23560372 TTACTAATCCACATATTTATTGG + Intronic
1095043812 12:37476010-37476032 TTAATTTTACACAAATATATTGG + Intergenic
1095224248 12:39660534-39660556 TTAATATTGTACATATTACTGGG + Intronic
1095551828 12:43451201-43451223 TTTAGATTCCACATATGAATGGG - Intronic
1095848991 12:46779725-46779747 TTTTTATTTCACATTTAAATAGG - Intronic
1096468392 12:51861261-51861283 TCAATATTCCACATCTTGATTGG + Intergenic
1097468385 12:59956255-59956277 TTAATATTCCAAATATATAAGGG + Intergenic
1097852858 12:64430559-64430581 TTAATATACCAAATATATATTGG + Intronic
1098270550 12:68765713-68765735 TATATATCCCACATATATATGGG - Exonic
1098601260 12:72334409-72334431 TTAAGAGTCCACAACTAAATTGG + Intronic
1098706683 12:73700669-73700691 TTAAGATTTCACATATAAGTTGG - Intergenic
1098762349 12:74440597-74440619 TCAATATTCAACATAGATATTGG - Intergenic
1099021073 12:77405511-77405533 TTAGGATTCAACATATAATTTGG + Intergenic
1099221103 12:79915609-79915631 TTAAAATTCCACATTAAAAATGG - Intronic
1099629473 12:85123597-85123619 TTATTTTTCCAGAGATAAATGGG + Intronic
1099731744 12:86512700-86512722 TTTAGATACCTCATATAAATGGG - Intronic
1099830069 12:87830680-87830702 TTTCTATTTCACAAATAAATTGG - Intergenic
1099930772 12:89071711-89071733 TAAACATTTCATATATAAATTGG + Intergenic
1100080623 12:90845457-90845479 ATTATATTCCACATATAATATGG - Intergenic
1100564920 12:95786332-95786354 AAAACATTCCACATAGAAATTGG + Intronic
1100852787 12:98730872-98730894 TTATTTTTTCACTTATAAATAGG - Intronic
1101057179 12:100930009-100930031 CTAATAATCCAAATAAAAATGGG - Intronic
1101182247 12:102231633-102231655 TAAATATTCCACATAAAACCAGG + Intergenic
1101312290 12:103592884-103592906 TTTATATTCCTCATATAAGTGGG + Intronic
1101591818 12:106131590-106131612 GTAATATTCCACAAATGAAATGG + Intronic
1101699467 12:107158580-107158602 TTATTATTCCAAATATAATACGG - Intergenic
1102187603 12:110961449-110961471 TTCATATTCCAAGTATAGATTGG + Intergenic
1102837803 12:116082706-116082728 TCAATATTTCACATATAATATGG - Intronic
1105816949 13:24044816-24044838 TTCAGATTCCACATATGAGTGGG - Intronic
1106192374 13:27464766-27464788 TTATTATTACACAGATAACTAGG - Intergenic
1106507289 13:30382332-30382354 TTAAAAACACACATATAAATAGG + Intergenic
1107182501 13:37477767-37477789 TAAATATTGCATTTATAAATGGG + Intergenic
1107784229 13:43938408-43938430 TTCATATTCTAAATTTAAATAGG + Intergenic
1107792248 13:44014337-44014359 TTAATATTCATTATATATATGGG - Intergenic
1109433144 13:62262967-62262989 ATGATATTCCTCATAGAAATAGG + Intergenic
1109447849 13:62468082-62468104 TTAATAATCTACACATAAAGAGG - Intergenic
1109629415 13:65025989-65026011 TTTAGCTTCCACATATGAATGGG + Intergenic
1109688175 13:65847930-65847952 TTAATATTATACATATATAGTGG - Intergenic
1109758050 13:66787801-66787823 CCTATATTCCACATAAAAATAGG - Intronic
1110003364 13:70233963-70233985 TTTAGATTTCACATATAAGTGGG - Intergenic
1110068540 13:71142541-71142563 TTAATAATCTATATATAAAATGG + Intergenic
1110300148 13:73916788-73916810 TTAATATTTAACAAAGAAATGGG + Intronic
1110522748 13:76499926-76499948 CTAACAATCCACATAAAAATGGG - Intergenic
1111317318 13:86580357-86580379 TTGAGATTCTACATATAAAGAGG + Intergenic
1111573477 13:90118336-90118358 TTACTCTTCCACTTTTAAATAGG - Intergenic
1111774215 13:92638983-92639005 TATAAATTCTACATATAAATAGG + Intronic
1112162754 13:96886253-96886275 TTTAGATTCTGCATATAAATGGG - Intergenic
1112621041 13:101053967-101053989 TTAACATTCCTCAGATAGATAGG - Exonic
1112642846 13:101296355-101296377 TTAATACTGCACAGATAATTTGG + Intronic
1112657293 13:101464615-101464637 TACATATACCAAATATAAATGGG - Intronic
1113004451 13:105683009-105683031 TTAAAATTACACATGTAAAATGG - Intergenic
1114453284 14:22839930-22839952 TTCATATTTCATATATAACTTGG + Intronic
1114783294 14:25564428-25564450 TTTACATCCCACAAATAAATGGG + Intergenic
1114824861 14:26064903-26064925 TCCATATTCCTCATATCAATGGG + Intergenic
1115386666 14:32805779-32805801 TGAATTTTTAACATATAAATGGG + Intronic
1115481190 14:33862823-33862845 TTAATATTACATATATAAGCTGG + Intergenic
1115934569 14:38537329-38537351 TTAATCTTCCTCAAATAAAGAGG - Intergenic
1116538367 14:46064799-46064821 CTGTTATTCCAAATATAAATTGG - Intergenic
1116906690 14:50410707-50410729 TTTCTATTCTACTTATAAATAGG + Intronic
1117211174 14:53501861-53501883 TTTATAGTTCACATGTAAATGGG + Intergenic
1117542371 14:56760904-56760926 TTAATATTCCAGTTCCAAATGGG - Intergenic
1117632006 14:57703580-57703602 TTATTATTCCCCATACAATTAGG + Intronic
1117885184 14:60354030-60354052 TTAAACTTCCAAATAAAAATGGG - Intergenic
1118240904 14:64057946-64057968 TTAATAATCCAATTAAAAATGGG - Intronic
1118790807 14:69090849-69090871 TTGCTATTTCACATATAGATTGG - Intronic
1118803881 14:69217366-69217388 TTTAGATTCCACATATGAGTGGG + Intronic
1119416529 14:74474090-74474112 TTAATATTCCCAGTATGAATAGG + Intergenic
1121212492 14:92219172-92219194 TTTAGATCCCACATATAAGTGGG - Intergenic
1202942346 14_KI270725v1_random:163644-163666 TTAATTTTACACAAATATATTGG + Intergenic
1123634978 15:22296027-22296049 TTTAGATTCCACATATATGTGGG + Intergenic
1123683406 15:22780100-22780122 TTTACATCCCACATATAAATGGG + Intronic
1124064904 15:26333324-26333346 TTTAGCTTCCACCTATAAATGGG - Intergenic
1124991599 15:34679810-34679832 TTATTATTCCAAATATTACTTGG - Intergenic
1125008699 15:34846885-34846907 TTACTTTTCCCAATATAAATCGG + Intergenic
1125385548 15:39132581-39132603 TTAGTCTTCCAGATACAAATAGG + Intergenic
1125446324 15:39761494-39761516 TTTGGATTCCACATATAAATGGG - Intronic
1126031222 15:44499613-44499635 GTAAAATTCAACATATGAATGGG + Intronic
1126252325 15:46582903-46582925 TTAATCTTCAACAGAAAAATTGG - Intergenic
1126261437 15:46697468-46697490 TTGTTCTTCCACTTATAAATAGG + Intergenic
1126291074 15:47079861-47079883 TTAATTTTACACAAATATATTGG - Intergenic
1126376336 15:48000599-48000621 TTAATCTTCCTCATATACAAAGG - Intergenic
1127075364 15:55319891-55319913 TTTATATTGCACATATACAAAGG + Intronic
1127745646 15:61968927-61968949 ATAATATTCCCCATATCAAGGGG + Intronic
1128940084 15:71780969-71780991 TTGATATTCCAACTATAAAGTGG - Exonic
1129045218 15:72728152-72728174 TTAATTTTCTGCATTTAAATTGG + Intronic
1130338052 15:82974582-82974604 TTCATATTCCAAATATGACTGGG + Intronic
1132200746 15:99953115-99953137 TTAAGGTTCAACATATGAATGGG - Intergenic
1132387848 15:101413233-101413255 TGTATATTACAAATATAAATGGG + Intronic
1133958565 16:10470190-10470212 TATATATTCTACATATATATAGG - Intronic
1134433083 16:14229999-14230021 TTATTATTTAAAATATAAATAGG - Intronic
1134892036 16:17849536-17849558 TTTAGATTCCACATATAAGTGGG - Intergenic
1135387088 16:22051995-22052017 AAATTATTCCACATATATATAGG - Intronic
1135426659 16:22343001-22343023 TTAAGATTCTACATATAAGTGGG - Intergenic
1135834135 16:25807825-25807847 TTAATATTAACCATTTAAATAGG + Intronic
1136740631 16:32520571-32520593 TGAAGATTCCAGATAAAAATTGG - Intergenic
1136769085 16:32818447-32818469 TTAATTTTCCATATACATATAGG - Intergenic
1137311065 16:47259307-47259329 TTAATATTCATAATATAAAAGGG - Intronic
1137348657 16:47690130-47690152 TTAAATTTCCACATATACTTGGG - Intronic
1137575388 16:49596657-49596679 TTAATATTATAAATATAATTTGG + Intronic
1138793399 16:59936975-59936997 TTAAAATTACAAATATATATAGG - Intergenic
1138881459 16:61020428-61020450 TTAATACACTACATATAAAACGG + Intergenic
1140321210 16:73953466-73953488 TTTAGATTCCACATATAAGTGGG + Intergenic
1140602325 16:76492038-76492060 TTTAGATTCCATATATAAGTGGG - Intronic
1141438573 16:84014804-84014826 TTCATATTCCACACATCAGTTGG + Intronic
1203028972 16_KI270728v1_random:554663-554685 TGAAGATTCCAGATAAAAATTGG + Intergenic
1203042749 16_KI270728v1_random:779768-779790 TGAAGATTCCAGATAAAAATTGG - Intergenic
1203071503 16_KI270728v1_random:1080554-1080576 TTAATTTTCCATATACATATAGG - Intergenic
1142949581 17:3466882-3466904 TTAAGTTTCAACATATAAATTGG + Intronic
1143359525 17:6357531-6357553 TTGATATTCCATCTATAAAATGG + Intergenic
1144420152 17:15089309-15089331 TTACTATTTCACATTTTAATAGG - Intergenic
1145101002 17:20077026-20077048 TAAATCTTACCCATATAAATTGG - Intronic
1148281523 17:46351851-46351873 TTAATATTTTACATGAAAATCGG + Intronic
1148303749 17:46569790-46569812 TTAATATTTTACATGAAAATCGG + Intronic
1148986138 17:51623299-51623321 TTCAGATTCCTAATATAAATGGG + Intergenic
1149279388 17:55085438-55085460 CTAATATGCCATATATTAATGGG - Intronic
1149416376 17:56464121-56464143 ATAATATTCTACTTTTAAATTGG + Intronic
1149878869 17:60267415-60267437 TTAAGATTCTTGATATAAATAGG - Intronic
1150316462 17:64173389-64173411 TAAATATTCCACATAAAATGAGG + Intronic
1150573608 17:66410268-66410290 CAAATATTCCTCATATAAATAGG - Intronic
1152409520 17:80116322-80116344 TTAATTTTACAAATAGAAATAGG + Intergenic
1153423798 18:4939307-4939329 TATATGTTCCACATATATATGGG + Intergenic
1153585922 18:6620194-6620216 TTTATACTCCATATATAAGTTGG - Intergenic
1153861769 18:9218122-9218144 TTAAAATTACACTTAGAAATCGG - Intronic
1155302303 18:24441517-24441539 GTAGTATTCAACATAAAAATAGG + Intronic
1155682332 18:28503561-28503583 TTAATAATCTACATAATAATGGG - Intergenic
1158028116 18:52928178-52928200 TTTAGCTTCCACTTATAAATAGG - Intronic
1158072154 18:53484896-53484918 CATATATTTCACATATAAATGGG - Intronic
1158114555 18:53980003-53980025 TTTATATTCCTTATATAAGTGGG + Intergenic
1158173933 18:54632743-54632765 TTGCTATTCTAAATATAAATAGG - Intergenic
1159617067 18:70593460-70593482 ATCATATTTCACCTATAAATGGG - Intergenic
1159617480 18:70598429-70598451 TTTATTTTCCAAATATTAATGGG + Intergenic
1159907331 18:74107303-74107325 TTGAAATTCCACATATAAGTGGG - Intronic
1159930948 18:74312357-74312379 TTAAGCTTCAACATATGAATTGG + Intergenic
1159971503 18:74660812-74660834 TTAATATTTCAAATTAAAATAGG - Intronic
1162669529 19:12243403-12243425 TTAATATTCCACAATTAAGTGGG + Intronic
1163045834 19:14641187-14641209 TTCATATTTCATATATACATGGG - Intronic
1164108950 19:22136759-22136781 TTAATATTTCTCAAATTAATTGG - Intergenic
1164546771 19:29172359-29172381 TTAGGTTTCAACATATAAATTGG - Intergenic
1166710327 19:44932858-44932880 TTAATATTCAAAATATATAAGGG + Intergenic
1166797704 19:45437625-45437647 TTAAGATTCCATATAAAAGTGGG - Intronic
1168167824 19:54564462-54564484 TTAAAATTACAGATAAAAATTGG + Intergenic
1168437040 19:56326545-56326567 TTAATATTCCACATATAAATGGG + Intronic
925857193 2:8140738-8140760 ATTATATTCCACTTTTAAATGGG + Intergenic
926399000 2:12476135-12476157 TTAATATTCCACATTAACCTTGG + Intergenic
926479328 2:13370323-13370345 TTTAGATTCCACATATATGTGGG + Intergenic
926792900 2:16593386-16593408 TTCATATTCAAAATATACATGGG + Intronic
927098430 2:19766407-19766429 TTTAGAGTCCACATATAAGTGGG + Intergenic
927120435 2:19955335-19955357 TTAATATTCCTAATATGTATTGG + Intronic
927359142 2:22211351-22211373 TCTAGATTCCACATATAAGTAGG + Intergenic
927728591 2:25448926-25448948 GAAATATTCCACATTTCAATAGG - Intronic
928835818 2:35543418-35543440 TTTAGAGTCCACATATAAATGGG - Intergenic
929164815 2:38871135-38871157 TTAAAAATCCACATTTATATTGG + Intronic
930298980 2:49591862-49591884 TTAATATTCAAAATATTGATAGG + Intergenic
931519591 2:63081140-63081162 TTTATATTAGATATATAAATAGG - Intergenic
932613279 2:73215251-73215273 ATAATTTTACACATATCAATAGG - Intronic
933322354 2:80792828-80792850 TTAATTTTCCAAATTTAAAAAGG - Intergenic
933382350 2:81565465-81565487 TTAAAACTACACAAATAAATGGG + Intergenic
934026295 2:88004014-88004036 TAAATATAACACATATAGATAGG + Intergenic
935228562 2:101076599-101076621 AGGATATTCCACATAAAAATTGG + Intronic
935236910 2:101146923-101146945 TTAAGATTACACATATAAGTGGG + Intronic
935261643 2:101361004-101361026 TTAATAGTGAACAAATAAATTGG - Intronic
935353766 2:102178915-102178937 TTATTATTCCAAATAAAAGTTGG - Exonic
935643809 2:105315965-105315987 TAAATATGCCACAATTAAATGGG - Intronic
936702943 2:115035663-115035685 TTTATACCCCAAATATAAATTGG + Intronic
936832273 2:116661869-116661891 ATAATATTCCTCACAGAAATAGG + Intergenic
939032478 2:137093117-137093139 ATAATATTTCAAATATTAATTGG - Intronic
940762236 2:157750829-157750851 TTAAAAATACACAAATAAATTGG + Intronic
941472591 2:165907140-165907162 TTAATATACCACATTTGAAAAGG + Intronic
941533935 2:166699643-166699665 TTGATATCCCACATATATACAGG - Intergenic
941787424 2:169513576-169513598 TTACTAGACCACATATAGATAGG + Intronic
941939056 2:171013740-171013762 TTCATATTTCACACAGAAATTGG + Intronic
942263742 2:174199185-174199207 TTATTTTTTCACATAGAAATGGG - Intronic
942515600 2:176749302-176749324 TAAAAAATCCACATAAAAATGGG - Intergenic
943434775 2:187850938-187850960 TTCATATTCTACATATAATATGG + Intergenic
943613131 2:190058347-190058369 TTAAAATTCTACCTATAAAAAGG + Intronic
943722319 2:191218040-191218062 TTATTATCCCACAGAAAAATGGG - Intergenic
943882838 2:193169905-193169927 TTTATATTTCACCTATAATTAGG - Intergenic
943942562 2:194018856-194018878 TAATTATTACACAGATAAATAGG + Intergenic
943972678 2:194431173-194431195 ATTATATTCCACATTTATATAGG - Intergenic
944279769 2:197882179-197882201 TTAATATTCCACACCAAATTAGG - Intronic
944524163 2:200601232-200601254 TTTAGATTCCTCATATAAGTGGG - Intronic
944993154 2:205261113-205261135 TTAAAAATGCACATTTAAATGGG - Intronic
945473983 2:210260428-210260450 TTAAAATATCACATTTAAATAGG + Intergenic
945647074 2:212510716-212510738 TCAATTTTCAACATATAAGTGGG + Intronic
946947375 2:224834938-224834960 ATAATATTTCACTTATGAATTGG + Intronic
947466384 2:230351461-230351483 TTAATATACCTGATATTAATAGG - Intronic
1170927160 20:20735677-20735699 ATACTAATCCAAATATAAATTGG + Intergenic
1171841220 20:30214042-30214064 TTAATTTTACACAAATATATTGG + Intergenic
1172857760 20:38020378-38020400 TTTACATTTCACATTTAAATAGG - Intronic
1173017832 20:39242771-39242793 TTAATTTTCAACATTTTAATTGG - Intergenic
1173881298 20:46414491-46414513 TTAGTTTTCAACATATGAATGGG + Intronic
1174668917 20:52287467-52287489 TTATTATTCCATATAATAATTGG - Intergenic
1175010543 20:55730131-55730153 TTCATCTTCCACATAGAATTGGG - Intergenic
1175049074 20:56136519-56136541 TGAATATTTTACATAGAAATCGG + Intergenic
1175614076 20:60377705-60377727 TTAAAATTTCTTATATAAATGGG - Intergenic
1176580824 21:8523283-8523305 TTAATTTTACACAAATATATTGG - Intergenic
1176728018 21:10459697-10459719 GTAATATTCAACAACTAAATGGG + Intergenic
1177316212 21:19464442-19464464 TCAATATCCCACAGATAAAGAGG - Intergenic
1177365089 21:20124559-20124581 TTAAAAATCCAAATATAATTAGG - Intergenic
1177436410 21:21059536-21059558 ATTATATTCCAAATATAAAAAGG - Intronic
1177883734 21:26723726-26723748 TTTATATTTCTCATATAATTTGG - Intergenic
1180114649 21:45692842-45692864 CTAATATTCCTCATGTAACTAGG + Intronic
1182232481 22:28849273-28849295 ATAATATTTCACATATTGATGGG + Intergenic
1183920406 22:41162593-41162615 TTAAGAATACACATTTAAATAGG - Intronic
1184655370 22:45938876-45938898 GTAATATTACACATATTTATGGG - Intronic
1185205898 22:49538418-49538440 TTAATATTTCAGATAAGAATTGG - Intronic
949160454 3:875897-875919 TTCCTATTCAACATATGAATGGG - Intergenic
949630590 3:5921405-5921427 TGAATATTCAACATGTAAAGTGG + Intergenic
949810082 3:7997874-7997896 TTTACATTCCCCTTATAAATTGG - Intergenic
951828186 3:26892820-26892842 ATAATAATACATATATAAATCGG + Intergenic
952069344 3:29615365-29615387 TTAACTTTCCTCATATTAATAGG + Intronic
952135961 3:30420014-30420036 TTTACATTCCACATATAAGTGGG - Intergenic
952236810 3:31488443-31488465 TTAAGTTTCAACATATGAATTGG - Intergenic
952438620 3:33299351-33299373 TTAATATTCCACAGAAAATTTGG + Intronic
952719717 3:36519815-36519837 TCAATATATCACATATACATAGG + Intronic
953401046 3:42617509-42617531 TAAATATATCACATTTAAATGGG - Intronic
953463206 3:43097682-43097704 TAGATCTTCAACATATAAATGGG + Intronic
954229756 3:49207577-49207599 TTAATATTCCAGTATTAAATCGG - Intronic
954942543 3:54387871-54387893 TTTCTATTCCCCATATAAATGGG - Intronic
955956858 3:64299244-64299266 TTAATATTCCTCATTAAATTTGG - Intronic
955965296 3:64382873-64382895 TTAAGTTTCAACATATGAATTGG - Intronic
956243992 3:67160535-67160557 TTTATATTCCTCATATCACTGGG + Intergenic
956350625 3:68331779-68331801 TTAATTTACCATATATGAATGGG - Intronic
956690355 3:71872649-71872671 TTTATATTCCACCAATAACTTGG - Intergenic
957593900 3:82235651-82235673 TTTAAATTCCACATAAAAAGGGG - Intergenic
957651999 3:83019600-83019622 CTAATATTCAACAAATACATTGG + Intergenic
957721575 3:84008252-84008274 ATTATAATCCAAATATAAATTGG - Intergenic
958471574 3:94527487-94527509 TTAATTTTCCAGATACATATGGG + Intergenic
958889384 3:99766597-99766619 TTAATATTCACCATAATAATTGG + Intronic
958936956 3:100265719-100265741 TTAATATTCAACTTTTAATTAGG + Intronic
959279991 3:104325338-104325360 TTAATATAAAACATATGAATAGG - Intergenic
959283464 3:104378179-104378201 TTAAAATTCCACATAAGATTTGG - Intergenic
959509558 3:107195442-107195464 TAAATATTTCATAAATAAATTGG - Intergenic
960066857 3:113383488-113383510 TTAGGCTTCAACATATAAATTGG + Intronic
960175512 3:114513390-114513412 TTAAAATTCAAAATATAAATAGG - Intronic
960402007 3:117211638-117211660 TTAATATTCCTCAAGTATATTGG - Intergenic
960549988 3:118964701-118964723 TTAATATTCTCCTCATAAATTGG - Intronic
962271865 3:133983277-133983299 TTAATGTTCCACGGATAACTCGG + Intronic
962863867 3:139430374-139430396 TAAAAATTCCAAAAATAAATTGG - Intergenic
963374660 3:144448807-144448829 TTAAGATTCCACGTATAACTGGG + Intergenic
963428985 3:145172083-145172105 TTCATATTTCATTTATAAATTGG - Intergenic
963491871 3:146012152-146012174 TTAAAGTTCCAAGTATAAATAGG + Intergenic
963715876 3:148803222-148803244 TGTATATTTCATATATAAATGGG + Intronic
963950500 3:151194731-151194753 TTAATATTAGAAATAAAAATTGG + Intronic
964192458 3:154019345-154019367 TTAATCTTGCAAAAATAAATTGG + Intergenic
964791463 3:160456627-160456649 TTAAAAATCCACCCATAAATGGG - Intronic
964804401 3:160591668-160591690 TCAATATTCAACATAGATATTGG - Intergenic
965122249 3:164576029-164576051 ATAATGTTGCACATATAATTTGG - Intergenic
965382110 3:168002735-168002757 ATAATTTTGAACATATAAATTGG + Intergenic
965440776 3:168711154-168711176 TTATTATTGTACATATACATGGG + Intergenic
965957672 3:174390219-174390241 TCAAAATTCCACATATTAATAGG + Intergenic
967415798 3:189217035-189217057 TTAATCTTGCACATTTTAATTGG + Intronic
968772070 4:2513805-2513827 TGAATACTTCATATATAAATGGG - Exonic
970654479 4:18215923-18215945 TTAAGCTTCAACATATGAATTGG - Intergenic
970727423 4:19062711-19062733 TCAATATTAGACAGATAAATGGG + Intergenic
970779788 4:19722859-19722881 TTAGTTTTCCACATATTAAATGG - Intergenic
970815172 4:20146864-20146886 TTATTATTCAATGTATAAATAGG - Intergenic
970900917 4:21159292-21159314 TCAATATTCTACATATTCATGGG - Intronic
970916168 4:21337802-21337824 TTAATATTCCACTTTACAATAGG - Intronic
971662132 4:29432488-29432510 TTATTATTCTACTTTTAAATTGG + Intergenic
972052306 4:34753109-34753131 TTTAGATTCCTCATATAAGTAGG - Intergenic
972147907 4:36051909-36051931 TTAATATTTAACATATAGATTGG - Intronic
974279793 4:59778585-59778607 TTAGTATTCCACATAAAGAAAGG - Intergenic
974290519 4:59923860-59923882 TTAATAATCCAGCTAAAAATGGG + Intergenic
974561268 4:63522272-63522294 TAAATATTGCAAATAAAAATAGG + Intergenic
974773205 4:66443180-66443202 TTAATATTCCACAGAATAATTGG - Intergenic
974823671 4:67099693-67099715 TTAATAATTCACATATTTATGGG + Intergenic
975031116 4:69618155-69618177 ATATTATTTCACAGATAAATAGG + Intronic
975361981 4:73481052-73481074 TTTAGATTCCACATATAAGTAGG + Intergenic
976040919 4:80884370-80884392 TTAATATTCCACTTATTTGTGGG - Intronic
976041785 4:80894932-80894954 TTTAGATTCCACATATAAAGTGG - Intronic
976203450 4:82601914-82601936 TTACTATTCCAACTGTAAATCGG - Intergenic
976779321 4:88740570-88740592 TTACTATTTCACATATAATAAGG + Intronic
976945032 4:90754827-90754849 TTAATCTTACACATAAAACTTGG + Intronic
977770594 4:100853289-100853311 TTAAGATTCCACATATAAGTGGG + Intronic
978056962 4:104282037-104282059 TAAATATTTCCCATCTAAATGGG + Intergenic
978080516 4:104584716-104584738 TTAATGTTCAAAGTATAAATAGG - Intergenic
978801149 4:112756549-112756571 TTAATAATCCACATGTTACTTGG + Intergenic
979068442 4:116168991-116169013 TTAAAATTCCACATGAAATTGGG + Intergenic
979091310 4:116486497-116486519 CTAATGTTCAACATATAGATTGG - Intergenic
979155919 4:117391151-117391173 TTAAAATTGAAAATATAAATAGG - Intergenic
979444977 4:120802009-120802031 TTATTCATCCACATATAAAATGG + Intronic
979496367 4:121387914-121387936 TTAAAAATACACAAATAAATGGG + Intergenic
979727076 4:123974910-123974932 TTAAGATTTAACATATGAATTGG - Intergenic
979841602 4:125449032-125449054 CCAATATTTCAGATATAAATGGG - Exonic
980025062 4:127756357-127756379 TTAAAATTCCATATATAAGTGGG - Intronic
980453774 4:133012333-133012355 TTTAAATTCCTCATTTAAATAGG - Intergenic
980789256 4:137597593-137597615 ATAAAATTTGACATATAAATGGG - Intergenic
981320954 4:143390723-143390745 TTTATATTGCTCATATAAAAGGG + Intronic
981812291 4:148789527-148789549 TTAAAATTCAACATACAAGTAGG + Intergenic
982387322 4:154824008-154824030 TGTGTATTCCATATATAAATAGG + Intronic
982534481 4:156592577-156592599 TTTCAATTCTACATATAAATGGG + Intergenic
982622181 4:157722518-157722540 TTATTATGGCAAATATAAATTGG + Intergenic
982665432 4:158255357-158255379 TTAAAATTTTGCATATAAATTGG - Exonic
983481727 4:168282840-168282862 TTATTATTCCAGAAATAGATTGG + Intronic
983618854 4:169738205-169738227 TAAATATTCCAGGTAAAAATAGG - Intronic
983948713 4:173615106-173615128 TCAATATTACACAGATCAATGGG - Intergenic
984220037 4:176964066-176964088 ATAATATTCCCCATTAAAATAGG + Intergenic
984291699 4:177803827-177803849 TTAATATTCAAAAGTTAAATTGG - Intronic
986470661 5:8071099-8071121 ATAATATTTGACATATAATTAGG - Intergenic
986702176 5:10421297-10421319 TTGATATTCCACATTTTATTTGG - Intronic
986998658 5:13636344-13636366 AAAAAATTCCACATATAAGTGGG - Intergenic
988062580 5:26192431-26192453 TAAATCTTCCACATATCACTTGG + Intergenic
988655238 5:33204197-33204219 TTAGTTTTCAACATACAAATTGG - Intergenic
988945497 5:36193098-36193120 TTAATATGTAACATATTAATAGG - Intronic
990100584 5:52181031-52181053 TTTAGATTCCACATGTAAATGGG - Intergenic
990166824 5:53003704-53003726 TTAAGATTCCACCTATGGATGGG + Intronic
990384849 5:55250452-55250474 CTTAGATTCCACATATAAATGGG + Intergenic
991653024 5:68875345-68875367 TTAATATTATACTTACAAATAGG - Intergenic
991996842 5:72396105-72396127 TTTATATGCCACAAATAAGTTGG - Intergenic
993315748 5:86403815-86403837 TTAATGTTGAACATTTAAATTGG - Intergenic
993574592 5:89586107-89586129 TTAGCTTTCAACATATAAATTGG + Intergenic
994124783 5:96156503-96156525 TTCATATTCCTCCTCTAAATTGG - Intergenic
994310236 5:98260596-98260618 ATAATATTACAAATATACATTGG - Intergenic
994524375 5:100884130-100884152 TCAATATTCCAAATTGAAATTGG + Intronic
994600177 5:101892935-101892957 TTTAGATTCCACATATAAGTGGG + Intergenic
994890834 5:105633798-105633820 TTAATATTCCTCTTTAAAATTGG + Intergenic
995165620 5:109036971-109036993 TAATTTTTCCACATATAAATGGG - Intronic
996268097 5:121567813-121567835 TTTAGATTCAACATATAAGTGGG - Intergenic
996626563 5:125576829-125576851 TTAATATTAAACATATAGACAGG - Intergenic
996640490 5:125745918-125745940 TTAATATTCCTCAGTGAAATAGG - Intergenic
997712061 5:136014161-136014183 TTTATATTACACATTTAAAAGGG - Intergenic
997748390 5:136320202-136320224 TTCATAACCCACATATAATTTGG + Intronic
999159170 5:149481152-149481174 TTAATATTTCTCATGTTAATTGG - Intergenic
999647409 5:153731962-153731984 TTGAGATTCCACATATAAGTGGG + Intronic
999890370 5:155972320-155972342 TTATTATTCCAAAAATAAAAAGG - Intronic
999939276 5:156522826-156522848 TCTAAATTCCACATATAAAATGG + Intronic
1000501659 5:162058844-162058866 GTAATATTCCACATTTTTATAGG - Intergenic
1000953693 5:167516661-167516683 TTAATAATCAACAAGTAAATGGG - Intronic
1001060587 5:168485273-168485295 TTTAGATTACACATATACATGGG - Intergenic
1001793438 5:174481636-174481658 TTTGGATTCCACATATAAGTGGG - Intergenic
1002995377 6:2278193-2278215 TTTAGATTCCACATGTAAGTGGG + Intergenic
1003913607 6:10765176-10765198 TTAATATTTTACATTTAGATAGG + Intronic
1004046388 6:12028050-12028072 TTAATTCTCCACAGATGAATTGG + Intronic
1005451778 6:25980844-25980866 TTAAAATTCCACCTATCTATTGG - Intronic
1008203931 6:48629632-48629654 TTAAGATACCACATATAATATGG - Intergenic
1008724230 6:54396674-54396696 TTACTAGTACCCATATAAATTGG - Intergenic
1009548325 6:65051755-65051777 TTTAGATTCCACACATAAGTGGG - Intronic
1009724038 6:67513020-67513042 TTTATATTATGCATATAAATGGG - Intergenic
1009748414 6:67850770-67850792 TTAATATTCATCAGATATATTGG - Intergenic
1010106433 6:72174705-72174727 ATAATATTAAATATATAAATAGG + Intronic
1010350652 6:74870367-74870389 TTAACATTCCACATTCCAATAGG - Intergenic
1010428639 6:75753319-75753341 GTAATATTACTAATATAAATTGG + Intronic
1010480399 6:76345157-76345179 AATATATTCCACATATAAATGGG + Intergenic
1011180939 6:84619854-84619876 TTTGTATTCCACAAATAAGTGGG + Intergenic
1011460113 6:87593993-87594015 TTAATACTACACATTAAAATGGG - Intronic
1011529752 6:88308824-88308846 TAAATATTCCAGACATAAAGAGG - Intergenic
1012126332 6:95433120-95433142 TGCAGATTCCTCATATAAATGGG - Intergenic
1012299804 6:97571940-97571962 TAAATATTCAACATTTAAAAAGG - Intergenic
1013972043 6:116031803-116031825 TTCATATTTCATAGATAAATTGG - Intronic
1013990528 6:116250479-116250501 TTAATCTTCCACACATATAAAGG + Exonic
1014313899 6:119839535-119839557 TTTACATTCCACATATAAGTGGG + Intergenic
1014730238 6:125023846-125023868 TTAAGATTCCATATATAAAGGGG - Intronic
1014828288 6:126071535-126071557 TTAATATTCCACCAACACATGGG - Intergenic
1014836699 6:126168007-126168029 TTCACATTCCAGCTATAAATGGG - Intergenic
1015360236 6:132331551-132331573 TTATTATTCCAGGGATAAATTGG - Intronic
1015685724 6:135857303-135857325 GTCATAATTCACATATAAATAGG + Intronic
1016022581 6:139251683-139251705 TCAATATTTCACTTTTAAATGGG + Intronic
1017353934 6:153479887-153479909 TTAATATTACAGTTATAAAATGG - Intergenic
1017367422 6:153660548-153660570 TAAATATTCCATATATGAACAGG + Intergenic
1017483097 6:154877438-154877460 TTAAGAACCTACATATAAATGGG - Intronic
1020525131 7:9250160-9250182 TTAAGATTCCACATTAAAGTGGG + Intergenic
1020541908 7:9469373-9469395 TTAAAATTCAACATAAAACTTGG - Intergenic
1021100155 7:16578886-16578908 TTTAGATTCCATATATAAGTGGG - Intronic
1022351238 7:29567255-29567277 TTAATAGTCCACACTAAAATAGG - Exonic
1022584895 7:31599264-31599286 TAAATATTACAAATATAAGTTGG + Intronic
1023129625 7:36989535-36989557 TTAATCTCCCACATATAAAATGG + Intronic
1024122161 7:46254988-46255010 GTAATATTGTTCATATAAATTGG - Intergenic
1024495306 7:50039539-50039561 TTTATATATAACATATAAATTGG + Intronic
1024866676 7:53911210-53911232 TTAATTTTCCAGTTTTAAATGGG + Intergenic
1025289730 7:57705569-57705591 TTAATTTTACACAAATATATTGG + Intergenic
1025530525 7:61875995-61876017 TGAAGATTCCAGATAAAAATTGG - Intergenic
1025968400 7:66297559-66297581 TAAATATTCCATTCATAAATTGG - Intronic
1026518292 7:71092327-71092349 ATCAAATACCACATATAAATGGG + Intergenic
1027356245 7:77358485-77358507 TTCATATGCCACATGTAAAATGG + Intronic
1027734106 7:81910905-81910927 TTAAAATTCCACATATAAGTGGG + Intergenic
1027819054 7:83020357-83020379 TTAAGTTTCCACACTTAAATTGG - Intronic
1027896877 7:84055729-84055751 TTAAGAATCAACATATAATTTGG - Intronic
1028397005 7:90380854-90380876 TTAAGATTCCACATATAAGTGGG + Intronic
1028863608 7:95682243-95682265 TTCAAATTCCAAATTTAAATCGG - Intergenic
1030431939 7:109460278-109460300 TCAATATACCACTTACAAATTGG - Intergenic
1030476247 7:110036344-110036366 TTTAGATGCCTCATATAAATGGG + Intergenic
1030920203 7:115375025-115375047 TTAATATTCCATAGAAGAATAGG + Intergenic
1030928687 7:115493927-115493949 TAAATTTTCCACAAATAATTTGG - Intergenic
1030992665 7:116319047-116319069 TAAATATCCCACATAAACATAGG + Intronic
1031582694 7:123496529-123496551 TTCTTATTCCAAATATAAAGTGG + Intronic
1031642111 7:124178101-124178123 TTAGAATTCAACATATGAATTGG - Intergenic
1031819150 7:126477163-126477185 TTTAGATTCCACATATAAGTGGG - Intronic
1033297695 7:140156006-140156028 TTAACATTTCACAGATTAATTGG - Intronic
1033525404 7:142208700-142208722 GTAATATCCCACATCTTAATAGG + Intronic
1033770160 7:144541654-144541676 TTAAGTTTCAACATACAAATTGG + Intronic
1034518167 7:151598224-151598246 TTTAGATTCCACAGATGAATGGG - Intronic
1035077102 7:156187324-156187346 TGAATATTCCAAATATAAGTTGG + Intergenic
1035563063 8:622281-622303 TTGAGTTTCAACATATAAATGGG - Intronic
1035920492 8:3670594-3670616 TATATATTGCACATATATATGGG + Intronic
1036459330 8:8937965-8937987 AAAAAAATCCACATATAAATAGG + Intergenic
1037211811 8:16397904-16397926 TTTATATCACACATATAAATTGG - Intronic
1037213192 8:16417295-16417317 TTAATATTACACCTAATAATGGG + Intronic
1037297479 8:17416254-17416276 TTAAGATTCCACAAATGAGTGGG - Intergenic
1038260601 8:25990278-25990300 ATAACAATCCACATATAAATAGG - Intronic
1038759161 8:30370401-30370423 TTTTTATTCCACTTATAAATGGG + Intergenic
1038983251 8:32782012-32782034 TATATATATCACATATAAATAGG + Intergenic
1038992515 8:32884058-32884080 TTAATCTTCCTAATATAAACTGG + Intergenic
1039373080 8:37006450-37006472 TTAATTTTCCACCTAGTAATGGG - Intergenic
1040619208 8:49071085-49071107 TTTAGATTCCACATGTAAGTGGG + Intronic
1040638480 8:49303690-49303712 TTTAGATTCCACATATGAGTGGG + Intergenic
1040767590 8:50932557-50932579 TTAAAATTACCTATATAAATGGG + Intergenic
1041296775 8:56364917-56364939 TTTAGGTTCCACATATGAATGGG - Intergenic
1041504093 8:58575089-58575111 TTCAGATTCCACATATAAGTGGG + Intronic
1041609169 8:59823857-59823879 TAAATAATCCACATATTCATTGG - Intergenic
1041641227 8:60204333-60204355 TTAACATTCGACATACAAGTTGG + Intronic
1041970880 8:63741151-63741173 TTAATATCCCTCAAATAAATTGG - Intergenic
1042006917 8:64191339-64191361 TTTAGGTTCCACATATAAGTGGG - Intergenic
1042074923 8:64982526-64982548 TTATTATAAAACATATAAATAGG + Intergenic
1042418548 8:68557215-68557237 CTAAAATGCCAAATATAAATAGG - Intronic
1042521149 8:69711914-69711936 TTAAATTTGCACATATATATTGG + Intronic
1042806715 8:72778385-72778407 TTAATATTCCCCCAATAAAGAGG - Intronic
1043039676 8:75246358-75246380 TTTATATGCCATATATAATTGGG + Intergenic
1043140615 8:76585097-76585119 TTCATTTTCCAAATATGAATGGG + Intergenic
1043205411 8:77432725-77432747 TTTAGATTCCACATATAAGTGGG + Intergenic
1043656202 8:82670321-82670343 TATATATTCTACATATATATAGG - Intergenic
1043674249 8:82930344-82930366 TTAATATTCAAAATATAGATTGG - Intergenic
1044002350 8:86899099-86899121 TTTAAATTTCACATATAAGTGGG - Intronic
1044467176 8:92520991-92521013 TTAACCTTCCACATATAAGGTGG - Intergenic
1045974701 8:108119038-108119060 TTTATATTCCTTATATAAAAAGG + Intergenic
1046409078 8:113815311-113815333 TTATTCTTCTACATATAGATAGG + Intergenic
1047001174 8:120574138-120574160 TTTAGATTCCTCATATAAATGGG - Intronic
1047347618 8:124043264-124043286 TTAGTTTTCCTCATTTAAATGGG - Intronic
1047427866 8:124763150-124763172 ATCATATTCCACATATACATTGG - Intergenic
1047619111 8:126588394-126588416 GTAATTTTCCACATGTAAAAAGG - Intergenic
1047910597 8:129524659-129524681 TTAATATTCCATTTTTAAAATGG + Intergenic
1048506088 8:135023211-135023233 TTAAGCTTCCACATATGAGTGGG + Intergenic
1048740181 8:137549422-137549444 TTTATATTCTACATATAAGTGGG - Intergenic
1050919401 9:11182787-11182809 TAAATATTCAACATAAAAAAAGG - Intergenic
1051236945 9:15011193-15011215 TAAATATTCCAGATAAAAATAGG + Intergenic
1051770398 9:20572133-20572155 TTTAGATTCCACATACAAGTGGG - Intronic
1051803416 9:20963174-20963196 TAAATCTTCCACATTTAAAAGGG - Intronic
1052487421 9:29119303-29119325 TTAATATTCAAAATATATAAGGG + Intergenic
1052563970 9:30122681-30122703 TTAATATTTCACTAATATATCGG + Intergenic
1052574079 9:30268811-30268833 TAAACAATCAACATATAAATGGG + Intergenic
1052639470 9:31147346-31147368 TTGTTATTCCACATATAGAAAGG - Intergenic
1052656590 9:31370579-31370601 TTCAGATTCCACATATGAGTTGG + Intergenic
1053564954 9:39239670-39239692 TTAAAATTCCACATGTAAGTGGG - Intronic
1053830732 9:42077545-42077567 TTAGAATTCCACATGTAAGTGGG - Intronic
1054132196 9:61379369-61379391 TTAAAATTCCACATGTAAGTGGG + Intergenic
1054599826 9:67109892-67109914 TTAGAATTCCACATGTAAGTGGG + Intergenic
1055032504 9:71784672-71784694 TTAATATTCCTAATATAGTTTGG - Intronic
1055253515 9:74337449-74337471 TGAATCTTCCACATATATAGGGG - Intergenic
1055460223 9:76512346-76512368 TTTAGATTCCACATGTAAGTGGG + Intergenic
1055817633 9:80225687-80225709 TTTATATTCCACTTATAAGCAGG + Intergenic
1055850574 9:80624144-80624166 TTATTATTCCTCTCATAAATTGG + Intergenic
1057845723 9:98520959-98520981 TTAAAATTCCTCATTTATATTGG - Intronic
1057973870 9:99583129-99583151 ATGAAATTCCAAATATAAATTGG + Intergenic
1057974921 9:99595152-99595174 TGTAGATTCCACATATAAGTGGG + Intergenic
1058140686 9:101354430-101354452 TTAGGTTTCAACATATAAATTGG + Intergenic
1058223837 9:102336481-102336503 TCCAGATTCCTCATATAAATGGG + Intergenic
1058663476 9:107287430-107287452 TTAAAATTCTACATATACATTGG + Intronic
1060689486 9:125644044-125644066 TGAATATTCCACTTTTTAATTGG - Intronic
1061543859 9:131292458-131292480 TTATTATTCCCCATTTAAAGAGG + Intronic
1061686050 9:132279600-132279622 TTAAAATCACACATATAAATAGG - Intronic
1061972462 9:134052397-134052419 TTAATAGTCCCCATATCCATTGG + Exonic
1203610839 Un_KI270749v1:1375-1397 TTAATTTTACACAAATATATTGG - Intergenic
1186003190 X:5037872-5037894 TGAAAATTCTACATATAGATTGG - Intergenic
1187493132 X:19771555-19771577 TTAGTATTACACTTAAAAATTGG + Intronic
1187585417 X:20655906-20655928 TTTAGATTCCACATATAAGTAGG - Intergenic
1187666651 X:21619339-21619361 CTAATATTCCCTATATTAATAGG - Intronic
1188217633 X:27498771-27498793 ATTAGATTCCACATATAAATGGG + Intergenic
1189080301 X:37964042-37964064 TTAAGTTTCAACATAGAAATAGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190868878 X:54408183-54408205 ATAATAATCCACCTAAAAATGGG + Intergenic
1192486331 X:71530262-71530284 CTAATATTCCAGAGAGAAATTGG - Intronic
1193117835 X:77792688-77792710 TTAATATTCAGAATATAAAAGGG + Intergenic
1193183752 X:78488040-78488062 TTTAGCTTCCACATATGAATGGG - Intergenic
1193669303 X:84364823-84364845 TTTAGATTCCTCATATAAGTGGG + Intronic
1193724977 X:85027358-85027380 TTAATATTCAACATGTGATTTGG + Intronic
1194107023 X:89782560-89782582 TTAATATTCATCATATATATTGG - Intergenic
1194566673 X:95497329-95497351 TAAATAAACCACATATACATAGG - Intergenic
1195224239 X:102776153-102776175 TCAATATTCATCATAGAAATTGG + Intergenic
1195334350 X:103834935-103834957 TTAATATTGAACATATTCATAGG + Intergenic
1195710617 X:107770842-107770864 TTCATATGCTACATTTAAATTGG + Intronic
1195808889 X:108807244-108807266 ATAGTAATCCACATATAAACTGG - Intergenic
1196052317 X:111318711-111318733 TTAATTTCCCACTTATAAGTGGG + Intronic
1196335707 X:114530771-114530793 TAAATATTCCACATATATATCGG - Intergenic
1196390969 X:115207217-115207239 TAAAAATTCCACCTAAAAATCGG + Intronic
1196657650 X:118235786-118235808 TTAAGATTCTACACATAAGTGGG - Intergenic
1197069849 X:122283478-122283500 TTAATATTCCTCAAAGATATTGG - Intergenic
1197160796 X:123319842-123319864 TTAATATGCCACATTTGTATTGG + Intronic
1197394610 X:125911104-125911126 TTAAGTTTCAACATATGAATTGG + Intergenic
1197444293 X:126530150-126530172 TGAATAATCCATATAAAAATGGG + Intergenic
1197492510 X:127135899-127135921 TTTAGATTCCACAAATAAGTGGG - Intergenic
1197588746 X:128383031-128383053 TTTACATTCTACATATAAGTTGG - Intergenic
1197630765 X:128855091-128855113 TTCAGATTCCACATACAAATGGG - Intergenic
1199572673 X:149283426-149283448 TTAATTTTATACATTTAAATAGG + Intergenic
1199781584 X:151066068-151066090 TTGTTATTCAACATATTAATAGG - Intergenic
1200458982 Y:3430420-3430442 TTAATATTCATCATATATATTGG - Intergenic
1200976966 Y:9222359-9222381 TGAATATTACACTTATAATTTGG - Intergenic
1201369368 Y:13244511-13244533 ATAATATTTCCCATATATATGGG - Intergenic