ID: 1168439980

View in Genome Browser
Species Human (GRCh38)
Location 19:56356282-56356304
Sequence CCTTTTAAACAATCAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168439972_1168439980 14 Left 1168439972 19:56356245-56356267 CCAGGAAAGTCTGAGCCCCGAAC 0: 1
1: 4
2: 9
3: 8
4: 91
Right 1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 327
1168439974_1168439980 -2 Left 1168439974 19:56356261-56356283 CCCGAACAAAGAGAGCAGCCACC 0: 1
1: 0
2: 11
3: 19
4: 205
Right 1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 327
1168439975_1168439980 -3 Left 1168439975 19:56356262-56356284 CCGAACAAAGAGAGCAGCCACCT 0: 1
1: 0
2: 8
3: 20
4: 188
Right 1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 327
1168439973_1168439980 -1 Left 1168439973 19:56356260-56356282 CCCCGAACAAAGAGAGCAGCCAC 0: 1
1: 0
2: 8
3: 14
4: 125
Right 1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168439980 Original CRISPR CCTTTTAAACAATCAGTGGT GGG Intronic
902580915 1:17407022-17407044 CCTTTAAAACAAGGAGTTGTGGG - Exonic
903150888 1:21407796-21407818 TCTTTTCAACAAACAGTGCTGGG - Intergenic
904849924 1:33450609-33450631 CCTATTCAACAAACAGTGCTGGG + Intergenic
906046097 1:42832114-42832136 ACTTTAAAACACTCAGTAGTTGG + Intronic
906591170 1:47025188-47025210 TCTTTTCAACAATCAGTTCTGGG - Intronic
906910899 1:49949100-49949122 CCTATTCAACAAACAGTGCTGGG + Intronic
907779866 1:57556986-57557008 CCTATTCAACAAACAGTGCTGGG - Intronic
907959800 1:59268240-59268262 TCTTTTAAACAATCAGATCTTGG + Intergenic
908606306 1:65800650-65800672 CATTTGAAACAATTTGTGGTAGG + Intronic
908972252 1:69850802-69850824 TCTATTAAACAATCAGCTGTTGG + Intronic
909746851 1:79108195-79108217 ACTTGTTAACAATCATTGGTAGG - Intergenic
909822647 1:80085725-80085747 TCTTTCAAACAGCCAGTGGTGGG - Intergenic
910906830 1:92190078-92190100 GCTTTTAAAAGATCAGTAGTGGG + Intergenic
911316930 1:96367151-96367173 CTTTTTAAAAAATAAGTAGTAGG - Intergenic
911571918 1:99527886-99527908 CATTTAATACAATCAGTGGTTGG - Intergenic
913421492 1:118674676-118674698 CCTTTTGAACAATCACAGGATGG + Intergenic
914862148 1:151395630-151395652 TCTTTTCAACAAACAGTAGTGGG + Intergenic
915074204 1:153295474-153295496 CCATTTATACAATCAGAGGAAGG - Intergenic
915700154 1:157784436-157784458 CCTTTTAATAAATGAATGGTGGG + Intergenic
915917991 1:159952559-159952581 CCCTCTAAACAATCAGGGATCGG + Intronic
917898067 1:179512295-179512317 CCTTTTAAACAAATGGTGCTGGG - Intronic
917907591 1:179602609-179602631 CCTTTTAAACAAATGGTGCTGGG - Intronic
919228860 1:194745898-194745920 TCTTTTCAATAAACAGTGGTGGG - Intergenic
919576785 1:199320116-199320138 CCTTTCCAATAAACAGTGGTAGG - Intergenic
919578536 1:199341663-199341685 CCTATTCAATAAGCAGTGGTAGG + Intergenic
921504064 1:215944807-215944829 CCTGAAAAAAAATCAGTGGTAGG + Intronic
922424276 1:225479129-225479151 CCTTTTAAACAGTCAGTCTTTGG + Intergenic
922691290 1:227693527-227693549 CCTGTTAAAGATTCAGTGGTAGG - Intergenic
923821560 1:237448878-237448900 TCTTTTAAGCAATAAGTAGTTGG + Intronic
924187664 1:241512258-241512280 CTTTTTAAAGTATCTGTGGTTGG - Intronic
1063952095 10:11233145-11233167 CCCTTTTAAAAATCAGTGTTGGG - Intronic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1065867434 10:29926253-29926275 ACTTTTAAACAATCAGATCTCGG + Intergenic
1066269323 10:33807005-33807027 GCTTTTAAACAATCTGAGGCAGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1068347945 10:55808375-55808397 CCTTTTTAACAAATAGTGCTGGG + Intergenic
1068562757 10:58534330-58534352 CCTTTGAAAGAAGCAGTGGGCGG + Intronic
1068783869 10:60948707-60948729 CATTTTAAAGAATAAGTGTTTGG + Intronic
1068817761 10:61336762-61336784 CCTTGTAAATAAACAGTGATTGG - Intergenic
1069163602 10:65120538-65120560 CCTATTTAATAAACAGTGGTGGG - Intergenic
1069743705 10:70701653-70701675 CCTTTAAAAAAATCAGGTGTTGG - Intronic
1070661990 10:78313626-78313648 CCTGTTTAACAATCACTTGTTGG + Intergenic
1071911792 10:90244463-90244485 CTTTGTAAAGAATCAGTGCTAGG - Intergenic
1072073009 10:91938498-91938520 TCTTTTCAACAAACGGTGGTGGG - Intronic
1073731934 10:106299014-106299036 GCTATTAAAAAATCAGTTGTAGG - Intergenic
1074356103 10:112784872-112784894 CCTTTTAAAAAGTCAGTGGGAGG - Intronic
1076928992 10:133515234-133515256 TCTTTTCAACAAACAGTGCTGGG + Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1079810044 11:24986847-24986869 TCTTTTAAACTAAAAGTGGTAGG - Intronic
1081828389 11:46081580-46081602 CATTTCAGACAATCAGGGGTAGG + Intronic
1083117070 11:60471849-60471871 TCTTTTCAACAAACTGTGGTGGG + Intergenic
1083390407 11:62345567-62345589 CCTTTTCAACAATTGGTGCTGGG - Intronic
1083393912 11:62375209-62375231 CCTTTAAAACAAAGAGTTGTGGG + Intronic
1084284643 11:68123022-68123044 CCTTTCAAACATCCAGTGGCCGG - Intergenic
1085654633 11:78301948-78301970 CCTATTCAACAAACAGTGCTGGG + Intronic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086265028 11:84987677-84987699 CCTATTCAACAAACAGTGCTGGG + Intronic
1087310700 11:96538834-96538856 CCTTTTAAAAAAAAATTGGTAGG - Intergenic
1088480476 11:110291990-110292012 CTTTTTAAAAAATTAGTTGTTGG + Intronic
1088978309 11:114835466-114835488 CCTTTTAAATAATGAGGGGAAGG - Intergenic
1089005720 11:115089108-115089130 ACTTTTAAACAATCAGACCTAGG - Intergenic
1089851751 11:121503401-121503423 CCTTTTCAACAAATGGTGGTGGG - Intronic
1089937433 11:122378465-122378487 CCTTTTCAACAAATAGTGCTGGG + Intergenic
1090038778 11:123272022-123272044 CCTTTTAAAAAATCTGTCATGGG - Intergenic
1090222713 11:125043850-125043872 CTTTTTCAACAAACAGTGTTGGG - Intergenic
1090816860 11:130305515-130305537 CCTATTCAACAAACAGTGCTGGG + Intronic
1092438108 12:8469692-8469714 CCTATTCAACAAACCGTGGTGGG + Intronic
1092962125 12:13606391-13606413 TCTTTTTAACAATCAGCTGTTGG + Intronic
1095374512 12:41510489-41510511 GCTTTTAAATAATCAATGGATGG - Intronic
1097441780 12:59616814-59616836 CCTTTTAAATAATGAATGTTGGG - Intronic
1097816559 12:64080743-64080765 CCATTAAAACAAACAGGGGTGGG - Intronic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1098555457 12:71813722-71813744 CCTCTTAAACAGACAGAGGTAGG - Intergenic
1098952727 12:76658378-76658400 CCTTTTAAACAAATGGTGCTCGG + Intergenic
1098982274 12:76969776-76969798 CCTTTTCAACAAATGGTGGTGGG - Intergenic
1099713924 12:86265395-86265417 CCTTTTCAATAAACAGTGGTGGG - Intronic
1100487507 12:95044582-95044604 GCTTTTAAAAAATCACTGGATGG + Intronic
1100923944 12:99522545-99522567 CATTTAAAACTATCAGTGGTGGG + Intronic
1101384256 12:104242237-104242259 GCTTTTAAAAAATCATTAGTAGG - Intronic
1102200376 12:111053857-111053879 CCTTTTAAAAACTCAGAGCTGGG + Intronic
1102869322 12:116401251-116401273 ACTTTTAAACAATCAGACCTCGG + Intergenic
1103932136 12:124456542-124456564 CCTTGTAAACAGTAAGTGCTGGG - Intronic
1106238857 13:27891232-27891254 CCTTTTCAACAAACGGTGCTGGG - Intergenic
1106369279 13:29115860-29115882 CTTTTTAAAGAATCAGTTGGAGG - Intronic
1106486925 13:30180527-30180549 CCTTACACACAATAAGTGGTAGG - Intergenic
1107126044 13:36848069-36848091 CATTTTAAACAAACTGTGATCGG - Exonic
1107358812 13:39597584-39597606 CCTTTTAAAAACTCAGTTGAGGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1109435354 13:62292179-62292201 CCATTTAAACAATCAATCCTGGG - Intergenic
1109619685 13:64887355-64887377 CCTTGTAAAAGATCAGTTGTTGG - Intergenic
1110069409 13:71154696-71154718 CCTATTCAATAAACAGTGGTGGG - Intergenic
1110791519 13:79591492-79591514 CTTTATAAACTATCTGTGGTTGG + Intergenic
1110793260 13:79608508-79608530 CCTATTCAACAAACAGTGCTGGG - Intergenic
1111276680 13:85957650-85957672 ACATTTAAACAATATGTGGTGGG + Intergenic
1111419621 13:87995529-87995551 CCTTTTCAATAAACAGTGCTGGG - Intergenic
1111990701 13:95113836-95113858 CCATTTAAACAATGAATGTTGGG + Intronic
1112001703 13:95216559-95216581 CCTTTTAAAAAATAATTGGTAGG - Intronic
1112314466 13:98349361-98349383 CATTTTAATAAAACAGTGGTGGG - Intronic
1114357780 14:21931686-21931708 TCTTTTCAACAAACAGTGTTGGG - Intergenic
1114978806 14:28135956-28135978 CATTTTAAAAAATCAGTTTTAGG + Intergenic
1117210979 14:53499466-53499488 TCTTTTCAACAAACAGTGTTGGG + Intergenic
1117381106 14:55164406-55164428 TCTTTTCAACAAACAGTGCTGGG + Intronic
1117762497 14:59045301-59045323 TCTTTTCAGCAATCAGTGTTGGG - Intergenic
1118010219 14:61603218-61603240 CCTCTTTAACATACAGTGGTAGG - Intronic
1119810432 14:77513329-77513351 TTTTTTAAAAAATCAGTGTTTGG + Intronic
1120773495 14:88407840-88407862 CCTATTTAACAAACAGTGTTGGG - Intronic
1122185653 14:99992659-99992681 ACTTTTCAACAAACAGTGTTAGG - Intronic
1122620040 14:103051081-103051103 GATTTTAAACAATCTGTGTTGGG - Intronic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1124177729 15:27441971-27441993 CTTTATAAAAAAGCAGTGGTGGG + Intronic
1125076107 15:35620298-35620320 CCTTTAAATCAATCAGAGGACGG - Intergenic
1126398359 15:48243325-48243347 CATTTTAAATAATCAGTGCAGGG - Intronic
1127093346 15:55488301-55488323 CCTTTTAAAAAATAATTAGTGGG - Intronic
1127914528 15:63444571-63444593 CCTGTTAAACAACCTGAGGTGGG - Intergenic
1128453679 15:67821392-67821414 CCTTTTAAAAAATCATTAGGAGG + Intronic
1129494550 15:75965645-75965667 CCTTGTACACAGTCATTGGTAGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130692717 15:86098545-86098567 CCTTTTCAACAAATGGTGGTGGG - Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133386365 16:5373423-5373445 ACTTTTAAACAACCAGATGTGGG - Intergenic
1133607065 16:7398158-7398180 CATTTCAAACAAGCATTGGTAGG + Intronic
1134413820 16:14026310-14026332 CTTTGTAAAAAATCAGTTGTGGG - Intergenic
1138223223 16:55270713-55270735 CCTTGTACACAGTCAGTGCTAGG + Intergenic
1139650248 16:68358830-68358852 CACTTTAAAAAATCAGTGGAAGG + Exonic
1139987498 16:70911344-70911366 CCTTTTCAACAAATAGTGCTGGG - Intronic
1140039819 16:71398796-71398818 CCTTTAAAACAAGGAGTTGTGGG + Intergenic
1141756399 16:85994105-85994127 CCTTTGAAACCAGCAGTGCTGGG - Intergenic
1143414735 17:6738015-6738037 CCTTTTCAACAAATAGTGCTGGG + Intergenic
1145080315 17:19889456-19889478 CTTTTTAAACAAACAGTTGCTGG - Intergenic
1149704723 17:58684695-58684717 GTTTTTAAAAAATAAGTGGTAGG - Intronic
1150817706 17:68407102-68407124 CCTTTTCAACAAACGGTGCTGGG - Intronic
1150837384 17:68576628-68576650 CCTTTCAGACACTTAGTGGTGGG + Intronic
1151813867 17:76461385-76461407 CCTTACAGACAGTCAGTGGTTGG - Intronic
1152014336 17:77740235-77740257 TCTTTTCAACAAACAGTGCTGGG - Intergenic
1155260338 18:24036009-24036031 TCTTTTCAACAAACAGTGCTGGG - Intronic
1160219400 18:76962289-76962311 CCTTTTCAACAAACAGTGCTGGG - Intronic
1162117361 19:8438977-8438999 CCTTTTATTCATTCAGGGGTGGG - Exonic
1162615173 19:11793961-11793983 CCTTTTCAATAAACAGTGCTGGG - Intergenic
1162686825 19:12393742-12393764 CCTTTTGCACAATAAGTAGTAGG - Intronic
1162691177 19:12433514-12433536 CCTTTTGCACAATAAGTAGTAGG - Intronic
1164319681 19:24132363-24132385 CCTTTTCAACAATTGGTGCTGGG - Intergenic
1164602225 19:29569846-29569868 CCTTTTAAACAATCAGGTACAGG - Intergenic
1164966506 19:32489485-32489507 TCTTTTAAACTGTCTGTGGTAGG - Intergenic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
925054656 2:847684-847706 CCTTTTAAAACATAAGTGGAAGG + Intergenic
925280979 2:2684240-2684262 TCTTTTCAACAATCAATGTTTGG + Intergenic
928797761 2:35043563-35043585 CCTTTTAGACAGTCAATTGTTGG + Intergenic
929315562 2:40473778-40473800 CCTTTTACACACCCAGTGGTGGG + Intronic
930002985 2:46873713-46873735 CCTTTTAAACCTTCAATGATGGG - Intergenic
932100153 2:68891539-68891561 CCTTTTCAACAAATAGTGCTAGG - Intergenic
932364564 2:71140867-71140889 ACTTTTAAACAAACTGTGATGGG + Intronic
932671431 2:73740837-73740859 CCTATAAAGCACTCAGTGGTGGG + Intergenic
933479853 2:82842228-82842250 CCTTTTTAACAATATGTGATAGG + Intergenic
935901096 2:107794563-107794585 TCATTTACACAATCACTGGTGGG + Intergenic
936803880 2:116301400-116301422 CCTTTTAAATAAATACTGGTAGG + Intergenic
938037605 2:128048494-128048516 CCTTTTCAACAAATAGTGCTGGG - Intergenic
938236069 2:129708261-129708283 CCTCTCAAACAAGCATTGGTCGG + Intergenic
938640840 2:133277893-133277915 CTTTTTAAACAAACAGTGCTGGG + Intronic
938894547 2:135737284-135737306 CATTCTAAACAATCTGGGGTGGG - Intergenic
939813444 2:146864678-146864700 CCTTTTCAACAAACAGTCTTGGG + Intergenic
940647188 2:156404065-156404087 GCCCTTAAACAATAAGTGGTGGG + Intergenic
941258614 2:163267589-163267611 CCTTTTAAAAAAGTAGTGCTGGG - Intergenic
941862166 2:170294130-170294152 CTTTTTAAACAAACAGTTTTTGG + Intronic
942208619 2:173648459-173648481 CCCTTTAACCAATCTGTGCTTGG - Intergenic
942689202 2:178567443-178567465 CCTCTTAACCACTCAATGGTAGG + Exonic
943649830 2:190445282-190445304 CATTGTTAACTATCAGTGGTGGG + Intronic
943655556 2:190504466-190504488 CATTGTAAACATTAAGTGGTTGG + Exonic
943795349 2:191986247-191986269 TCTTTCAAACAGTCAGTGTTTGG + Intronic
943822401 2:192342420-192342442 TCTTTTAAACAAACAGTGCTTGG - Intergenic
946637510 2:221745869-221745891 CTTTTGCAAAAATCAGTGGTAGG + Intergenic
946851407 2:223910165-223910187 TCTTTTAAACAATTGGTGCTGGG + Intronic
947070596 2:226283800-226283822 CCTTTCAAACCAGCAGTGGTGGG - Intergenic
947108029 2:226688262-226688284 CCTATTCAACAAACAGTGCTGGG - Intergenic
948810202 2:240471128-240471150 CTTTTTGAAGAATCAGTGGCTGG + Intergenic
1168803557 20:659786-659808 CCTCTTCCACAGTCAGTGGTGGG - Intronic
1169624942 20:7555315-7555337 CCTTTTAAACAAATGGTGCTGGG - Intergenic
1172714576 20:36953256-36953278 CCCCTTTAACAAGCAGTGGTTGG - Intergenic
1174912124 20:54618714-54618736 CTTTTTAAAAAATCACTGTTAGG + Intronic
1175069476 20:56320614-56320636 CCTTTTCAACAAACGGTGCTGGG + Intergenic
1176335801 21:5598307-5598329 CCTTTACAACAATTAGTGCTGGG + Intergenic
1176391956 21:6222641-6222663 CCTTTACAACAATTAGTGCTGGG - Intergenic
1176469463 21:7093533-7093555 CCTTTACAACAATTAGTGCTGGG + Intergenic
1176493024 21:7475311-7475333 CCTTTACAACAATTAGTGCTGGG + Intergenic
1176507618 21:7663072-7663094 CCTTTACAACAATTAGTGCTGGG - Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1177181885 21:17753226-17753248 CCATTTAAACAATGAGGTGTAGG + Intergenic
1177794984 21:25766183-25766205 GCTTTTCAATAATCAGTGCTGGG + Intronic
1182877598 22:33705846-33705868 CGTATTAAACATTCAGTAGTAGG - Intronic
949203753 3:1413043-1413065 CCTTGTAATAGATCAGTGGTGGG + Intergenic
949773600 3:7606403-7606425 TTTTTTAAAAAATCAGAGGTGGG + Intronic
950978665 3:17277961-17277983 CATTTTAAACATTCAGTTATAGG - Intronic
951201571 3:19881179-19881201 CTTTTTAAACTACCAGTGGGTGG - Intronic
953682503 3:45050512-45050534 CCTTTTAAACAACAAGTTCTTGG - Intergenic
955205091 3:56888590-56888612 CTTTTTTAAGAAGCAGTGGTAGG - Intronic
955898961 3:63731526-63731548 CCTATTCAACAAACAGTGCTAGG + Intergenic
956254959 3:67273667-67273689 CCTCTGACCCAATCAGTGGTGGG + Intergenic
958500189 3:94895875-94895897 CCTTTCAAACAAACAGTTCTGGG + Intergenic
958602119 3:96308410-96308432 CCATTAAAGCAATCAGTGTTTGG - Intergenic
959653570 3:108775443-108775465 CCTTTTAAGCAATCAGAAGAAGG - Intergenic
960015271 3:112880524-112880546 CCTATTAAATAAGCAGTGCTGGG - Intergenic
961134562 3:124497753-124497775 CTCTTTAAACAGTCAGTGGGTGG + Intronic
961416692 3:126764431-126764453 CCTTTAAAACAAGGAGTTGTGGG - Intronic
961946408 3:130693985-130694007 CCTTTAGAACAAGCAGTGCTGGG - Intronic
962013414 3:131416139-131416161 CCTATTCAACAAACAGTGCTGGG + Intergenic
962357035 3:134703620-134703642 CCTGTTAAAAGATCAGGGGTGGG + Intronic
964190029 3:153990949-153990971 CCTTTTCAACAAACGGTGCTGGG + Intergenic
964644237 3:158941327-158941349 CCTTTTCAACAAATAGTGCTGGG + Intergenic
965232238 3:166069453-166069475 TCTTTTCAACAAGCAGTGTTTGG - Intergenic
965321582 3:167258426-167258448 CCTTTTAAACAAATGGTGCTGGG - Intronic
965591369 3:170363024-170363046 CATTTTAAACACTTAGTGTTAGG - Intronic
967432795 3:189406658-189406680 CCTTTTAAAGAATCAGAGTCTGG + Intergenic
971209806 4:24604871-24604893 TCTTTTAACAAATCAGTGCTTGG + Intergenic
972088480 4:35250681-35250703 CTTTTTAAATAAACAGTTGTAGG + Intergenic
974379463 4:61119908-61119930 CCATTTAAACAATTAGAGCTTGG + Intergenic
974442224 4:61934149-61934171 TCTTTTAAAAAATCAGCAGTAGG - Intronic
975187125 4:71416923-71416945 TTTTTTAAACAATGAATGGTAGG + Intronic
975335275 4:73169304-73169326 CATTTTAAACAGTGAGTGGGAGG + Intronic
975613090 4:76220731-76220753 TCTTTTTAAAAATCAGTGATGGG + Intronic
975943197 4:79673048-79673070 CCTATTAAACAAACAGTTCTGGG + Intergenic
980822035 4:138029873-138029895 CCTTTTAAATAATTTATGGTGGG + Intergenic
981506818 4:145510318-145510340 CCTTTTAAAAAATCTTTGGCGGG + Intronic
981753874 4:148119908-148119930 CTTTATAAACACTGAGTGGTTGG + Intronic
981985853 4:150854959-150854981 CTTTTTAAAAGATCAGTGGCTGG + Intronic
983052671 4:163067097-163067119 CCTTTTCAACAATTGGTGCTGGG + Intergenic
986988009 5:13521073-13521095 CCTTTTACAAAATCAATGGGAGG - Intergenic
988725542 5:33922825-33922847 CCTTATAAGCAATCACTGATGGG - Intergenic
988984653 5:36605442-36605464 CCTTTTAAACAGCTACTGGTTGG - Intergenic
989215013 5:38895303-38895325 CCTTTCAAAAAACCAGTGTTTGG - Intronic
990128628 5:52551245-52551267 CCTTTTAAAAAAGCTGTGTTAGG - Intergenic
991136843 5:63192531-63192553 TCTTTTAAACAACCAGTTCTTGG + Intergenic
992371595 5:76149554-76149576 GTTTTTAAATAATCAGAGGTGGG + Intronic
993074813 5:83215733-83215755 TCTTTTAGACAAACAGTGCTTGG + Intronic
994187107 5:96827286-96827308 CCTTTTAAAAAGTCAGTTGGGGG + Intronic
994595351 5:101825797-101825819 CCTATTCAACAAACAGTGCTGGG + Intergenic
995673026 5:114628673-114628695 TCTCTTAAATAAACAGTGGTGGG + Intergenic
997954457 5:138267897-138267919 CCTTTTCAACAAACGGTGCTGGG + Intronic
997959762 5:138311090-138311112 TTTTTTCAACAATTAGTGGTGGG + Intronic
998759224 5:145413468-145413490 CCTTTTAGATACTCAGTAGTGGG - Intergenic
1000404195 5:160869346-160869368 CCTTTTAACCAAATAGGGGTAGG - Intergenic
1000723296 5:164735421-164735443 CCTTTTTAACAATGAGTAATTGG + Intergenic
1000873277 5:166604107-166604129 TCTTTTCAACAAACAGTGCTGGG - Intergenic
1001183557 5:169544581-169544603 CCCTTAACACAATCAGTTGTGGG + Intergenic
1002028284 5:176410465-176410487 CTTTATAAACAGTCAGGGGTGGG - Intronic
1004706347 6:18127450-18127472 CTTTTTAAAAAATCAGTTATTGG - Intergenic
1005423209 6:25674007-25674029 ACTTTTAAACAACCAGATGTTGG + Intronic
1006482585 6:34309585-34309607 CCTTTTAAATAACCAGTTTTGGG - Intronic
1006572869 6:35019834-35019856 ATTTTTAAAAAATCAGTGGGTGG + Intronic
1006746820 6:36348576-36348598 AATTTTAAAAAATCAGTGGCCGG - Intergenic
1006849941 6:37091189-37091211 CCTTTTAAAAATTCAAAGGTTGG - Intergenic
1006978848 6:38129555-38129577 CCTTTTCAACAAACGGTGCTAGG - Intronic
1007302683 6:40879841-40879863 GTTTTTAAAAAATCAGTGCTAGG + Intergenic
1007811904 6:44492204-44492226 CCTTTTTAACAATCAGATTTTGG - Intergenic
1009395508 6:63194706-63194728 CCTTTTCAACAAATAGTGTTGGG - Intergenic
1011332895 6:86229468-86229490 TCTTTTCAACAAACAGTGCTGGG - Intergenic
1011937105 6:92793721-92793743 TCTTTTGAACAATCAGTGCTTGG - Intergenic
1013568947 6:111400970-111400992 CCTTTTCAACAAATAGTGCTGGG - Intronic
1013897547 6:115108105-115108127 TCTTTTCAACAAACGGTGGTGGG + Intergenic
1014413645 6:121156452-121156474 CCTTTTAAAAAATCAATTATTGG + Intronic
1014656289 6:124108771-124108793 CCTCTTAAACAAATGGTGGTAGG - Intronic
1014680082 6:124417319-124417341 ACATTTAAACACTCAGTGGATGG + Intronic
1016368893 6:143350594-143350616 CCTCTTAAATAAACAGTGCTAGG - Intergenic
1018151200 6:160940991-160941013 TCTTTTCAACAAATAGTGGTGGG - Intergenic
1018597159 6:165493595-165493617 CCTATTCAACAAACAGTGCTGGG + Intronic
1021402284 7:20222941-20222963 CCTTATAAACAATCAATTATTGG - Intergenic
1021778492 7:24077912-24077934 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1021779506 7:24088929-24088951 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1022126101 7:27359130-27359152 CTTTTTAAAAAATCATGGGTTGG - Intergenic
1022925108 7:35048861-35048883 CATTTGAAACAATCACTGGGGGG - Intergenic
1024083844 7:45877624-45877646 ACTTTCAAACAAGCAGTAGTAGG + Intergenic
1024516362 7:50262361-50262383 GATTTTAAACAATCGGTAGTTGG + Intergenic
1027210094 7:76139565-76139587 TCTTTTCAACAAACAGTGCTGGG + Intergenic
1027328568 7:77066936-77066958 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1027686937 7:81289901-81289923 TGGTTTAAACAATCATTGGTTGG - Intergenic
1028141140 7:87275680-87275702 ACTTTTAAACAAGCAGTTCTTGG + Intergenic
1028257156 7:88613267-88613289 TATTTTAAACAATCATTGGCAGG + Intergenic
1029353966 7:100036776-100036798 CCTCTTAAAAAATAAGTGCTTGG - Exonic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1029787197 7:102804441-102804463 CCTTTTCAACAAATAGTGCTGGG + Intronic
1029823122 7:103163567-103163589 CATTTGAAACAATCACTGGGGGG - Intergenic
1030285373 7:107821246-107821268 CCTTTTACCCAATCTTTGGTTGG - Intergenic
1030653654 7:112142629-112142651 AATTTTAAAAAATGAGTGGTAGG - Intronic
1031519723 7:122748860-122748882 CCTGTTAAACAATAAGGGGGTGG + Intronic
1032808331 7:135381482-135381504 CCTTTTAAAAAGGCAGTGGGGGG - Intronic
1032894069 7:136231459-136231481 ACTTTTAAACAAGCAGTTCTTGG - Intergenic
1033222163 7:139535243-139535265 CCTTGTAAACAATCTGTGAAAGG + Intronic
1035646307 8:1223435-1223457 ACTTTGAAACAATTAGTGGGTGG + Intergenic
1036468560 8:9027710-9027732 CCTTTTCAACAAACGGTGTTGGG - Intronic
1037055182 8:14431448-14431470 CCTATTCAACAATTAGTGCTGGG + Intronic
1039095170 8:33876409-33876431 CCTTTTCAACAAACGGTGCTGGG - Intergenic
1039749883 8:40468419-40468441 CCTTTTCAACAAATAGTGCTTGG + Intergenic
1039890814 8:41684115-41684137 TCTGTAAAACAGTCAGTGGTTGG - Intronic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1040711349 8:50192882-50192904 CCTTTTCAACAAATAGTGCTGGG - Intronic
1042122375 8:65502309-65502331 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1043140451 8:76582293-76582315 TCATTTAAAAAATCAGTGGTTGG + Intergenic
1044228055 8:89741751-89741773 CCTTTTCAACAATTGGTGCTAGG + Intergenic
1045387770 8:101687998-101688020 CCTGTTAAAGAATCAGAGGTTGG - Exonic
1045905265 8:107337644-107337666 CCTTTTAAATAAGCAGTTTTAGG - Intronic
1047813819 8:128440458-128440480 CCTATTCAATAAACAGTGGTGGG + Intergenic
1048104454 8:131392552-131392574 CATTTTAAACAATAAGTTGATGG + Intergenic
1050439541 9:5647040-5647062 TCTTTTCAACAAACAGTGCTGGG - Intronic
1050503208 9:6320407-6320429 CCTTTTCAACAAATAGTGCTGGG + Intergenic
1051324649 9:15952112-15952134 TCTTTTCAACAAACAGTGCTAGG - Intronic
1052549905 9:29934747-29934769 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1052731078 9:32286798-32286820 CCTTTTCAACAAACGGTGCTGGG - Intergenic
1055151034 9:73000066-73000088 TCTTTTCAACAAACAGTGCTGGG - Intronic
1055472982 9:76632226-76632248 CATTTTAAACAATGAGTTATTGG - Intronic
1056075962 9:83040673-83040695 ACTATTTAATAATCAGTGGTAGG - Intronic
1056236847 9:84603136-84603158 ATTTTTAAAAATTCAGTGGTAGG - Intergenic
1056433478 9:86551952-86551974 AATTTTAAAAAATCAGTGATTGG - Intergenic
1056819266 9:89825822-89825844 CCTTTTAAACAATGAGATATTGG + Intergenic
1057858388 9:98620547-98620569 CCATTTAAAAAATCAAGGGTGGG - Intronic
1058480256 9:105385801-105385823 CCTTTTTAACTGTCAGTGTTTGG + Intronic
1060256800 9:122038237-122038259 CATTTTAAAAAATAAGTGGAAGG + Intronic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1203425838 Un_GL000195v1:36595-36617 CCTTTACAACAATTAGTGCTGGG - Intergenic
1186283262 X:8017526-8017548 CGTTTTAAACAATCACTTATGGG + Intergenic
1188400776 X:29741441-29741463 CATTTTAAACAATGCTTGGTAGG + Intronic
1188599977 X:31950878-31950900 TCTTTTAAACAAACTATGGTTGG + Intronic
1190554182 X:51617209-51617231 TTTATCAAACAATCAGTGGTGGG - Intergenic
1191130360 X:57001809-57001831 TATTTTTAACAATCAGTGCTGGG - Intergenic
1191722373 X:64243932-64243954 CCTGTTCAACAAACAGTGCTAGG - Intergenic
1192038161 X:67588289-67588311 CCTTTTAATCAAACAGTGTGGGG - Intronic
1192068706 X:67914273-67914295 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1192257480 X:69474632-69474654 CCTTTTCAACAAATGGTGGTAGG + Intergenic
1192413493 X:70955835-70955857 CCTTTTAAACAAATGGTGGTGGG + Intergenic
1193237576 X:79127688-79127710 CCTTTTAAACAAATGGTGCTGGG + Intergenic
1194917907 X:99727057-99727079 CCTTTTCAACAAACGGTGCTGGG - Intergenic
1194935000 X:99938476-99938498 CCTTTAAAACAAGGAGTTGTGGG - Intergenic
1195001621 X:100648404-100648426 CCTTTAGATCAATCAGTGCTTGG - Intronic
1195240487 X:102946754-102946776 CATTTTAAAAAATCAGCCGTGGG + Intergenic
1195999446 X:110765534-110765556 CCTTTTCAACAAATAGTGCTGGG - Intronic
1196179495 X:112674200-112674222 CCTTTTCAACAACTAGTGCTGGG + Intronic
1197023927 X:121724077-121724099 CCTATTCAATAAACAGTGGTGGG + Intergenic
1197132851 X:123024894-123024916 CCTTTTCAACAAACGGTGCTGGG + Intergenic
1198162826 X:134024443-134024465 ACTTGTAAGCAATCAGTGTTGGG - Intergenic
1198237928 X:134753577-134753599 CTGTTTAAACAATCAGGGGCGGG + Intronic
1198415604 X:136416765-136416787 CCTTTTCCCCAATCAGGGGTTGG - Exonic
1198771052 X:140130434-140130456 CCTTTTAATCATGCAGTGCTAGG - Intergenic
1198781815 X:140246110-140246132 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1198894637 X:141439406-141439428 CCTATTCAACAAACAGTGCTGGG - Intergenic
1199342380 X:146696368-146696390 GCTTATAAAAAATCATTGGTGGG - Intergenic
1199442649 X:147885887-147885909 CCTATTCAAAAATCAGTTGTTGG + Intergenic
1200782760 Y:7231789-7231811 ACTTTTAAACAATCAGATCTTGG + Intergenic
1201408934 Y:13678733-13678755 CCTTTTAAACAAATGGTGCTGGG + Intergenic
1201498384 Y:14614667-14614689 CCTATTTAACAAACAGTGGTAGG - Intronic
1201504640 Y:14684551-14684573 TCTTTTAAACAATCAGCTTTGGG + Intronic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic