ID: 1168441857

View in Genome Browser
Species Human (GRCh38)
Location 19:56375119-56375141
Sequence GTTTCTACCATTCCCGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168441857_1168441864 14 Left 1168441857 19:56375119-56375141 CCAGTTCCGGGAATGGTAGAAAC No data
Right 1168441864 19:56375156-56375178 AGTTCCTTAGAGGTCAGTCAGGG No data
1168441857_1168441861 4 Left 1168441857 19:56375119-56375141 CCAGTTCCGGGAATGGTAGAAAC No data
Right 1168441861 19:56375146-56375168 ATGAAATCCAAGTTCCTTAGAGG No data
1168441857_1168441865 15 Left 1168441857 19:56375119-56375141 CCAGTTCCGGGAATGGTAGAAAC No data
Right 1168441865 19:56375157-56375179 GTTCCTTAGAGGTCAGTCAGGGG No data
1168441857_1168441863 13 Left 1168441857 19:56375119-56375141 CCAGTTCCGGGAATGGTAGAAAC No data
Right 1168441863 19:56375155-56375177 AAGTTCCTTAGAGGTCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168441857 Original CRISPR GTTTCTACCATTCCCGGAAC TGG (reversed) Intergenic
No off target data available for this crispr