ID: 1168443552

View in Genome Browser
Species Human (GRCh38)
Location 19:56392318-56392340
Sequence GCATGCACAAAGCCTCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168443552_1168443555 11 Left 1168443552 19:56392318-56392340 CCAAACTGAGGCTTTGTGCATGC 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1168443555 19:56392352-56392374 GCATGCCTTGCATCAACAAATGG 0: 1
1: 0
2: 1
3: 4
4: 113
1168443552_1168443556 12 Left 1168443552 19:56392318-56392340 CCAAACTGAGGCTTTGTGCATGC 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1168443556 19:56392353-56392375 CATGCCTTGCATCAACAAATGGG 0: 1
1: 0
2: 0
3: 5
4: 102
1168443552_1168443559 26 Left 1168443552 19:56392318-56392340 CCAAACTGAGGCTTTGTGCATGC 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1168443559 19:56392367-56392389 ACAAATGGGATAGAGTTGGAAGG 0: 1
1: 0
2: 3
3: 25
4: 401
1168443552_1168443558 22 Left 1168443552 19:56392318-56392340 CCAAACTGAGGCTTTGTGCATGC 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1168443558 19:56392363-56392385 ATCAACAAATGGGATAGAGTTGG 0: 1
1: 0
2: 2
3: 20
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168443552 Original CRISPR GCATGCACAAAGCCTCAGTT TGG (reversed) Intronic
902059605 1:13631078-13631100 GCAGCCATAAAGCCTCAGGTGGG + Intergenic
902745257 1:18469661-18469683 GCATTCACACGGCCTCTGTTAGG - Intergenic
903442742 1:23400756-23400778 GCTTCCACAAGGGCTCAGTTTGG - Intronic
904977847 1:34472291-34472313 ACAAGCACAAAGGCTCAGCTTGG + Intergenic
908845382 1:68319309-68319331 GTATACACAAAGCCTAAATTGGG + Intergenic
909683327 1:78317498-78317520 GAAAGCAGCAAGCCTCAGTTCGG - Intronic
917173192 1:172201062-172201084 CCTTGCACAAAGCCTCAGCCTGG - Intronic
922173589 1:223177762-223177784 GCATGTATAAAGCCTCAGTGGGG - Intergenic
922618988 1:226979256-226979278 GAATGCCCAAAGCCTCAGCGTGG - Intronic
922697626 1:227739403-227739425 GCATGCAAACAGCCCCAGTGAGG + Intronic
922976344 1:229786899-229786921 CCATGCACCTTGCCTCAGTTGGG + Intergenic
924401792 1:243691184-243691206 GCATAAACAAAGCCTCAGAGTGG + Intronic
924717037 1:246585239-246585261 GCTGGCAGAAAGCTTCAGTTTGG - Intronic
1063762980 10:9101297-9101319 GAATGCAAATAGCCTCAATTTGG - Intergenic
1070266659 10:74909487-74909509 GCAGGCAGAACTCCTCAGTTTGG + Intronic
1070740442 10:78899746-78899768 GCATGCAGAAAGCTTCCTTTGGG + Intergenic
1071731931 10:88256706-88256728 ACAGGCACAAAGCCACATTTTGG + Intergenic
1079756709 11:24274068-24274090 GCATTCACAAACCCTGAGTTAGG + Intergenic
1087117636 11:94542549-94542571 GCAGGGCCACAGCCTCAGTTTGG - Intergenic
1089037580 11:115411017-115411039 GCTTACACAAAGACACAGTTAGG - Intronic
1089382730 11:118047715-118047737 TCATACTCAAAGTCTCAGTTTGG - Intergenic
1090647826 11:128780191-128780213 GCATCCACATAGCCACACTTTGG + Intronic
1090762114 11:129847168-129847190 ACATGCACAAAGCATTAGGTTGG + Intronic
1103041711 12:117701219-117701241 GCATGCCCATAGTCTCAGCTAGG - Intronic
1107757415 13:43639532-43639554 TGATGCAGATAGCCTCAGTTAGG + Intronic
1111587768 13:90305169-90305191 ACATGCACATACACTCAGTTTGG + Intergenic
1112651066 13:101399147-101399169 GCAAGCACAAAACCACAGTCTGG + Exonic
1113661029 13:112106410-112106432 GAATTTACAAAGCCTCATTTTGG - Intergenic
1116653878 14:47627201-47627223 GCATTCACAAACCCTGAGCTAGG - Intronic
1117117222 14:52526686-52526708 GCATACACAAGACATCAGTTTGG - Intronic
1121400368 14:93670840-93670862 GCATACAAAAAGAATCAGTTTGG + Intronic
1123051986 14:105548422-105548444 GCATCCACAAACCCTGAGCTAGG - Intergenic
1123933478 15:25182993-25183015 GCAAGCACCGAGCCTCAGCTGGG - Intergenic
1123966578 15:25465878-25465900 ACAAGCACAAATCCTCAGGTGGG - Intergenic
1127405223 15:58637328-58637350 GAATGAACATAGTCTCAGTTCGG - Intronic
1128461338 15:67870040-67870062 GCATTCAGAAAGAATCAGTTGGG + Intergenic
1131250348 15:90826050-90826072 GCATTCACAAACCCTGAGCTAGG - Intergenic
1132362938 15:101233071-101233093 GGATGCACCAAGCCTCAGAGGGG + Intronic
1133236722 16:4390827-4390849 GCTTGCACAAAGTCGCAGCTAGG + Intronic
1137015544 16:35370631-35370653 GTATGCACACAGCCCAAGTTAGG - Intergenic
1137781941 16:51104717-51104739 ACAAGCAGAAAGCCTCAATTTGG + Intergenic
1138027857 16:53536831-53536853 GCAAGCAGAAAGTCTTAGTTTGG - Intergenic
1138126819 16:54446100-54446122 ACAAGGACAAAGTCTCAGTTTGG - Intergenic
1138414371 16:56862983-56863005 GTATACCCAAAGCCTCAGCTGGG + Intergenic
1141076620 16:81011461-81011483 GCATGCACAGATCCTCAGTAAGG + Intronic
1141835210 16:86534027-86534049 GCAGGCACATGGCCTCATTTTGG + Intronic
1144793588 17:17876169-17876191 ACCTGCAGAAAGCCTGAGTTTGG - Intronic
1148450804 17:47776962-47776984 GGGTGCACACAGCCTGAGTTAGG - Intergenic
1149459125 17:56812948-56812970 ACATCTACAATGCCTCAGTTAGG + Intronic
1152318871 17:79596817-79596839 GCATCCACAAAGCCTCCCTCTGG - Intergenic
1153124234 18:1770724-1770746 GCAGGTACACAGTCTCAGTTTGG - Intergenic
1156350739 18:36298679-36298701 GCGCTCACAAAGCCTCAGCTTGG + Intronic
1156799702 18:41095160-41095182 GCATGGACCCAGCCTAAGTTAGG - Intergenic
1156929173 18:42620351-42620373 GTATGCACATAGCCTATGTTAGG - Intergenic
1159923838 18:74249473-74249495 GAAAGCACAAAGCCTGACTTGGG + Intergenic
1159993895 18:74942742-74942764 TCACCCACAAAGCCTCAGTGGGG + Intronic
1161544032 19:4868914-4868936 GGCTGGACAAAGCCCCAGTTGGG - Intergenic
1164557200 19:29262873-29262895 GCATGCTCAAAGCCACAGGAGGG + Intergenic
1168443552 19:56392318-56392340 GCATGCACAAAGCCTCAGTTTGG - Intronic
926729277 2:16023166-16023188 GAATACACACAGCCTCAGCTGGG - Intergenic
927258852 2:21065689-21065711 ACAGGCACAAAGTCTCAGTAAGG + Intergenic
927887125 2:26725437-26725459 GCATGGACATAGCCCCAGCTTGG - Intronic
928260151 2:29759232-29759254 GCAGACAGAAAACCTCAGTTAGG - Intronic
928686040 2:33749914-33749936 ACATGCACAAAGCCTCTTTGGGG + Intergenic
931255336 2:60567153-60567175 GCATGCACAAAACAGCAGTTGGG + Intergenic
933245213 2:79967313-79967335 GCAAGCACAACTCCTAAGTTTGG - Intronic
934623125 2:95828414-95828436 ACCTGCACAAAGCCTCAGCCTGG - Intergenic
934810639 2:97273673-97273695 CCCTGCACAAAGCCTCAGCCTGG + Intergenic
934827053 2:97434266-97434288 CCCTGCACAAAGCCTCAGCCTGG - Intergenic
935368022 2:102315183-102315205 TCATCCAGGAAGCCTCAGTTGGG - Intronic
936988454 2:118335336-118335358 GAGGGCACAAAGCTTCAGTTAGG - Intergenic
938099081 2:128486000-128486022 GCATTCACAGAGCCTCAGGGAGG - Intergenic
940130550 2:150376627-150376649 GCATGCACAATTACTCAATTTGG - Intergenic
941299217 2:163780443-163780465 GCAGGAGCAGAGCCTCAGTTGGG + Intergenic
941602099 2:167555895-167555917 ACATGCACAATGACTCAGTGAGG + Intergenic
943611808 2:190043886-190043908 TCCTGCACAAAGCCTTGGTTTGG - Intronic
947790948 2:232869015-232869037 GCAAGCACAAAGTCTGACTTAGG - Intronic
1170890612 20:20372309-20372331 GCATACACTGACCCTCAGTTTGG - Intergenic
1171542942 20:25978368-25978390 TCATGCACACAGCCTCTTTTGGG + Intergenic
1171845980 20:30275013-30275035 TCATGCACACAGCCTCTTTTGGG + Intergenic
1174203341 20:48822308-48822330 TCATGAACACAGCCTCATTTTGG + Intronic
1180036119 21:45251141-45251163 GCAGGCACAAAGCCTCTGCAGGG - Intergenic
1181994465 22:26864455-26864477 CCATGCGCTAAGCTTCAGTTAGG + Intergenic
1182094494 22:27616749-27616771 GCAAGGAGAAAGCCTCAGCTGGG + Intergenic
1182920066 22:34071076-34071098 GCATGTGCAAAGCCTGAGTCAGG - Intergenic
1184663240 22:45975224-45975246 GCAGGGACAAAGCCTCATTAAGG + Intronic
949654958 3:6207225-6207247 GAATGAATAAAGCCTAAGTTGGG - Intergenic
950126603 3:10513664-10513686 GCTTGCACAGGGCCACAGTTGGG + Intronic
952969332 3:38641058-38641080 GCTTGGACAAAGGCTCAGTGGGG + Intronic
952979890 3:38726309-38726331 TCATGCACAGAGCCTGGGTTGGG + Intronic
956189654 3:66596528-66596550 GCATGTACAAAGCTTCTGCTGGG + Intergenic
956528354 3:70189299-70189321 TCATGCAGAAAGCCCCAGTGAGG + Intergenic
961600043 3:128053186-128053208 GAATGAATAAGGCCTCAGTTAGG + Intronic
962905481 3:139797600-139797622 GCATTCAATAAGCCACAGTTCGG - Intergenic
964378632 3:156073815-156073837 GCATTCACAAACCCTGAGCTAGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
971455686 4:26841562-26841584 GCATGCACCACACCTCAGTGAGG - Intergenic
973850592 4:54957782-54957804 GACTGCACAATGTCTCAGTTAGG + Intergenic
975106081 4:70570894-70570916 ACCTGTACAAAGCCTCAGTCTGG - Intergenic
976546187 4:86338209-86338231 GAATGTTCAAAGCCCCAGTTTGG - Intronic
976917456 4:90395033-90395055 AAAAGTACAAAGCCTCAGTTAGG - Intronic
978076341 4:104535090-104535112 GCAGGTACAAAGCTACAGTTAGG - Intergenic
981176475 4:141689484-141689506 GCATTCACAAACCCTGAGCTAGG + Intronic
984779940 4:183516217-183516239 TCATGCAGAAAGACTCAATTTGG - Intergenic
985283435 4:188309956-188309978 ACATGAACAAAGACTCAGGTTGG - Intergenic
990133768 5:52620369-52620391 GCAGGCAGAAAGCATCACTTGGG - Intergenic
990348829 5:54895345-54895367 GCAGGCACCAAGCCTCATTAGGG + Intergenic
994096452 5:95851823-95851845 GCATTCACAAACCCTGAGCTAGG - Intergenic
994246142 5:97479397-97479419 GAAAGCACAAAGACTCAGTGTGG - Intergenic
995563316 5:113406816-113406838 GCATGCAGAGAACCTCAGTGAGG + Intronic
996077342 5:119212172-119212194 GCGGGCACAAAGTTTCAGTTTGG - Intronic
998817637 5:146030153-146030175 GAAGGCACAAGGGCTCAGTTAGG - Intronic
1000959551 5:167583846-167583868 GCATCTGCAAAGCCACAGTTAGG - Intronic
1001706993 5:173748684-173748706 GCATTCCCACAGCCTCAGGTGGG + Intergenic
1001808172 5:174606839-174606861 GCATGCACAAAGGCCCAGACTGG - Intergenic
1001956479 5:175851322-175851344 GCCTGCACAAAGGCCCAGTGAGG + Intronic
1002552048 5:180001967-180001989 GCATGCACAACTGCTCAGTCTGG + Intronic
1004598585 6:17125451-17125473 GAATTCACAGAGCCTCAGGTAGG - Intronic
1005125327 6:22440471-22440493 ACTTGCACAGAGCCTCAGTGAGG + Intergenic
1007124039 6:39409694-39409716 GCATGGAGACGGCCTCAGTTTGG - Intronic
1008080875 6:47193480-47193502 TCATTCACAGAACCTCAGTTTGG + Intergenic
1018218612 6:161555753-161555775 GCATCCACATGGCCTGAGTTTGG + Intronic
1018324974 6:162656896-162656918 CCTAGCACAAAGCCTTAGTTAGG + Intronic
1019930977 7:4222922-4222944 GCCTCCACAAAGCCTCAATTTGG - Intronic
1020220702 7:6234475-6234497 GCCTGCAGCAAACCTCAGTTGGG - Intronic
1024700536 7:51900666-51900688 GCATTCACAAACCCTGAGCTAGG + Intergenic
1025294324 7:57763476-57763498 TCATGCACACAGCCTCTTTTGGG + Intergenic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1032886666 7:136147759-136147781 GCCTGCACAATTTCTCAGTTTGG - Intergenic
1032977164 7:137238884-137238906 ACAAGCAGAAAGCCTCAATTTGG + Intronic
1040902243 8:52428851-52428873 GGAGGAACAAAGCCTCAGTGTGG + Intronic
1043229774 8:77787601-77787623 CCTTGCACAAAGCCTCAACTTGG - Intergenic
1043651566 8:82600574-82600596 GCATGTACACAGACTCAGCTGGG - Intergenic
1044727534 8:95205486-95205508 GCATGCACAAAGACTCAGAGAGG + Intergenic
1046492048 8:114966391-114966413 ATATGCATTAAGCCTCAGTTAGG + Intergenic
1046724888 8:117663558-117663580 GCATTCACCAAGCCACAGTCTGG + Intergenic
1046730304 8:117718371-117718393 GCATACACACAGCATCAGCTTGG + Intergenic
1047219254 8:122905998-122906020 GCAAGAACAGAGCCTCAATTAGG + Intronic
1054162098 9:61680829-61680851 TCATGCACACAGCCTCTTTTGGG - Intergenic
1058174133 9:101718716-101718738 TTAAGCAGAAAGCCTCAGTTTGG + Intronic
1058973355 9:110102983-110103005 GCATGCAGAAACCCTGAGATGGG - Intronic
1060240263 9:121897155-121897177 GCAAGCACATAGCCTCTGTGTGG - Intronic
1061878650 9:133557443-133557465 GCATGCTCAAAGCCTTGGGTAGG + Intronic
1188505144 X:30874240-30874262 CCATGAACAAAGCCGAAGTTAGG - Intronic
1188835434 X:34948568-34948590 ACATGCACAGAGTCTCAGTGGGG + Intergenic
1190445975 X:50524576-50524598 GCATGGACTGAGCCTCATTTAGG - Intergenic
1191670051 X:63740663-63740685 GCATCCTCAGAGCCTCAGTTGGG - Intronic
1193212404 X:78822564-78822586 GCCTGCACACAGCCTAAATTGGG - Intergenic
1198041855 X:132860410-132860432 GGATGCACAAAGACTCTGTGTGG - Intronic
1198442166 X:136673716-136673738 GCATGCCCAAAGCCACAGCCAGG + Intronic
1198776025 X:140179645-140179667 CCTTGCACAAAGCCTAAATTGGG - Intergenic
1199859744 X:151790498-151790520 CCATGGAAAAAGCCACAGTTGGG + Intergenic