ID: 1168445496

View in Genome Browser
Species Human (GRCh38)
Location 19:56408766-56408788
Sequence GGCAATGAAGGTTCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168445496_1168445503 19 Left 1168445496 19:56408766-56408788 CCATGCCCAGAACCTTCATTGCC No data
Right 1168445503 19:56408808-56408830 GAAATCCAGTGTCCTAACCATGG No data
1168445496_1168445500 -7 Left 1168445496 19:56408766-56408788 CCATGCCCAGAACCTTCATTGCC No data
Right 1168445500 19:56408782-56408804 CATTGCCTTCCTATCTTACTTGG No data
1168445496_1168445505 28 Left 1168445496 19:56408766-56408788 CCATGCCCAGAACCTTCATTGCC No data
Right 1168445505 19:56408817-56408839 TGTCCTAACCATGGCCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168445496 Original CRISPR GGCAATGAAGGTTCTGGGCA TGG (reversed) Intronic