ID: 1168451010

View in Genome Browser
Species Human (GRCh38)
Location 19:56466589-56466611
Sequence CTGTCTTAAAGTGAGTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168451005_1168451010 25 Left 1168451005 19:56466541-56466563 CCCCTGGTTACCAGGCCTCTGGT 0: 1
1: 8
2: 8
3: 27
4: 262
Right 1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG 0: 1
1: 0
2: 3
3: 29
4: 152
1168451007_1168451010 23 Left 1168451007 19:56466543-56466565 CCTGGTTACCAGGCCTCTGGTTT No data
Right 1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG 0: 1
1: 0
2: 3
3: 29
4: 152
1168451008_1168451010 15 Left 1168451008 19:56466551-56466573 CCAGGCCTCTGGTTTAATAAAAC 0: 4
1: 11
2: 11
3: 17
4: 155
Right 1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG 0: 1
1: 0
2: 3
3: 29
4: 152
1168451006_1168451010 24 Left 1168451006 19:56466542-56466564 CCCTGGTTACCAGGCCTCTGGTT 0: 1
1: 6
2: 8
3: 14
4: 193
Right 1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG 0: 1
1: 0
2: 3
3: 29
4: 152
1168451009_1168451010 10 Left 1168451009 19:56466556-56466578 CCTCTGGTTTAATAAAACATGAC 0: 7
1: 5
2: 7
3: 24
4: 298
Right 1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG 0: 1
1: 0
2: 3
3: 29
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168451010 Original CRISPR CTGTCTTAAAGTGAGTAGCT AGG Intronic
903427212 1:23262888-23262910 CTGAGTTCAAGCGAGTAGCTGGG - Intergenic
905349171 1:37332666-37332688 CTGTTGCAAAGTGAGAAGCTAGG + Intergenic
908767141 1:67564449-67564471 CTGTCCTGACGTGAGCAGCTGGG + Intergenic
911098985 1:94079017-94079039 CTGTCTTTATCTGAGTAGCCAGG + Intronic
912967694 1:114250677-114250699 CCATCTTAAATTGAGTAACTAGG - Intergenic
913074069 1:115326274-115326296 CTGCCTTAGACTGAGTAGTTGGG + Intronic
913126353 1:115793919-115793941 CGGTCTTAAAGAGAATAACTGGG + Intergenic
920101150 1:203517778-203517800 GTTTCTGAAAGTGAGAAGCTGGG + Intergenic
921202146 1:212817542-212817564 CCATCTTAAAGTGAGTAGCTAGG + Intergenic
922076577 1:222250932-222250954 CTGAGTTCAAGCGAGTAGCTGGG - Intergenic
922756623 1:228100511-228100533 CTGTCTCAACCTGAGTTGCTGGG - Intergenic
1062764783 10:52824-52846 CTATCTTAATATGAGTAGCTAGG - Intergenic
1063648618 10:7910749-7910771 CTGTCTTTTAGTTAGTAGCCAGG - Intronic
1065257535 10:23886606-23886628 CTGTCATTAAGTCAGTTGCTGGG - Intronic
1065561522 10:26968727-26968749 CAGCCTTAAATTGAGAAGCTTGG + Intergenic
1066458713 10:35594835-35594857 CTGCCTTAGCCTGAGTAGCTGGG - Intergenic
1068010607 10:51445352-51445374 CTTTATTAAAATGAGTAACTAGG - Intronic
1068131807 10:52904723-52904745 CTGTCCTAAAGTAAGCAGCAGGG + Intergenic
1069726616 10:70584150-70584172 CTATCTTAAAGTGAATAGCTGGG + Intergenic
1075377266 10:121988757-121988779 CTGTGTTAGAGTAGGTAGCTAGG + Intergenic
1082031964 11:47611202-47611224 CAGTCATTAAGTGAGTAGCTTGG - Intergenic
1082202544 11:49390326-49390348 GGGTCTTAAAGTCTGTAGCTGGG - Intergenic
1083228001 11:61296500-61296522 CTGCCTCAACCTGAGTAGCTGGG - Intergenic
1084330839 11:68429246-68429268 CTGTCTCAAAGTAAGTAAATAGG + Intronic
1085095637 11:73758888-73758910 GTGTCTTTAGGTGAGTAACTTGG - Intronic
1086652488 11:89309762-89309784 GGGTCTTAAAGTCTGTAGCTGGG + Intergenic
1087224475 11:95582516-95582538 CTGTCTTATACTGAGTAGCCTGG - Intergenic
1087292272 11:96332660-96332682 CTGTCTGAAATTAAGTAGCACGG + Intronic
1091741912 12:2965271-2965293 TTGCCTTAACCTGAGTAGCTGGG + Intronic
1095101943 12:38194296-38194318 CTATCTTAATATGAGTAGCTAGG + Intergenic
1095491656 12:42740928-42740950 AAGTTTTAAAGTGAGGAGCTGGG + Intergenic
1098295811 12:69003163-69003185 CTGTCTTACAGTGAGAACTTGGG - Intergenic
1101800848 12:108020806-108020828 CTTCCTTAAAATGAGTAACTTGG - Intergenic
1102444084 12:112987993-112988015 CCATCTTAAAGCAAGTAGCTAGG + Intronic
1102608123 12:114086408-114086430 CTCCCTCAAACTGAGTAGCTGGG + Intergenic
1105033221 12:132899615-132899637 CTATCTTAAGGTAAGTAGCTAGG - Intronic
1109316387 13:60754413-60754435 TTGTCTTAGAGGAAGTAGCTAGG - Intergenic
1110361315 13:74628931-74628953 CTTTCTTAAAGTTATTACCTAGG - Intergenic
1111386304 13:87533150-87533172 CTGTCTGGAAGTGAGGGGCTAGG + Intergenic
1111900660 13:94195815-94195837 CAGTCTTTATGTGAGTACCTTGG - Intronic
1113879508 13:113615905-113615927 CTGTCTCAAAATGAGTAGGCTGG + Intronic
1114164473 14:20205499-20205521 CTGCCTTAACCTCAGTAGCTGGG - Intergenic
1119104231 14:71908828-71908850 CCATCTTGAAGTGAGTAGCGAGG + Intergenic
1119124505 14:72113133-72113155 CAGTGATAAAGTGAGTAGCTGGG + Intronic
1120347927 14:83313981-83314003 CTGCCTCAGACTGAGTAGCTGGG + Intergenic
1121168343 14:91831535-91831557 CTGTTTTAGAAAGAGTAGCTTGG + Intronic
1121620756 14:95346613-95346635 CTGTCTTGTAGTGTTTAGCTGGG + Intergenic
1122683363 14:103484758-103484780 CTGTCTAAAATTAATTAGCTGGG + Intronic
1125790282 15:42360243-42360265 CTGTCTTTAAGTGTGAAGCAGGG + Intronic
1127428808 15:58882089-58882111 CTGGGTTCAAGTGAATAGCTGGG - Intronic
1128143849 15:65321406-65321428 CTGTCTTCTAGTGAGAAGCATGG - Intergenic
1130248848 15:82281904-82281926 ATGTATTAAAGTGAGGAGATGGG + Intronic
1130451210 15:84054248-84054270 ATGTATTAAAGTGAGGAGATGGG - Intergenic
1133476945 16:6132869-6132891 CTGGGTTCAAGTGAGTAGCTGGG - Intronic
1134452646 16:14372914-14372936 CTGGGTTCAAGCGAGTAGCTTGG - Intergenic
1138046032 16:53725934-53725956 TTGTCATTAAGTGACTAGCTAGG - Intronic
1142439866 16:90090394-90090416 CTATCTTAATATGAGTAGCTAGG + Intronic
1148753350 17:49958920-49958942 ATGTCTTAAAGTGCCTTGCTAGG - Intergenic
1148914257 17:50961151-50961173 CTATGTTAAAGTGATTTGCTAGG + Intergenic
1151881353 17:76897029-76897051 CTGCCTCAATCTGAGTAGCTGGG + Intronic
1152957690 18:53160-53182 CTATCTTAATATGAGTAGCTAGG - Intronic
1153380053 18:4428277-4428299 GTGTTTAAAAGTGTGTAGCTGGG + Intronic
1156724341 18:40109989-40110011 CTTTCATAAAGAGAGTAGATGGG + Intergenic
1157782022 18:50447985-50448007 CTGTCTTGAACTGAGTATTTAGG + Intergenic
1157791070 18:50531627-50531649 GTGTCTGAAAGTGATGAGCTTGG - Intergenic
1158418444 18:57271208-57271230 CTGCCTTAAAGTTAGTCACTAGG - Intergenic
1159895545 18:73992275-73992297 CTGTCTGTATGTAAGTAGCTAGG - Intergenic
1161254197 19:3297741-3297763 CTGTCTCAGCCTGAGTAGCTGGG + Intergenic
1163706515 19:18817203-18817225 CTCTCTTAAACTGAGTGCCTGGG + Intergenic
1164503389 19:28838295-28838317 CTATCTTAAAGTGGGTGTCTGGG + Intergenic
1166792766 19:45407715-45407737 CCATCTTAAAGTGAGTAGCTAGG - Intronic
1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG + Intronic
925084459 2:1097100-1097122 CTGTGTTAAAGTGTGTATATGGG - Intronic
925610954 2:5702619-5702641 CTTTCATAAAATGAATAGCTTGG + Intergenic
925680303 2:6413480-6413502 GTGCCTTAAAGTGAGCATCTGGG - Intergenic
925750712 2:7088869-7088891 CTGTCTTAAACTGAGTTCCGGGG + Intergenic
926087035 2:10027100-10027122 CCATCTTGAAGTGAGTAGCTAGG - Intergenic
926337873 2:11877776-11877798 CTGTCTTAAATTAAAAAGCTTGG + Intergenic
926530270 2:14036132-14036154 TTGTCTTTAACTGAGCAGCTGGG + Intergenic
926637271 2:15195516-15195538 CTTTGTTAGAGTGGGTAGCTAGG + Intronic
931512436 2:63015280-63015302 CTGTGTTAATGGGAGTAACTTGG + Intronic
932026314 2:68137421-68137443 CTGTTTTCAGGTGTGTAGCTTGG - Exonic
937099880 2:119260404-119260426 CTGGGTTCAAGCGAGTAGCTGGG + Intronic
940570832 2:155431000-155431022 CTCACTAAAGGTGAGTAGCTGGG + Intergenic
943494255 2:188600141-188600163 CTGTCTTTAAATGTGTACCTAGG - Intergenic
945022905 2:205592021-205592043 ATGTCTTACAGTGTGTAACTGGG + Intronic
1169200648 20:3707555-3707577 GTGTCTTGGAGTGAGTAACTGGG - Intergenic
1171776783 20:29375816-29375838 CTATCTTAATATGAGTAGCTAGG - Intergenic
1171818159 20:29807226-29807248 CTATCTTAATATGAGTAGCTAGG - Intergenic
1171900086 20:30848051-30848073 CTATCTTAATATGAGTAGATAGG + Intergenic
1172153174 20:32804961-32804983 CTATTTTAAAGTGAGGAGCTTGG - Intronic
1172546408 20:35765086-35765108 CTGTATGAAAGTGAGTTGCATGG - Intergenic
1173355555 20:42284706-42284728 CTGTCTTAAAGAAAGAAGGTTGG + Intronic
1176013930 20:62918381-62918403 CTGCCTCAACCTGAGTAGCTGGG + Intronic
1180321600 22:11326645-11326667 CTATCTTAATATGAGTAGCTAGG - Intergenic
1180333451 22:11554046-11554068 CTATCTTAATATGAGTAGATAGG + Intergenic
1182570865 22:31236796-31236818 CAGCCTCCAAGTGAGTAGCTGGG - Intronic
1183431361 22:37767857-37767879 GTGTCATAAACTGAGTGGCTTGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1185103967 22:48856913-48856935 CAGTTTTTAAGTGAGGAGCTTGG + Intergenic
949506549 3:4733662-4733684 CTATCATATAATGAGTAGCTGGG - Intronic
951863249 3:27277380-27277402 ATGTCCTAAACTGAGTATCTGGG + Intronic
955384563 3:58469168-58469190 CCCTCTTGAAGTGAGTAACTGGG + Intergenic
957088303 3:75703835-75703857 CTATCTTAATATGAGTAGCTAGG + Intergenic
957126324 3:76165940-76165962 CTGTCTTATAGGGAGTGGTTTGG + Intronic
957436345 3:80181938-80181960 CTACCATAAAGTGAGTACCTTGG - Intergenic
959995009 3:112670916-112670938 CAGCCTTTAATTGAGTAGCTGGG - Intergenic
960809692 3:121615890-121615912 CCATCTTAAAGTGAATAGCGAGG - Intronic
961345720 3:126262087-126262109 CTACCTTAAAGTCAGTTGCTTGG - Intergenic
961884068 3:130084208-130084230 CTGTCTCAGCCTGAGTAGCTGGG - Intronic
964141977 3:153413544-153413566 CTCTCTTAAAGTAAGAAGCTAGG - Intergenic
966574999 3:181490827-181490849 CTGGGTTCAAGCGAGTAGCTGGG - Intergenic
968357044 3:198117024-198117046 CTATCTTAATATGAGTAGCTAGG + Intergenic
969340855 4:6540019-6540041 ATGCTTTAAAGTGAGAAGCTTGG - Intronic
970333987 4:15013806-15013828 CTATTTTAAAATGATTAGCTTGG - Intronic
975910479 4:79260322-79260344 CTGTTTTAATGTGAGGATCTTGG + Intronic
977390010 4:96396433-96396455 CTGTATTAAATTGAAGAGCTTGG - Intergenic
977399939 4:96520072-96520094 CCATCTTAGAGTGAGTAGTTGGG - Intergenic
979327122 4:119393337-119393359 CTTTTTTATAGTGAGTAGCATGG - Intergenic
983245004 4:165278025-165278047 CTTTTTTATAGTGAGTAGCATGG - Intronic
985442620 4:189994569-189994591 CTATCTTAATATGAGTAGCTAGG - Intergenic
986875038 5:12097086-12097108 CTGTCTAGAAGTGAGTGGCTAGG + Intergenic
987885611 5:23807693-23807715 TAGTCATAAAGTGAGTGGCTTGG - Intergenic
988887673 5:35575838-35575860 CTGTTTTAAAGAGAGTAGACAGG + Intergenic
990907151 5:60816261-60816283 CTATCTCAACCTGAGTAGCTGGG - Intronic
990962822 5:61412895-61412917 CAGACTTAAAGTCAGTTGCTGGG + Intronic
994269332 5:97758622-97758644 CTGTCTTAAACTAAGGAACTGGG + Intergenic
995191344 5:109322037-109322059 CTGTGTTACAGTAGGTAGCTAGG + Intergenic
997443359 5:133924488-133924510 CTGTCTTACCGTGCTTAGCTGGG - Intergenic
998406325 5:141876602-141876624 CTGACTTACAGAGGGTAGCTGGG + Intronic
999911600 5:156207564-156207586 CTTTCTTAAAATTAGTAGTTTGG + Intronic
1007128988 6:39451894-39451916 CTTACTTAAAATGGGTAGCTAGG + Intronic
1007558878 6:42789119-42789141 CTGGCTTAAAGTGAGTTAATGGG + Intronic
1011145883 6:84215922-84215944 CTGTATTAAATTGTGTACCTAGG - Exonic
1012983135 6:105850846-105850868 CTGTCTTAAAGTGATTCAGTAGG - Intergenic
1013127251 6:107196301-107196323 CAATATCAAAGTGAGTAGCTAGG - Intronic
1013304134 6:108832527-108832549 CTGGCTTAATCAGAGTAGCTGGG + Intergenic
1014439213 6:121454527-121454549 AGGTCCTATAGTGAGTAGCTTGG - Intergenic
1015397657 6:132753138-132753160 CTGAGTTCAAGCGAGTAGCTGGG + Intronic
1016627574 6:146190323-146190345 ATGTTTTAAAATTAGTAGCTTGG - Intronic
1016814995 6:148295186-148295208 CTACCTAAAAGTGGGTAGCTAGG - Intronic
1017427103 6:154333474-154333496 CTGTCTGAAGCTGAGGAGCTAGG - Intronic
1018055092 6:160045409-160045431 CTGCTTTTAAGTGTGTAGCTTGG + Intronic
1018139650 6:160817542-160817564 CTTTCTCAAAGTGTGTGGCTAGG - Intergenic
1024925313 7:54606714-54606736 CTTTCAAAAAGTGAATAGCTAGG + Intergenic
1026495488 7:70898129-70898151 CTGTCTTAATGTCAGTATCCTGG - Intergenic
1028077884 7:86536922-86536944 ATGTGTTTGAGTGAGTAGCTAGG - Intergenic
1031589006 7:123567239-123567261 ATGTCTAAATGTGAGTAGCAAGG + Intronic
1032440117 7:131936240-131936262 CTGCCTCAAAGTGATTAGCTGGG - Intergenic
1033351612 7:140566797-140566819 CTGTCTCAGCCTGAGTAGCTGGG + Intronic
1033786272 7:144734680-144734702 CTGTTTAAAAGTTAGTACCTGGG - Intronic
1036806706 8:11839777-11839799 CTGTCTTCAGGTGATTGGCTTGG + Intergenic
1038389304 8:27180274-27180296 AAGTATTAAAGTGAGTGGCTAGG - Intergenic
1038466733 8:27771810-27771832 CTGTCTTAAGGGAATTAGCTGGG + Intronic
1039039068 8:33389781-33389803 CTATGTTAAAGTCAGTACCTAGG + Exonic
1040024428 8:42768947-42768969 CTGTCTTAATGAGTGCAGCTTGG + Intronic
1043559258 8:81471169-81471191 CAGCCTCAAAGTGAGTAGCTGGG + Intergenic
1044942525 8:97357776-97357798 CTGTCTTAATGTAAGAAGCTGGG + Intergenic
1045156309 8:99477207-99477229 CTGTCTTAAAAGGAGTATCATGG + Intronic
1045273699 8:100682861-100682883 CTATCTGAAAGTGAGTATTTGGG + Intergenic
1045417234 8:101979572-101979594 TTATTTTAAAGTGAGTAGCATGG - Intronic
1047391002 8:124451248-124451270 GTGTCTTGAGGTGAGTCGCTGGG + Exonic
1049281288 8:141747364-141747386 CTGCCTCAACCTGAGTAGCTGGG + Intergenic
1049735042 8:144200302-144200324 CTGTGTGAAGGTGAGAAGCTGGG - Intronic
1052260771 9:26513921-26513943 CTGAGCTCAAGTGAGTAGCTAGG + Intergenic
1054830354 9:69618147-69618169 CTGTACTAAAATGACTAGCTCGG - Intronic
1056340693 9:85628805-85628827 CTGGGTTCAAGTGAGTAGCTGGG + Intronic
1056534092 9:87512754-87512776 CTGCCTCAGAGTAAGTAGCTGGG + Intronic
1057732050 9:97618421-97618443 CTGTCTTACACTAACTAGCTAGG + Intronic
1058038989 9:100283615-100283637 CCGTCTAAAGATGAGTAGCTGGG - Intronic
1059194560 9:112358694-112358716 TTGGCCTCAAGTGAGTAGCTGGG - Intergenic
1061148277 9:128813421-128813443 CAGTCTCCAAGTGAGTAGCTGGG - Intergenic
1062740456 9:138171435-138171457 CTATCTTAATATGAGTAGCTAGG + Intergenic
1203358505 Un_KI270442v1:188740-188762 CTTTCTTTAATTGAGCAGCTTGG - Intergenic
1203369821 Un_KI270442v1:292491-292513 CTATCTTAATATGAGTAGCTAGG - Intergenic
1186841123 X:13485612-13485634 CTGTCTTGAAGAGAGAAGCAAGG - Intergenic
1188489995 X:30727500-30727522 CTTTTTTATAGTGAGTAGCATGG + Exonic
1189360384 X:40345421-40345443 CATTTTTAAAGTGAATAGCTTGG + Intergenic
1191836173 X:65464684-65464706 GTTTCTTAAGGTGAGTGGCTAGG + Intronic
1195123237 X:101778920-101778942 CTTTTTTATAGTGAGTAGCATGG - Intergenic
1196699813 X:118655772-118655794 CTGCCTTAAAGGAAGTAGCTTGG - Intronic
1197237456 X:124083871-124083893 CTGCCTTAATCTGAGTAGCTGGG + Intronic
1201068484 Y:10122568-10122590 CTATCTTAATATGAGTAGCTAGG + Intergenic
1201759967 Y:17526068-17526090 CTATCTTAATATGAGTACCTAGG - Intergenic
1201841587 Y:18379922-18379944 CTATCTTAATATGAGTACCTAGG + Intergenic