ID: 1168453557

View in Genome Browser
Species Human (GRCh38)
Location 19:56485546-56485568
Sequence GAGTGTGGCCAGAGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168453552_1168453557 28 Left 1168453552 19:56485495-56485517 CCAGCCTGGGCAACAGAGCGAGA 0: 13859
1: 89903
2: 167511
3: 219270
4: 217578
Right 1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG No data
1168453553_1168453557 24 Left 1168453553 19:56485499-56485521 CCTGGGCAACAGAGCGAGACTCC 0: 7799
1: 51257
2: 99726
3: 151223
4: 177000
Right 1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG No data
1168453554_1168453557 3 Left 1168453554 19:56485520-56485542 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168453557 Original CRISPR GAGTGTGGCCAGAGGCCAGA TGG Intergenic
No off target data available for this crispr