ID: 1168456331

View in Genome Browser
Species Human (GRCh38)
Location 19:56511716-56511738
Sequence CAGTGGCCCCTGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168456331 Original CRISPR CAGTGGCCCCTGAGAGAAGT GGG (reversed) Intronic
900482592 1:2906404-2906426 CAGAGGCCCCTGAGGGATGCTGG - Intergenic
901415421 1:9112871-9112893 TAGTGGCTCCTGAGAGAGGCAGG + Intronic
901659355 1:10788972-10788994 CAGTGGCCACTGTGAGAAGCAGG - Intronic
902201371 1:14836124-14836146 AACTGGCTCCTGAGAGAAGAGGG + Intronic
902958180 1:19941322-19941344 CAATAGCCCCTGAGGGAAATAGG + Intergenic
903883928 1:26530369-26530391 CGGAGGGCCCTGGGAGAAGTGGG - Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
909093987 1:71264158-71264180 CAGTGTACCCTGAGAAAAATCGG - Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
915142860 1:153777747-153777769 CTGTGGCCCCTGCCAGAAGTGGG - Exonic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
915448832 1:155990565-155990587 CAGTCTTCCCTGAGAGAAGGAGG + Intronic
920281421 1:204846522-204846544 CAGAGGCCCAGGAGAGAACTAGG - Intronic
924783485 1:247172866-247172888 CAGTGCCCAGAGAGAGAAGTGGG + Intergenic
1063100274 10:2944520-2944542 CAGTGGCCCCTGAGATACCGGGG + Intergenic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1068763946 10:60742503-60742525 CAGTGGCCACTGAAAGGAGATGG - Intergenic
1069532730 10:69230985-69231007 CAGTGGACCCTGGGAGAGGGAGG - Intronic
1070362283 10:75702252-75702274 CAGTGACCTCTGAGAGATGATGG - Intronic
1070570257 10:77635974-77635996 CCTTGGCGGCTGAGAGAAGTAGG - Intronic
1070789244 10:79179917-79179939 CACTGGCCTCTGAGAGAGGGTGG - Intronic
1072226537 10:93375252-93375274 CAGTGGCAGCTGAGAGAAACTGG + Intronic
1072611193 10:97018626-97018648 CAGTGGCCCCTGTGAAAATGGGG - Exonic
1072711279 10:97717239-97717261 CAGCGGGCCCTGAGAGCGGTCGG - Exonic
1075808755 10:125209123-125209145 CAGAGGCGGCTGTGAGAAGTAGG - Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076867281 10:133174233-133174255 CAGAGGCCACTGTGAGAAGGTGG + Intronic
1077423696 11:2464668-2464690 TCCTGGCCCCTGAGAGAAGCTGG - Intronic
1081601586 11:44498920-44498942 CAAAGGCTCCAGAGAGAAGTGGG + Intergenic
1083593973 11:63910333-63910355 CAGTGTCTCCTGAGAGGAGGGGG - Exonic
1083608063 11:63990846-63990868 CAGAGGCCCCTGGGGGAAATGGG + Intronic
1083629217 11:64087229-64087251 CAGGGGCCCAGGAGAGCAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084582435 11:70032365-70032387 CAGGTGCCCCTGGGAGAAGCTGG + Intergenic
1086270740 11:85063344-85063366 CAGTGGACTATGAGAGAATTTGG - Intronic
1089218591 11:116851764-116851786 CAGTGCCCACTGAGAGGAATTGG - Intronic
1091032659 11:132204873-132204895 CAGTGGCCCTTGGGAAAAGATGG + Intronic
1093970554 12:25371766-25371788 CAGGAGCCCCTAAAAGAAGTGGG + Intergenic
1094499587 12:31010075-31010097 CACTCTTCCCTGAGAGAAGTGGG - Intergenic
1095940045 12:47720701-47720723 CAGTGGCCCCTTAGACAGGCTGG + Intronic
1096113923 12:49044158-49044180 CAGTGGGGCCTGGGAGAAGGTGG - Intronic
1096473861 12:51896206-51896228 GAGCGGCCCCTGAGAGAAGGAGG - Intergenic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1097317516 12:58187867-58187889 CAGAGGTTCCTGAGAGGAGTTGG - Intergenic
1099082993 12:78209951-78209973 CACTGTCCCTTGAGAGAAGGAGG - Intronic
1101666354 12:106819231-106819253 CAGTGGCCTCTGGGAGTAATTGG + Intronic
1101992415 12:109497910-109497932 CAGTGACCCCTGAGGTAAGCAGG + Exonic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1107344689 13:39446518-39446540 CAGTATACCCTGAGAGAACTGGG + Intronic
1110531406 13:76602867-76602889 CTGTGTCCCCTGACAGATGTGGG - Intergenic
1110670437 13:78170599-78170621 CAGTGGCACCTGAGAAACCTTGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1113509736 13:110843650-110843672 CAGTCGCCCCTCGGAGAGGTAGG - Intergenic
1113518042 13:110918270-110918292 CAGTGCGCCCTGAGGGACGTGGG + Intergenic
1113615993 13:111681061-111681083 CAGTGGCCCCGGAGGGCATTTGG + Intergenic
1113621461 13:111765954-111765976 CAGTGGCCCCGGAGGGCATTTGG + Intergenic
1113917516 13:113883424-113883446 CAGGGGCCGCTGAGGGACGTGGG - Intergenic
1114112822 14:19488613-19488635 TAGTGGCCTCTGGGAAAAGTGGG - Intergenic
1117439469 14:55746273-55746295 TCGAGGCCCCTGAGAGAAGGAGG + Intergenic
1117873161 14:60221666-60221688 AAGTGGCCTCTCAGAGTAGTGGG - Intergenic
1118039754 14:61903980-61904002 CAGTAATTCCTGAGAGAAGTTGG + Intergenic
1118059056 14:62115962-62115984 CAGGGGGCCCTGAGAGTGGTGGG + Intergenic
1120324756 14:83009921-83009943 CAGTGGCCCATGAAAGCAGCTGG + Intergenic
1121629183 14:95410177-95410199 CAGGGTCCCCTGAGAGGAGGTGG + Intronic
1122008241 14:98723839-98723861 CTGTGACCCCTGAAAGAAGAGGG + Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1123712410 15:22998354-22998376 CAGTTGGCCCTAAGTGAAGTTGG + Intronic
1124161860 15:27277906-27277928 ATGTGGTCCCTGAGGGAAGTGGG - Intronic
1126388661 15:48121143-48121165 CTGTGGCCCTTGGGAGACGTTGG - Exonic
1126497238 15:49305508-49305530 CAGTGGCCCTTGACAGAATAAGG - Intronic
1127294291 15:57596188-57596210 CAGTGCCCCCAGAGACAAATGGG - Intronic
1129937208 15:79460618-79460640 CAGTGGCCCATGAGATGAGATGG - Intronic
1132240718 15:100255322-100255344 CTTTGGGCCCTGAGAGAAGATGG - Intronic
1132317160 15:100898525-100898547 CAGAGCCCCCTGGGAGGAGTGGG + Intronic
1132660126 16:1057620-1057642 CAGTGGGCCCTGCGTGAGGTCGG - Intergenic
1133297278 16:4760760-4760782 CAGTGGCACATGGGAGCAGTGGG - Intronic
1134073047 16:11272482-11272504 CAGTACCCCATGAGAGCAGTAGG - Intronic
1136995095 16:35183580-35183602 CAGCAGACCCTGAGAGAAGAAGG + Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138525169 16:57600930-57600952 CAGTCCCCACTGAAAGAAGTGGG - Intergenic
1138526051 16:57607872-57607894 CGGTGGCCCCTGAGAGGATGCGG + Intergenic
1139211056 16:65076965-65076987 CAGTTGCCCCTGAGAAAAATGGG - Intronic
1143620016 17:8075403-8075425 CAGTGGCATCTCAGAGAGGTTGG - Intronic
1143864979 17:9917123-9917145 CAGTGGCCCAGGAGAGAGGGTGG + Exonic
1144673458 17:17146110-17146132 CCGTGGCCCCTGAGGGATCTGGG + Intronic
1146249034 17:31321739-31321761 CAGTGGCCAACTAGAGAAGTTGG - Exonic
1147132119 17:38415662-38415684 CAGGGCCCCGAGAGAGAAGTGGG - Intergenic
1147589828 17:41675178-41675200 CAGTGACCCCTGAAAGAGGTGGG - Intergenic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1148079041 17:44957444-44957466 CAGTGGCCTCTGGGAAAGGTGGG + Intergenic
1148892380 17:50817432-50817454 CAGGGGGCGCTGAGACAAGTCGG + Intergenic
1156010306 18:32489665-32489687 CAGTGATCCCTAAGATAAGTAGG - Intergenic
1156606669 18:38674478-38674500 GACAGGCCCCTGAGAGGAGTAGG + Intergenic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160333469 18:78016361-78016383 CAGTGGCACCTGAGGGGCGTGGG + Intergenic
1160425756 18:78778093-78778115 CAGTGGCCACTCAGAGAAGGCGG + Intergenic
1160425764 18:78778132-78778154 CAGTGGCCACTCAGAGAAGATGG + Intergenic
1160545453 18:79650150-79650172 CTGTGGCCCGTGAGAGCAGCTGG - Intergenic
1161200240 19:3010576-3010598 CTGGGGCCCCTGAAAGAAGCTGG - Intronic
1161737837 19:6002521-6002543 CAGAGGGCCCTGAGAGATGATGG + Intronic
1162641575 19:12014467-12014489 CAATGGCACCTGAGGGAGGTAGG - Intergenic
1164391135 19:27822309-27822331 CAGTGTCCAGTGGGAGAAGTGGG - Intergenic
1164749754 19:30644137-30644159 CAGTTGTCCCTGGGAGATGTTGG + Intronic
1165404924 19:35623736-35623758 CAGTTGCCTCTGAGGGAAGGTGG + Exonic
1166291210 19:41864684-41864706 CAGGGGTTCCTGAGAGGAGTGGG + Intronic
1166981647 19:46635077-46635099 CAGTGGCTCCAGGGAGAACTGGG + Intergenic
1167650854 19:50727852-50727874 CAGGGGACCCTGAGATGAGTCGG + Intergenic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
1168636106 19:57998827-57998849 GGGTGGCTCCTGAGAGAAATAGG - Intronic
925756282 2:7135046-7135068 CAGGCGCACCTGAGAGAGGTGGG - Intergenic
925850068 2:8072016-8072038 AAGTGGCACCTGAGAGATGTAGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927679735 2:25131736-25131758 CTGTGGGCCCTGAGAGCGGTGGG - Exonic
929371335 2:41227571-41227593 CAGTGATCCCTGAGAGATGGTGG + Intergenic
929919769 2:46163787-46163809 CAGAGGCCACTGAGAGACATGGG + Intronic
931443528 2:62307903-62307925 GAGTGGTCCCTGAGATTAGTTGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
935091165 2:99896303-99896325 CAGAGGTCCCTGATAGTAGTAGG - Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938427100 2:131201649-131201671 TAGTGGCCTCTGGGAGAAGTGGG + Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
940001176 2:148967454-148967476 CAGAGGCCCAGGATAGAAGTGGG + Intronic
942383931 2:175421678-175421700 GAGAGGCCCAGGAGAGAAGTGGG - Intergenic
944538112 2:200731084-200731106 TAGTGGCACCTGGGAGAAGTGGG + Intergenic
947081123 2:226398342-226398364 CGGTTGCTCCTGAGAGCAGTCGG - Intergenic
1170521643 20:17192076-17192098 CAGTGACCCCTGAGAGATGAGGG + Intergenic
1170898525 20:20437689-20437711 CAGTGCCTCCTGAGAAAAGCTGG - Intronic
1171285779 20:23937216-23937238 CACTGGGCCCTGAGAGATGGAGG + Intergenic
1171320509 20:24239721-24239743 CAGAGGCCCCTGATAATAGTGGG - Intergenic
1172941326 20:38656643-38656665 CATTGGCCCCTGTGGGAGGTGGG + Intergenic
1173869195 20:46331099-46331121 CATCTGCCCTTGAGAGAAGTAGG + Intergenic
1174305050 20:49609139-49609161 CAGGGACCCCTGAGAGCAGAGGG - Intergenic
1175274346 20:57757655-57757677 CACTGTCCCCTGAGAGAGGGAGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1178305436 21:31486891-31486913 CTGTGGCCCCGGTGAGGAGTTGG - Intronic
1181884224 22:26006976-26006998 CAGTGGCCCCTCAGGCAAGGTGG + Intronic
950481769 3:13248465-13248487 CAGTCTCCCCTGAGAGAACGTGG + Intergenic
953232040 3:41074042-41074064 CAGTGAACCCTGAAAGCAGTAGG - Intergenic
954123509 3:48514895-48514917 CAGGGGCCCCTGAACGAGGTGGG + Intergenic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
955805217 3:62726506-62726528 CCATGGCCCCTGACAGAAGGAGG - Intronic
959906045 3:111712357-111712379 CAGTGGACCGTGGGAGAGGTGGG - Intronic
960601463 3:119463219-119463241 GACTGGTCCCTAAGAGAAGTCGG + Intronic
961043487 3:123693546-123693568 TGGTTGCCCCAGAGAGAAGTGGG + Intronic
961122458 3:124384592-124384614 CAGTGTCCCTGGAAAGAAGTGGG - Intronic
961317429 3:126050148-126050170 CAGTGGCCCCAGAGATAACCAGG - Intronic
961734932 3:128995357-128995379 CAGTGGGCCCTGTGAGGAGTGGG + Intronic
961751998 3:129102108-129102130 CAGTGGTCCCTCTGAGAGGTGGG - Intronic
962988592 3:140558421-140558443 GATTGGCTCCTGAGAGAAATGGG - Intronic
964876028 3:161369725-161369747 CAGTATACCCTGAGAGAAGCAGG - Intronic
965458155 3:168929775-168929797 CTGTGGCCCCTACGGGAAGTGGG + Intergenic
967681943 3:192373863-192373885 GAGTCGGCCATGAGAGAAGTAGG - Intronic
969352583 4:6606315-6606337 CAGTGGCTCCTGAGGGAAAGTGG + Intronic
971764414 4:30811214-30811236 CAGTGGCACTTGATAGGAGTTGG + Intronic
974185097 4:58435296-58435318 CAGTGGCCCATGGCAGAGGTGGG - Intergenic
982198054 4:152936034-152936056 CGGGGGCCACCGAGAGAAGTAGG - Intergenic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
984429052 4:179625126-179625148 CAGTAGGCCCTGGGAGAAGGAGG - Intergenic
984977539 4:185242751-185242773 CAGGGGCCCCTGAGAGTAGAAGG + Intronic
985858487 5:2449783-2449805 GGTTGGCCCCTGTGAGAAGTGGG - Intergenic
988237549 5:28564798-28564820 TGGTGGCCCGAGAGAGAAGTGGG - Intergenic
990650055 5:57888143-57888165 CAGTTGCCCCTGGGAGAAGGTGG + Intergenic
993320499 5:86463567-86463589 CAGGGGCCTGTGAGAGAAGGGGG - Intergenic
997239571 5:132296528-132296550 CTGTGGCACCTGTGGGAAGTGGG + Intronic
997362404 5:133303475-133303497 AAGTGGCCCCTGATAGGAGCTGG - Intronic
997882613 5:137603934-137603956 TTGAGGCCCCTGAGAGAGGTTGG - Intergenic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1002316992 5:178349851-178349873 CAGTGGCCCCTGACTGGAGGGGG + Intronic
1002460661 5:179372013-179372035 CAGTGGCTCCTGAGTCAAGCTGG - Intergenic
1002498809 5:179634110-179634132 CAGTGGCACCTGCGCGAAGCTGG - Intronic
1002502867 5:179658414-179658436 CAGTGGCACCTGCGCGAAGCTGG + Intergenic
1002922792 6:1585104-1585126 CAGGGGCCCCTGGGGGAAGCCGG - Intergenic
1003766538 6:9243365-9243387 CAGTTGCCCAGGAGAGAACTTGG + Intergenic
1007652553 6:43432466-43432488 CCATGGGCCCTGGGAGAAGTGGG - Exonic
1012620092 6:101333444-101333466 CACTGGCCCCTGTGAGACCTGGG - Intergenic
1012668837 6:102014783-102014805 CTGTGGTCCCTGAGAGTGGTTGG + Intronic
1015181950 6:130370123-130370145 CAGCTGACCCAGAGAGAAGTGGG - Intronic
1015371326 6:132456898-132456920 CAGTGGCCTCTGAGGAAAGATGG - Exonic
1015921735 6:138273187-138273209 CATTGGGCCTTGAGAGAAGCGGG + Intronic
1018125504 6:160679016-160679038 TCGGAGCCCCTGAGAGAAGTGGG - Intergenic
1018998751 6:168729708-168729730 CAGTGGCCTCTGAGGGCAGGAGG + Intergenic
1019152413 6:170017551-170017573 GAGAGGCCCCTGAGGGAAGTTGG + Intergenic
1019310949 7:360339-360361 CAGTGGCTTCTGAGAGAGGAGGG - Intergenic
1022024286 7:26431323-26431345 AAGTGCCACCTGAGAGAAATGGG + Intergenic
1022199633 7:28103896-28103918 CAGTGGCCCTTGAGAAGAGGAGG - Intronic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024199570 7:47091805-47091827 CAGTTGCCTCTCAGAGAAGTGGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1033019562 7:137709257-137709279 CAGTGGCCCATAAGAGAAAGAGG - Intronic
1034162842 7:149005529-149005551 CTGTGGCCCCCGTGACAAGTGGG - Intronic
1035556900 8:573858-573880 GCGTGGCCCCTGAGAAAAGCAGG + Intergenic
1035741951 8:1935309-1935331 CAGTGGACCCTGAGTGATGAGGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039504735 8:38043750-38043772 CCCTGGCCCCTGAGAAATGTTGG + Intronic
1039546303 8:38413694-38413716 CAGCGGCTCATGAGAGAAGACGG + Exonic
1042316913 8:67435162-67435184 CAGTGGGCCATGGAAGAAGTAGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1048385946 8:133912676-133912698 GGGTGGCCCTTCAGAGAAGTGGG - Intergenic
1048451461 8:134537465-134537487 CAGTGGACCGGGAGAGATGTGGG + Intronic
1048687918 8:136925024-136925046 CAGGAGCCCCTGAGAAAAGAAGG - Intergenic
1049037274 8:140086460-140086482 CTGTGGCCCCTGAGAGCCATGGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049934173 9:484771-484793 CAGTGGCCCCAGTGAGCACTGGG + Intronic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1059359458 9:113729492-113729514 CTGTGGCCCCTGAAAGTATTGGG + Intergenic
1060376621 9:123120341-123120363 CAGTGCCTCCTGAGAGAGGGTGG - Intronic
1061245500 9:129399423-129399445 CTGGGGACCCTGAGAGAAGGAGG - Intergenic
1185803629 X:3035902-3035924 TAGTGGCCCATTAGTGAAGTGGG - Intergenic
1186381888 X:9069593-9069615 CTGAGGCCCCACAGAGAAGTTGG - Intronic
1188843745 X:35047712-35047734 CAGTGGCAGCTGAGAGAATGAGG - Intergenic
1189318053 X:40069651-40069673 CAGAGGGACCTGGGAGAAGTGGG - Intronic
1191615902 X:63168926-63168948 GAGCAGCCCCTGAGAGAAGGGGG + Intergenic
1191620396 X:63209997-63210019 GAGCAGCCCCTGAGAGAAGGGGG - Intergenic
1196140706 X:112260218-112260240 CAGGGGCCCCTGAAGGAAATAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic