ID: 1168459093

View in Genome Browser
Species Human (GRCh38)
Location 19:56538892-56538914
Sequence GCCCAGTGGATGCCGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168459086_1168459093 4 Left 1168459086 19:56538865-56538887 CCGGGGGCGGGGCGGCTCCGCGG 0: 1
1: 0
2: 5
3: 44
4: 388
Right 1168459093 19:56538892-56538914 GCCCAGTGGATGCCGGGCCATGG 0: 1
1: 0
2: 1
3: 42
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168459093 Original CRISPR GCCCAGTGGATGCCGGGCCA TGG Intergenic
900534603 1:3170676-3170698 GCCCAGAGGAGGCGGGGCCCGGG + Intronic
900595426 1:3478137-3478159 GCCGAGTGGAAGCCGCGCCTCGG - Intronic
900697041 1:4018996-4019018 CCCCATTGGATGTCAGGCCAAGG + Intergenic
901099803 1:6711057-6711079 GACCAGTGGTTGCCTGGACATGG - Intergenic
901892000 1:12274790-12274812 TTCCAGTGGATGCTGGGCCGTGG + Intronic
902361715 1:15945648-15945670 GCGCAGTGGAGGCAGGGCCCTGG + Intronic
902779134 1:18693258-18693280 ACCAAGTGGGTGCCGGGCAAAGG - Intronic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
903186317 1:21631259-21631281 GCCCAGAGCATGCCGGGACATGG + Intronic
904007644 1:27372105-27372127 GACCAGTGGAGGCAGGGACATGG - Intronic
904040289 1:27580312-27580334 GCCCTCTGGAAGCCAGGCCAGGG + Intronic
905362728 1:37431445-37431467 GCCCTGGGGAGGCCTGGCCAAGG + Intergenic
906264434 1:44417783-44417805 GCCCCGGGGAGGCCAGGCCACGG + Intronic
907021706 1:51072513-51072535 GCCCAGTGGATGCCAAGGAATGG - Intergenic
908301194 1:62761953-62761975 GCCTAGTGGATCCTGCGCCAGGG - Intergenic
908672490 1:66563500-66563522 GCCGAGTGGATGGAGAGCCAGGG - Intronic
909335312 1:74465681-74465703 GCCTAGTGGATACCTGGCCAGGG - Intronic
909782205 1:79561465-79561487 GCCTAGTGGGTCCCGTGCCAGGG + Intergenic
911157443 1:94651480-94651502 GCCCAGTGGATGCCAGGACTGGG - Intergenic
912723948 1:112042781-112042803 GCCCAGTGGAATCCCGGGCAGGG - Intergenic
912978100 1:114347747-114347769 GCCCAGGGGTTGCCCGTCCACGG - Intergenic
913987171 1:143575478-143575500 GCCCAGTGGATCTCGCACCAGGG - Intergenic
914438358 1:147680703-147680725 ACCCAGTGGATCCCGCACCAGGG + Intergenic
915865472 1:159494545-159494567 ACCCAGTGGATCCCGCACCAGGG + Intergenic
915931619 1:160063821-160063843 GCGCAGTGGATTCAGGGGCAAGG + Intronic
916681829 1:167111974-167111996 GCCCAGTGTCAGCCAGGCCATGG + Intronic
917406423 1:174711827-174711849 GCCTAGTGGATCCTGTGCCAGGG - Intronic
918002321 1:180509030-180509052 GCCTGGTGGATCCCGTGCCAGGG - Intergenic
918732227 1:188013258-188013280 ACCCAGTGGATCCCGTGCCTGGG + Intergenic
918942910 1:191025937-191025959 GCCTAGTGGATCCCGCACCAGGG + Intergenic
919201274 1:194358206-194358228 ACCCAGTGGATGCCACACCAGGG + Intergenic
919938963 1:202273404-202273426 ACCCACTGGATGTGGGGCCAGGG - Intronic
920366252 1:205449820-205449842 TCCCAAGGGATGCTGGGCCAGGG + Intronic
922166058 1:223116899-223116921 GCCTAGTGGATCCCGCGTCAGGG + Intronic
922798991 1:228355569-228355591 CCCCAGGGGATGCCTGGGCAGGG - Intronic
922985956 1:229865879-229865901 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1063309239 10:4937364-4937386 GCTCAGTGGATCCCGCACCAGGG + Intronic
1063339745 10:5252237-5252259 TCCCAGAGGATGCAGGGCCAGGG + Intergenic
1063769777 10:9183773-9183795 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1063907648 10:10797653-10797675 GTCCAGTGGCTTCCGGACCATGG - Intergenic
1066429477 10:35337352-35337374 GCCCAGAGGCTGCGGGGCCCCGG - Intronic
1066624489 10:37392304-37392326 ACCCAGTGGATCCCGGGCTCTGG + Intergenic
1067042373 10:42961904-42961926 CCACAGTGGAGGCCGAGCCAAGG - Intergenic
1068374102 10:56155547-56155569 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1068792350 10:61041037-61041059 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1069831372 10:71284282-71284304 GCCCCGTGGCTGCAGAGCCAGGG + Intronic
1069988759 10:72301026-72301048 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1071008226 10:80908392-80908414 GCCCAGTGGATGCCATGTTATGG - Intergenic
1073486854 10:103824601-103824623 GCCGAGGGGATGCCGGGAGAGGG - Intronic
1075375941 10:121978327-121978349 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1075645418 10:124093164-124093186 GCCTCGGGGAGGCCGGGCCAAGG + Intronic
1075741558 10:124699304-124699326 ACCCAGTGGATGTCAGGCAACGG + Intronic
1076473883 10:130739114-130739136 GCCCTGTGGATGTCTGGGCAGGG + Intergenic
1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG + Intronic
1077364182 11:2154891-2154913 GCCCTGTGGAGGCCGGGCTGGGG + Intronic
1077466318 11:2735342-2735364 GCCCGGTGGAGGGTGGGCCATGG + Intronic
1077520488 11:3030421-3030443 GCCCACTGGATGCCCTGCCGCGG - Intronic
1079867681 11:25756512-25756534 GCCTAGTGGATCCCGCACCAGGG - Intergenic
1081374632 11:42344274-42344296 GCCTAGTGGATCCCGAGCCAGGG + Intergenic
1081600302 11:44488205-44488227 CTCCAGTGGAGGCCGGGCCCTGG - Intergenic
1082028850 11:47590729-47590751 GCTCAGAGGATCCCGGGCCGGGG + Exonic
1082924699 11:58532366-58532388 GCCTAGTGGATCCCATGCCAGGG - Intronic
1083091895 11:60208441-60208463 GCCCAGTGGATGTGGGTCCTTGG - Intronic
1083955134 11:65978715-65978737 GCCCTGTGCCTGCCGGGGCAGGG + Intronic
1085454114 11:76656183-76656205 GCCCAGGGGCTGCAGGGCCAAGG + Intergenic
1086001518 11:81990786-81990808 GCCTAGTGGATCCTGGGCCAGGG + Intergenic
1088595055 11:111435221-111435243 GCCCAGTGGAGAACGGGACAGGG - Intronic
1088825648 11:113491601-113491623 GCCCAGTAGGTGCCTGGCCGTGG - Intergenic
1089139511 11:116274679-116274701 CCCCAGTGAATGCCAGGCCCTGG - Intergenic
1090586117 11:128215213-128215235 GCCTAGTGGATCCGGTGCCAGGG + Intergenic
1093189483 12:16057798-16057820 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1093524717 12:20093258-20093280 GCCCAGTGGATCTCGCACCAGGG + Intergenic
1093741295 12:22692975-22692997 GCCTAGTGGATGCCGCGCTGGGG + Intergenic
1094409916 12:30157283-30157305 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1096465496 12:51846159-51846181 GCCCACTGGGGGCAGGGCCAGGG + Intergenic
1096652376 12:53068233-53068255 GCTGAGTGGGTGCCGGGCCTGGG + Exonic
1097253763 12:57656187-57656209 GCCTAGTGGATCCCATGCCAGGG - Intergenic
1099191041 12:79561971-79561993 GCCTAGTGGATCCCGCACCAGGG - Intergenic
1099478738 12:83140485-83140507 GCCTAGTGGATCCCTCGCCAGGG - Intergenic
1101603930 12:106233453-106233475 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1101819603 12:108173603-108173625 GCCCAGTAGATGCTGGGGTAAGG + Intronic
1102486038 12:113257999-113258021 GCTCAGTGGTTGCCTGGGCATGG + Intronic
1102689962 12:114752702-114752724 CCCCAGGGGATGCTGGGGCAGGG + Intergenic
1102948373 12:117010496-117010518 GCGCAGTGGGGGCCGGGCCTTGG - Intronic
1103322904 12:120102087-120102109 GCCCAGTCGATGCAGGGCCTCGG + Intronic
1103443228 12:120978750-120978772 GCCCTGTGGCAGCCGAGCCATGG + Exonic
1103556145 12:121767726-121767748 GGCTTGTGAATGCCGGGCCAGGG + Intronic
1104198831 12:126567463-126567485 GCCTAGTGGATCACGTGCCAGGG - Intergenic
1104344576 12:127983808-127983830 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1104373965 12:128247671-128247693 GCCTAGTGGATCCCGTGCGAGGG - Intergenic
1104989518 12:132617942-132617964 GACCAGTGGTTGCCAGGGCATGG + Intergenic
1105701462 13:22938565-22938587 TCCTAGTGGATCCCGTGCCAGGG + Intergenic
1105763189 13:23531829-23531851 GCCTAGTGGATCCCGCTCCAGGG - Intergenic
1105871073 13:24506756-24506778 ACCCAGTGGATCCCATGCCAGGG + Intronic
1106643354 13:31608766-31608788 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1106692805 13:32136709-32136731 GCCCAGTGGATGCAGGGCACTGG - Intronic
1107590385 13:41898516-41898538 ACCCAGTGGATCCCGCACCAGGG + Intronic
1108063429 13:46553976-46553998 ACCCTGTGGCTGCCGCGCCAGGG + Intronic
1108469380 13:50753244-50753266 ACCCAGTGGATCCCGCACCAGGG + Intronic
1108845752 13:54676993-54677015 GCGTAGTGGATCCCGTGCCAGGG - Intergenic
1109323451 13:60837888-60837910 GCCCAGAGGAGGCAGGGCTATGG - Intergenic
1112842764 13:103600362-103600384 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1112886072 13:104173568-104173590 GGCCAGTGGATGCAGGGAGATGG + Intergenic
1113482607 13:110632966-110632988 ACCCAGTGGATCCCGCACCAGGG + Intronic
1113673824 13:112194834-112194856 GCCCAGTTCATGCCCAGCCAGGG - Intergenic
1115174511 14:30547445-30547467 GCCTAGTGGATCCCGCCCCAGGG + Intergenic
1117077946 14:52122668-52122690 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1120805023 14:88737495-88737517 GCCCAGTGCAGCCCGGGACAGGG + Intronic
1121145476 14:91578397-91578419 GCCTAGTGGATCCCACGCCAGGG - Intergenic
1121603135 14:95220837-95220859 GCCCAGAGGTTGCAGGGGCAGGG + Intronic
1122542609 14:102506483-102506505 ACCCTGTGGACTCCGGGCCAGGG - Exonic
1122772353 14:104103044-104103066 GCACAGTGGGTGCCTGGCAAGGG + Intronic
1122808994 14:104278547-104278569 GCCCAGGGGATGCCTGCCCGGGG + Intergenic
1122838148 14:104441410-104441432 GCCCAGTGGATGGTGGGTCAGGG + Intergenic
1124114773 15:26831116-26831138 ACCCAGTGGATCCCGCACCAGGG + Intronic
1124880657 15:33639639-33639661 CCCCAGTGGGAGCTGGGCCATGG + Intronic
1125518795 15:40337135-40337157 GCTCAGTGGAAGCCGGCCCGGGG - Intronic
1127104053 15:55594351-55594373 GTTCAGTAGATGCCAGGCCAAGG - Intergenic
1128669907 15:69567295-69567317 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1128813230 15:70587111-70587133 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1129410435 15:75347867-75347889 GCCCTGTGGGTGCCAGGCCAGGG + Intronic
1129766905 15:78175457-78175479 GCACAGGGGCTGCAGGGCCAGGG + Intronic
1131912674 15:97224670-97224692 GCCTAGTGGATTCCGCGCCGGGG - Intergenic
1132098800 15:99008213-99008235 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1132372783 15:101309701-101309723 GGCAAGTGGAGGCAGGGCCAGGG + Intronic
1132590064 16:722676-722698 GCCTAGTGGCTGCCGGTCCTTGG + Exonic
1132672147 16:1106355-1106377 GCCCAGGGGTTGGGGGGCCATGG - Intergenic
1132685027 16:1158652-1158674 GCCCAGAGCAGGCCGGGCCCTGG + Intronic
1132694830 16:1197313-1197335 GTACAGTGGGTGCCGGGCAAAGG - Intronic
1132871777 16:2118604-2118626 GCCCAGTGTCTGCAGGGCCCAGG + Intronic
1133015711 16:2938526-2938548 GCTCAGTGGGTGCCTGGCCTGGG - Intronic
1134049023 16:11123960-11123982 GCTCAGAGGATGCCCTGCCAGGG - Intronic
1134069202 16:11250220-11250242 GCCTGGTGGATGCTGGGCCATGG - Intronic
1134520750 16:14918291-14918313 GCCCAGTGTCTGCAGGGCCCAGG - Intronic
1134550825 16:15137682-15137704 GCCCAGTGTCTGCAGGGCCCAGG + Intronic
1134708422 16:16316942-16316964 GCCCAGTGTCTGCAGGGCCCAGG - Intergenic
1134715637 16:16356975-16356997 GCCCAGTGTCTGCAGGGCCCAGG - Intergenic
1134951180 16:18351703-18351725 GCCCAGTGTCTGCAGGGCCCAGG + Intergenic
1134959120 16:18395184-18395206 GCCCAGTGTCTGCAGGGCCCAGG + Intergenic
1135470143 16:22722929-22722951 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1137624896 16:49901326-49901348 GCCCAGTGGATCCTGTCCCAAGG + Intergenic
1137655409 16:50154155-50154177 GCCCAGCGGAGGGCGGGCCGCGG + Exonic
1139125463 16:64072265-64072287 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1139504463 16:67392147-67392169 GCCCAGGGGGTGGCAGGCCAGGG - Intronic
1139603133 16:67998639-67998661 ACCCAGTGGATCCCGCACCAGGG - Intronic
1139648608 16:68349977-68349999 GACCAGTGGCTGCCAGGCCTGGG - Intronic
1141087783 16:81109071-81109093 GCCCGGTGCTTGCCAGGCCATGG + Intergenic
1141597777 16:85107803-85107825 GGCCTGGGGCTGCCGGGCCAGGG - Intronic
1141602743 16:85136440-85136462 GCCCAGCTGAGGCCAGGCCAGGG - Intergenic
1142430252 16:90022637-90022659 GCCCAGCGGTTGCCGGGAAACGG + Exonic
1144771424 17:17761755-17761777 CCCCTGTGAATGCCAGGCCAAGG + Intronic
1144946807 17:18973490-18973512 GCCTGGTGGATGCGGGGCCTCGG + Intronic
1145241411 17:21242786-21242808 GCCCAGTGCAGGCAGGGCCCTGG - Exonic
1146621473 17:34401839-34401861 GCCCAGTGGGTGCCAGGTCCTGG - Intergenic
1146646679 17:34581080-34581102 GCCCCGGGGATGTCGGGCCGCGG + Exonic
1147331188 17:39700355-39700377 GCCCTGTGGATGCCCCGCCGAGG + Intronic
1147373700 17:40011358-40011380 ACCCAGTGGATTCCGCACCAGGG - Intergenic
1147431891 17:40376253-40376275 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1148085295 17:44990263-44990285 GCCCAGTGGAGGTCAGGCCAAGG + Intergenic
1148332955 17:46822766-46822788 GCCCAGGTGATGCCGGTCCAGGG + Intronic
1148570911 17:48668223-48668245 ACCCAGATGATGCCGGGCCTGGG + Intergenic
1149099184 17:52883912-52883934 ACCCAGTGGATGCCGCACCAGGG + Intronic
1149519479 17:57307673-57307695 GGCCAGTGGATGGGAGGCCAAGG - Intronic
1149782569 17:59409653-59409675 ACCCAGTGGAAGAGGGGCCATGG - Intergenic
1150127586 17:62648392-62648414 TCCCAGTGTCTGCCAGGCCAAGG + Intronic
1152244795 17:79179723-79179745 GTCCACTGGATCCCAGGCCAGGG + Intronic
1152391924 17:80008515-80008537 GCCCTGGGGATGCAGGGACACGG + Intronic
1154047067 18:10916231-10916253 GCCTAGTGGATCCCATGCCAGGG + Intronic
1155785883 18:29899026-29899048 GCCTAGTGGATCCAGGGCCACGG + Intergenic
1156242960 18:35271589-35271611 GCCTAGTGGAACCCGTGCCAGGG + Intronic
1156267657 18:35503160-35503182 GCCCAGTGGATGCTGGGGACAGG + Intergenic
1157979723 18:52366840-52366862 ACCCAGTGGATCCCGCACCAGGG + Intronic
1158137557 18:54224127-54224149 GCCCAGGGGACCCCGGGCCACGG - Exonic
1159472868 18:68879932-68879954 ACCCAGTGGATCCCGCACCAGGG + Intronic
1160862010 19:1241356-1241378 GCTCATTGGATGCAGGGCCCTGG - Intergenic
1161269656 19:3382835-3382857 GGCCAGTGCATGCAGGGCCCAGG + Intronic
1161562809 19:4983225-4983247 GCTCAGTGCATCCGGGGCCAGGG - Intronic
1161569117 19:5020590-5020612 GCCCAGAGGAAGCCAGGCCGCGG + Intronic
1161707556 19:5829243-5829265 CCCCCGTGGAGGCCCGGCCAGGG - Intergenic
1162534034 19:11252805-11252827 GCCCCGGGAATGCCGGACCACGG - Exonic
1165152978 19:33771783-33771805 GGCCTTTGGGTGCCGGGCCAGGG + Intronic
1165762147 19:38327585-38327607 GCCCAGTGGAGCCCGGGACATGG - Exonic
1166333453 19:42091616-42091638 GCTAAGGGCATGCCGGGCCAGGG + Intronic
1167404180 19:49293473-49293495 ACCCAGTGGTAGCCGGGCGAGGG + Intronic
1168459093 19:56538892-56538914 GCCCAGTGGATGCCGGGCCATGG + Intergenic
925172519 2:1759238-1759260 GCCTAGTGGATCCCACGCCAGGG + Intergenic
925997896 2:9306882-9306904 GCTCTGTGGATGTCCGGCCAGGG - Intronic
926097566 2:10091841-10091863 ACCCAGTGGATGTCGCACCAGGG - Intergenic
926192644 2:10740375-10740397 GCCCAGGGGATGCAGGAGCAAGG - Intronic
927900481 2:26814783-26814805 ACCCAGTGGATCCCGCACCAGGG - Intergenic
928723041 2:34142471-34142493 GCCTAGTGGATCCCACGCCAGGG + Intergenic
929379765 2:41336014-41336036 ACCCAGTGGATCCCGCACCAGGG - Intergenic
929438879 2:41949891-41949913 GCCCTGTGGATGCAGGCCAAGGG + Intronic
929606919 2:43240895-43240917 GCCCAGTGCATGCTGGGACTAGG - Intronic
930039291 2:47107703-47107725 ACCCAGTGGATCCCGCACCAGGG - Intronic
930096531 2:47570548-47570570 GCCCAGCGGGTGCCCGGGCAGGG + Exonic
930593467 2:53356854-53356876 GCCTAGTGGATCCCCTGCCAGGG - Intergenic
930703513 2:54483030-54483052 ACCCTGAGGAGGCCGGGCCAGGG + Intronic
931517774 2:63059783-63059805 GCCCAGGGCCTGCCGGGCCGCGG + Intergenic
932158610 2:69440080-69440102 GCCTAGTGGATCCCATGCCAGGG + Intergenic
933663587 2:84946723-84946745 GCCCACTGCAGGCCGGGCCCTGG - Intergenic
934569009 2:95356971-95356993 GCCCAGAGGCTGCTGGCCCAGGG + Intronic
937905255 2:127049924-127049946 GCCCTGTGCACGCAGGGCCATGG - Intronic
938183466 2:129206459-129206481 GCCCATTGCATGCCAAGCCATGG - Intergenic
939886367 2:147686200-147686222 GCCTAGTGGATCCCACGCCATGG + Intergenic
939972473 2:148678337-148678359 ACCCAGTGGATCCCGCACCAGGG + Intronic
941309861 2:163914041-163914063 ACCCAGTGGATCCCGCACCAGGG - Intergenic
943443376 2:187952139-187952161 GCCTAGTGGGTCCCGCGCCAGGG - Intergenic
943516280 2:188891003-188891025 GCCTAGTGGATCCCGTGCCAGGG - Intergenic
943520543 2:188944371-188944393 GCCTAGTGGATCCTGCGCCAGGG + Intergenic
944482869 2:200175163-200175185 ACCCAGTGGATCCCGCACCAGGG - Intergenic
945744296 2:213701650-213701672 GCCTAGTGGATCCTGCGCCAGGG - Intronic
945869224 2:215208297-215208319 GCCTAGTGGATCCCACGCCAGGG - Intergenic
946923488 2:224603638-224603660 ACCCAGTGGATTCCGCACCAGGG + Intergenic
947026710 2:225744557-225744579 ACCCAGTGGATCCCGCACCAGGG - Intergenic
947926061 2:233923556-233923578 GTGCAGTGGATGCCGGCCCATGG - Intronic
948600215 2:239103688-239103710 GCTCAGCGGATGCTGGGGCAGGG - Intronic
949031357 2:241798905-241798927 ACCCACTGGGTGCCGGCCCATGG - Intronic
1169630152 20:7622387-7622409 ACCTAGTGGATCCCGTGCCAGGG + Intergenic
1170930974 20:20768870-20768892 CCCTAGTGGATCCCGGGCCAGGG - Intergenic
1171012255 20:21515100-21515122 GCCCAGAGGCAGCAGGGCCAGGG - Intergenic
1171187536 20:23133438-23133460 TCCCAGTGGATGCAGGGTCGGGG + Intergenic
1174092375 20:48059264-48059286 GCCTAGTGGATCCCAAGCCAGGG - Intergenic
1174367368 20:50064668-50064690 GCCCAGGGGCTGCAGGGCCAGGG + Intergenic
1175692458 20:61075456-61075478 GTCCAAAGGATGCCTGGCCAGGG - Intergenic
1175912122 20:62410032-62410054 GCCCTGTGGCTGCCAGGCCAGGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1175989940 20:62783610-62783632 GCCCAGGGGGAGCCGGGGCATGG - Intergenic
1176344761 21:5733445-5733467 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1176351575 21:5854029-5854051 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1176500066 21:7591010-7591032 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1176539082 21:8131515-8131537 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1176558033 21:8314560-8314582 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1179445383 21:41426856-41426878 CCCCAGTGGATGCCATGCCTGGG + Intronic
1179644595 21:42767702-42767724 GCCCGGTGCAGGCAGGGCCACGG + Intronic
1180138382 21:45875957-45875979 GCACCGGGGATGCGGGGCCATGG - Intronic
1181450467 22:23016989-23017011 ACCCAGTGGATCCCGCGCCGGGG + Intergenic
1181625483 22:24119698-24119720 GGTGAGTGGCTGCCGGGCCAAGG + Exonic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1183896483 22:40973419-40973441 GCGGAGTGGATGCCAGTCCATGG - Intergenic
1184467428 22:44677069-44677091 GCACACTGGATGCCTGGCCTTGG - Exonic
1184524686 22:45014896-45014918 GCTCCGAGGATGCTGGGCCAAGG + Intergenic
1185128747 22:49025770-49025792 GGCCACTGGAGGCAGGGCCATGG + Intergenic
1185371304 22:50462159-50462181 GCCCAGTGGAGGCGGGGCCGTGG - Intronic
1203244032 22_KI270733v1_random:47870-47892 ACCCAGTGGATCCCGCACCAGGG + Intergenic
950556387 3:13698698-13698720 GCCCAGGGGATGCTGGGGCTAGG - Intergenic
950601308 3:14037629-14037651 GCCTAGTGGATCCCGTGCCGGGG - Intronic
950809272 3:15635864-15635886 TCCCAGGGGATGCCGGTCCACGG - Intronic
951491156 3:23271967-23271989 GCCTAGTGGATCCCGCGCCAGGG + Intronic
952652604 3:35744458-35744480 GCACAGTGGCTGCCGGGCTCTGG - Intronic
953149435 3:40310299-40310321 GCAAAGGGTATGCCGGGCCAGGG + Intronic
955219748 3:57013290-57013312 GCCTAGTGGATCCCATGCCAGGG - Intronic
956199492 3:66691707-66691729 GCCCAGTGAAGGCTGGGGCAGGG - Intergenic
957209356 3:77240028-77240050 GCCTAGTGGATCCCATGCCAGGG + Intronic
957919603 3:86731447-86731469 ACCCAGTGGATCCCGCACCAGGG + Intergenic
957970463 3:87375723-87375745 GCCTAGTGGATGCCAGGCCAGGG - Intergenic
960559961 3:119073335-119073357 GCCTAGTGGATCCCGCGCCAGGG + Intronic
960869264 3:122232609-122232631 GGCCAGTGTATGCAGGGCCCAGG + Intronic
961450767 3:127001375-127001397 GCTCCCTGCATGCCGGGCCAGGG + Intronic
961700713 3:128742863-128742885 GCCTAGCGGATCCCGTGCCAGGG + Intronic
961956960 3:130814778-130814800 GCCCAGTGGATCCCGCACCAGGG + Intergenic
962600422 3:136987524-136987546 ACCCAGTGGATCCCGCACCAGGG + Intronic
962933748 3:140060604-140060626 GCCCAGTGGATACCTGGCTCAGG + Intronic
963397292 3:144750232-144750254 ACCCAGTGGATCCCGCACCAGGG - Intergenic
964983078 3:162710444-162710466 ACCCAGTGGATCCCGCGCCAGGG + Intergenic
965728652 3:171746301-171746323 GCCTAGTGGATCCCGTGCCCAGG - Intronic
966425397 3:179775455-179775477 GCCTAGTGGATCCTGTGCCAGGG + Intronic
967068693 3:185943144-185943166 GGCCAGTGGCAGCCAGGCCAGGG + Intergenic
968222129 3:196947352-196947374 GCCAAGTGGCTGGTGGGCCATGG - Exonic
968412735 4:403936-403958 ACCCAGTGGATCCCGCGCCGGGG + Intergenic
969457821 4:7310180-7310202 GCCCAGCGGAGGCCCAGCCAGGG - Intronic
969621933 4:8283016-8283038 GGCCAGTGGATGCAGGGCAGTGG + Intronic
972872685 4:43319794-43319816 GCCCAGTGATAGCCGGGCCATGG + Intergenic
972890546 4:43551642-43551664 GCCTAGTGGATCCTGTGCCAGGG - Intergenic
973045463 4:45530877-45530899 GCCTAGTGGATCCCGCACCAGGG - Intergenic
973587684 4:52409681-52409703 ACCCAGTGGATCCCGCACCAGGG + Intergenic
973684271 4:53354019-53354041 GCCTAGTGGATCACGCGCCAGGG + Intronic
974299169 4:60042158-60042180 GCCTAGTGGATCCCGCACCAGGG + Intergenic
975160794 4:71121395-71121417 GCCTAGTGGATGCAGTGCCAGGG - Intergenic
977717272 4:100196456-100196478 ACCCAGTGGATCCCGAACCAGGG + Intergenic
978514682 4:109557829-109557851 CCCTAGTGGATGCCATGCCAGGG - Intergenic
979755943 4:124339436-124339458 ACCCAGTGGATCCCGCACCAGGG - Intergenic
979920519 4:126490341-126490363 CCCCAGTGGATCCTGTGCCAGGG - Intergenic
980043301 4:127964173-127964195 GCCCAGTGGATCCCGCACCGGGG + Intronic
982770239 4:159390380-159390402 GCCTAGTGGATCCCGTGCCTGGG - Intergenic
983425789 4:167581980-167582002 GCCCAGTGGATCCTGTGCCAGGG - Intergenic
983834162 4:172369417-172369439 ACCTAGTGGATCCCGTGCCAGGG + Intronic
984862564 4:184253365-184253387 GCCTAGTGGGTCCCGTGCCAGGG - Intergenic
984901824 4:184592291-184592313 ACCCAGTGGATCCCGCACCAGGG - Intergenic
984972615 4:185204138-185204160 GCGGAGTGGAGGCCGGGCCAGGG + Intronic
985324783 4:188754917-188754939 GCCTAGTGGATCCCATGCCAGGG - Intergenic
985415278 4:189730367-189730389 GCCCAGTGAAAGCCTGGCCTGGG - Intergenic
986332281 5:6726521-6726543 GGACAGTGGATGCCAGGTCAAGG - Intronic
986919103 5:12662328-12662350 GCCTAGTGGATCCTGTGCCAGGG - Intergenic
987156684 5:15096451-15096473 ACCCAGTGGATCCCGCACCAGGG + Intergenic
987283810 5:16436605-16436627 ACCCAGTGGATCCCGCACCAGGG - Intergenic
987488742 5:18551632-18551654 GCCTAGTGGATCCTGTGCCAGGG + Intergenic
988020449 5:25614502-25614524 GCCTAGTGGATCCTGTGCCAGGG + Intergenic
990510897 5:56488089-56488111 GCCTAGTGGATCCCGCACCAGGG - Intergenic
992802910 5:80309926-80309948 GCCTAGTGGATCCCGTGCCAGGG + Intergenic
992947525 5:81824138-81824160 ACCCAGTGGATCCCGCACCAGGG - Intergenic
993005408 5:82423798-82423820 GCCTAATGGATGCCGGGCCCTGG - Intergenic
993678529 5:90847453-90847475 ACCCAGTGGATCCCGCACCAGGG + Intronic
994701625 5:103141970-103141992 ACCCAGTGGATCCCGCACCAGGG + Intronic
995549701 5:113268579-113268601 GCCTAGTGGATGGAGGGGCAGGG - Intronic
995678976 5:114695847-114695869 GCCTAGTGGATCCCGTGCCAGGG - Intergenic
996746992 5:126854445-126854467 GCCTAGTGGTTGCGGTGCCAGGG + Intergenic
997624896 5:135324906-135324928 GCCTAGTGGATGCAGGTGCAGGG + Intronic
998395267 5:141814218-141814240 ACCCCATGGATGCTGGGCCATGG + Intergenic
999827590 5:155288867-155288889 GGCCAGTGGCTGTAGGGCCAGGG + Intergenic
1000329110 5:160193832-160193854 ACCCAGTGGATCCCGCACCAGGG + Intronic
1000568649 5:162882896-162882918 GCCTAGTGGATCCCGTGCCAGGG - Intergenic
1001655086 5:173343199-173343221 GCCCTTTGGATGCCAGGCCTCGG + Intergenic
1001906691 5:175478878-175478900 GCCCACGGGATGCTGGGCCTCGG - Intronic
1002140137 5:177133221-177133243 GCCCAGTGGATGGGGAGCCTGGG + Intronic
1003896946 6:10616995-10617017 ACCCAGTGGATCCCGCACCAGGG + Intronic
1005712085 6:28512211-28512233 AGCCAGTGGATGCCGCACCACGG - Intronic
1006097656 6:31666010-31666032 CCGCGGTGGATGCCGGGACACGG - Exonic
1006255575 6:32829663-32829685 GCCCAGTGGGAGGAGGGCCATGG + Intronic
1006645287 6:35511306-35511328 GCACAGTGGATGCAGGGAGATGG - Intronic
1007815930 6:44525557-44525579 TTCCAGTGGAAGCCAGGCCAGGG - Intergenic
1008631039 6:53363385-53363407 CCCCAGTGGATCCTGTGCCAGGG + Intergenic
1008844913 6:55950732-55950754 GCCTAGTGGATCCCATGCCAGGG - Intergenic
1009470345 6:64024159-64024181 ACCCAGTGGATCCCGCACCAGGG - Intronic
1011129249 6:84037414-84037436 GCCTAGTGGATCCCACGCCAGGG + Intronic
1011246597 6:85326393-85326415 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1011931880 6:92723904-92723926 GCCTAGTGGATGCCGCGCCCAGG - Intergenic
1012131370 6:95497367-95497389 GCCTAGTGGATCCCGCGCCGGGG - Intergenic
1013639592 6:112060129-112060151 GACCACAGGATGCAGGGCCATGG + Intronic
1014088299 6:117373226-117373248 GCCTAGTGGATCCTGTGCCAGGG + Intronic
1015600425 6:134905155-134905177 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1020662123 7:10995489-10995511 ACCCAGTGGATCCCGCACCAGGG + Intronic
1024056196 7:45661126-45661148 CCCCAGTGGATGCAGGCCCCTGG + Intronic
1024335555 7:48202848-48202870 ACCCAGTGGATCCCGCACCAGGG + Intronic
1025962001 7:66231296-66231318 GCCCAGTGGATCCCGCACCGGGG + Intronic
1026972678 7:74477711-74477733 GCTCAGTGGTTGCAGGGGCATGG + Intronic
1027667459 7:81057418-81057440 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1029515309 7:101019891-101019913 GCCTATGGGCTGCCGGGCCAGGG + Intergenic
1033664026 7:143424333-143424355 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1035297585 7:157875952-157875974 GCCCTGGGGATGCCTGGCCTGGG - Intronic
1036039642 8:5060963-5060985 TCCCTGTGAATGCCGGGCCACGG + Intergenic
1036400382 8:8402470-8402492 GCCCAGTGCAGGCCAAGCCATGG + Intergenic
1036554589 8:9847735-9847757 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1036952448 8:13154176-13154198 CCCTAGTGGATCCCGTGCCAGGG + Intronic
1037263768 8:17036753-17036775 ACCCAGTGGATCCCGCACCAGGG + Intronic
1037738076 8:21582687-21582709 GCCCAGTGGATGCTGGGGAGTGG - Intergenic
1037758267 8:21725389-21725411 GCCCAGTGAATGCCCAGCCTGGG + Intronic
1039892933 8:41696816-41696838 GCCAGCTGGATGCCGTGCCAGGG + Intronic
1040003617 8:42599992-42600014 GCCTAGTGGATCCCACGCCAGGG + Intergenic
1040723202 8:50350343-50350365 ACCCAGTGGATCCCGCACCAGGG - Intronic
1041275951 8:56157468-56157490 GCCGGGCGGACGCCGGGCCAGGG - Intergenic
1042838701 8:73101908-73101930 TCACAGAGGATGCAGGGCCACGG + Intronic
1043102164 8:76060388-76060410 ACCCAGTGGATCCTGTGCCAGGG + Intergenic
1044788762 8:95824064-95824086 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1045678355 8:104632901-104632923 GCCCAGTGGATGACCACCCAAGG - Intronic
1046288983 8:112133117-112133139 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1046445416 8:114311775-114311797 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1046450785 8:114386580-114386602 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1047973203 8:130104111-130104133 ACCCAGAGCATGCCGGGCCCTGG - Intronic
1049376209 8:142290309-142290331 GCCCTCTGGCTGCCGTGCCAGGG - Intronic
1049799639 8:144511826-144511848 GCTCTGTGGATGCAGTGCCACGG - Intronic
1051314103 9:15810334-15810356 GCCTAGTGGATCCCATGCCAGGG + Intronic
1051549707 9:18315314-18315336 GCCTAGTGCATCCCGCGCCAGGG + Intergenic
1053137867 9:35662958-35662980 GCTCAGTGGACGCCAGGCAAAGG - Exonic
1054155060 9:61634337-61634359 GCCCCGTGGACGCCCAGCCAAGG - Intergenic
1055102494 9:72480175-72480197 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1056219381 9:84436052-84436074 ACCCAGAGGATGTCGGGCCTTGG - Intergenic
1056576599 9:87859671-87859693 GCCCAGTGGACACCTGGCCACGG - Intergenic
1057210925 9:93200637-93200659 GCCCAGAGGATGCCGGAGCATGG + Intronic
1059529953 9:115026693-115026715 GCCCTGTGGATGACAGGCAAGGG + Exonic
1060533942 9:124367775-124367797 GCACAGGAGATGCTGGGCCACGG + Intronic
1060594155 9:124838669-124838691 ACCCAGTGGATCCCGCACCAGGG + Intergenic
1061283105 9:129608666-129608688 GCCCTGTAGATGCAGGGCCAAGG - Intergenic
1185431669 X:14834-14856 GCCCAGTGGAGGGCGGCACATGG + Intergenic
1185440993 X:227553-227575 GCCCAGTGGAGGGCGGCACATGG + Intergenic
1185860506 X:3574358-3574380 GCCAGGTGCATGCAGGGCCACGG + Intergenic
1187073165 X:15908720-15908742 GGCAAGTGGACTCCGGGCCAGGG + Intergenic
1189209907 X:39276004-39276026 ACCCAGTGGATCCCGCACCAGGG - Intergenic
1192727611 X:73768966-73768988 GCCCTGTGGGAGCCAGGCCATGG - Intergenic
1193803965 X:85972295-85972317 ACCCAGTGGATCCCGCACCAGGG + Intronic
1194340371 X:92699422-92699444 GCCTAGTGGATCCCGCACCAGGG + Intergenic
1197608015 X:128607048-128607070 ACCCAGTGGATCCCGCACCACGG - Intergenic
1200519631 Y:4195384-4195406 GCCTAGTGGATACTGCGCCAGGG + Intergenic
1200648740 Y:5816174-5816196 GCCTAGTGGATCCCGCACCAGGG + Intergenic
1201556375 Y:15267677-15267699 GCCCAGTGGATCCCACACCAGGG - Intergenic
1201728952 Y:17185543-17185565 GCCTAGTGGATCCCATGCCAGGG + Intergenic