ID: 1168464266

View in Genome Browser
Species Human (GRCh38)
Location 19:56589401-56589423
Sequence ACCACCTGCTGCTCTGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168464255_1168464266 10 Left 1168464255 19:56589368-56589390 CCCAGGAGAGCTTATAGCCACCC No data
Right 1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG No data
1168464256_1168464266 9 Left 1168464256 19:56589369-56589391 CCAGGAGAGCTTATAGCCACCCC No data
Right 1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG No data
1168464254_1168464266 16 Left 1168464254 19:56589362-56589384 CCAGGTCCCAGGAGAGCTTATAG No data
Right 1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG No data
1168464258_1168464266 -10 Left 1168464258 19:56589388-56589410 CCCCCAAGTCACCACCACCTGCT No data
Right 1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG No data
1168464257_1168464266 -7 Left 1168464257 19:56589385-56589407 CCACCCCCAAGTCACCACCACCT No data
Right 1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168464266 Original CRISPR ACCACCTGCTGCTCTGGTAG GGG Intergenic