ID: 1168465896

View in Genome Browser
Species Human (GRCh38)
Location 19:56600957-56600979
Sequence GAACCACCTGTGGCCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168465896_1168465911 30 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465911 19:56601010-56601032 CTCACACTCAAGGAGGGATCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1168465896_1168465908 23 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465908 19:56601003-56601025 TCCAGCACTCACACTCAAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
1168465896_1168465902 -9 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465902 19:56600971-56600993 AGGTGGTTCTGGGGCATCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 238
1168465896_1168465903 -8 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465903 19:56600972-56600994 GGTGGTTCTGGGGCATCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 208
1168465896_1168465907 20 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465907 19:56601000-56601022 CAGTCCAGCACTCACACTCAAGG 0: 1
1: 0
2: 1
3: 29
4: 230
1168465896_1168465910 24 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465910 19:56601004-56601026 CCAGCACTCACACTCAAGGAGGG No data
1168465896_1168465905 -6 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465905 19:56600974-56600996 TGGTTCTGGGGCATCTCAGGGGG 0: 1
1: 0
2: 0
3: 22
4: 210
1168465896_1168465904 -7 Left 1168465896 19:56600957-56600979 CCCAAAGAGGCCACAGGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1168465904 19:56600973-56600995 GTGGTTCTGGGGCATCTCAGGGG 0: 1
1: 0
2: 0
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168465896 Original CRISPR GAACCACCTGTGGCCTCTTT GGG (reversed) Intronic
900679879 1:3910903-3910925 GAACCACCCTTGGCCGCCTTAGG + Intergenic
900835724 1:5002364-5002386 GAACCTGGTGTTGCCTCTTTGGG + Intergenic
900999967 1:6144017-6144039 GACCCACCTGTGGCCCCAGTAGG + Exonic
902187105 1:14733778-14733800 GAACCACCTGCGAGCTGTTTGGG + Intronic
903138108 1:21322431-21322453 GAAACACCAGTGGGTTCTTTGGG + Intronic
907394382 1:54179061-54179083 GGACCAGCTCTAGCCTCTTTTGG - Intronic
907825439 1:58012377-58012399 GACACCCCTGTGGCCTCTTCAGG + Intronic
909017257 1:70393572-70393594 GAAACAGCTGTGGGCTATTTGGG + Intergenic
909895609 1:81065605-81065627 GAACCTCCTGTGGCCAATTGTGG - Intergenic
914348299 1:146818349-146818371 GAACCAACTGTTGCCTCTTGAGG - Intergenic
915008512 1:152663228-152663250 GAAGCTCCCGAGGCCTCTTTGGG + Intergenic
915050330 1:153063737-153063759 TAACCACCTCTGGTCTCTTGTGG - Intergenic
915051420 1:153078250-153078272 TAGCCACCTCTGGTCTCTTTTGG - Intergenic
915053309 1:153100999-153101021 TAGCCACCTCTGGTCTCTTTTGG - Intronic
915662827 1:157417942-157417964 TCCCCACCTGTGGCCTCTTAGGG - Intergenic
917195903 1:172465547-172465569 GCACCACCTGTGCCCTCCTCAGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
917914784 1:179690358-179690380 GAAGCACTTATGGGCTCTTTGGG + Intronic
918308588 1:183269204-183269226 GTACTAGCTGTGGCCTCATTGGG - Intronic
918311282 1:183287324-183287346 TCACCACCTGCGGCCTCTTTGGG + Intronic
923369925 1:233299640-233299662 GTACCACCTGTGGCCGCTGCAGG - Intergenic
923566206 1:235077728-235077750 GAACCAAGTGTGGTCTCCTTAGG - Intergenic
923918224 1:238533251-238533273 GAACCAACAGTGGGCTTTTTTGG + Intergenic
1066226590 10:33389535-33389557 GAACCTCCAGTAGCCTCTTCTGG + Intergenic
1069170570 10:65223818-65223840 AAAACACCTGTGTCCACTTTGGG + Intergenic
1070794002 10:79206479-79206501 ATACCACCTGTGGCCTCTGAGGG + Intronic
1071990911 10:91100128-91100150 GAGCCACCTGTTGCCTTTTAGGG - Intergenic
1072620743 10:97077541-97077563 GCACCAACTGATGCCTCTTTGGG + Intronic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1074637093 10:115332037-115332059 GAACCACCTGAGGCCACCTATGG - Intronic
1079361351 11:19773047-19773069 GAAACACCAGTGGCACCTTTTGG + Intronic
1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG + Intronic
1083102524 11:60323872-60323894 TAACCACCTCTGACCTCCTTTGG - Intergenic
1088439433 11:109852720-109852742 GAATCACCCATGGCCTCTTTTGG - Intergenic
1089392940 11:118114435-118114457 GAGCCACCTGTGGCTTCCATGGG + Intronic
1092442000 12:8512682-8512704 GAAGGACCTGTGGCATCTGTGGG - Intronic
1098750575 12:74288700-74288722 GGACCAACTCTGGCCTGTTTTGG + Intergenic
1098834360 12:75403589-75403611 GGAACATCAGTGGCCTCTTTGGG + Intronic
1098975861 12:76901456-76901478 GAATTACCTGTGGGCTTTTTAGG - Intergenic
1103267470 12:119643177-119643199 GCGCCACCTCTGGCCTCTCTGGG - Intergenic
1103890513 12:124235268-124235290 GAACCACTTGTGGCACCCTTAGG - Intronic
1104613389 12:130248646-130248668 CTACCACCTGTGGGCTCTCTGGG - Intergenic
1105240404 13:18603237-18603259 GAACCACCTGAGGCATGTTAAGG + Intergenic
1106013728 13:25848464-25848486 GAAACACGTGTGGCCTCACTGGG + Intronic
1106733657 13:32567920-32567942 GAACTACATATGGCTTCTTTAGG - Intergenic
1107072496 13:36286334-36286356 CAACCACCTTCTGCCTCTTTTGG + Intronic
1107497278 13:40939455-40939477 GAATCAGCTGTGGCCACTGTAGG + Intronic
1109781370 13:67114346-67114368 GAACCAATTTTAGCCTCTTTGGG + Intronic
1111637221 13:90920584-90920606 GAACCTCCTGTGATTTCTTTGGG + Intergenic
1115455850 14:33601470-33601492 GGACTACCTATGTCCTCTTTTGG - Intronic
1116529278 14:45947639-45947661 GAAGCACTTGTGGGCCCTTTGGG + Intergenic
1117088842 14:52229102-52229124 GTACCACCTGTGGCCTATCAAGG + Intergenic
1118590537 14:67397594-67397616 TTCCCACCTCTGGCCTCTTTGGG - Intronic
1118638009 14:67765898-67765920 GAACCACCTTTAGTCTCTGTGGG - Intronic
1119130678 14:72169824-72169846 GCACCACCTGAGAACTCTTTAGG + Intronic
1120772889 14:88400544-88400566 CCACCACATGTGGCCTCTGTTGG - Intronic
1122046461 14:99027433-99027455 GAACAACCTGTGGACTGTATTGG - Intergenic
1123209085 14:106741357-106741379 GAACCACCAGGGGGCTCTTAGGG - Intergenic
1123490822 15:20780843-20780865 GAACCACCTGAGGCATGTTAAGG - Intergenic
1123547324 15:21349934-21349956 GAACCACCTGAGGCATGTTAAGG - Intergenic
1127940827 15:63694044-63694066 GTACTACATATGGCCTCTTTCGG - Exonic
1128456508 15:67834484-67834506 CAACCACCTGGAGCCTGTTTGGG + Exonic
1129834348 15:78692523-78692545 GAACCTCCTTTGCCCTCTTTTGG - Intronic
1132415912 15:101618809-101618831 AAACCACAAGAGGCCTCTTTTGG + Intergenic
1202955655 15_KI270727v1_random:77165-77187 GAACCACCTGAGGCATGTTAAGG - Intergenic
1132649198 16:1012881-1012903 GAACCACCTGCGGCCAGTATGGG - Intergenic
1135058747 16:19253202-19253224 GGGCCACCTATGGCCTCTATTGG - Intronic
1139985738 16:70897196-70897218 GAACCAACTGTTGCCTCTTGAGG + Intronic
1141072711 16:80972824-80972846 GGACCATCTGTGTCCTCTTAGGG - Exonic
1141872658 16:86798837-86798859 GAACCTCCTCTGGCTTCTATGGG + Intergenic
1142787397 17:2234910-2234932 AAATGACCTGTGGCTTCTTTAGG - Intronic
1148442333 17:47717826-47717848 GACCCACCTGTGCCCACTGTGGG - Intergenic
1153926882 18:9842331-9842353 GACCATCCTGTGGCCTCTTCAGG - Intronic
1154448425 18:14455536-14455558 GAACCACCTGAGGCATGTTAAGG - Intergenic
1156371475 18:36475172-36475194 GAACCACCTGTGGGCTTCTGGGG - Intronic
1157233018 18:45936941-45936963 GAACTACCAGTTGCCTGTTTAGG - Intronic
1160224867 18:77004922-77004944 GAAGCTCCCGTGGCCTCCTTTGG + Intronic
1164485336 19:28650912-28650934 TAAGCACCTGTGGGCTGTTTTGG - Intergenic
1164796122 19:31032220-31032242 GCATCACCAGTGGCCTCTCTGGG + Intergenic
1165930243 19:39353105-39353127 GAAGCAGCTGCTGCCTCTTTGGG + Intronic
1168465896 19:56600957-56600979 GAACCACCTGTGGCCTCTTTGGG - Intronic
1168481912 19:56727273-56727295 GATCCACCTGTGTCCTCATCTGG - Intergenic
926469898 2:13241401-13241423 CAACCACATGTGACCTCTTCTGG + Intergenic
926576642 2:14589703-14589725 CAACCATCTTTGTCCTCTTTAGG - Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
937273360 2:120669374-120669396 GAACCACCAGGGACCTCTCTTGG - Intergenic
938031732 2:128000267-128000289 GAACCACCTGTGTACTTTGTTGG - Intronic
939865172 2:147464503-147464525 GTACCCTCTGTGGACTCTTTGGG - Intergenic
939987632 2:148846835-148846857 TAACCACCTCTGCCCTTTTTTGG + Intergenic
940724121 2:157315524-157315546 TAAACCCCTTTGGCCTCTTTTGG + Intergenic
946176417 2:217924574-217924596 GAGGCACCTGTGGCCACTTGTGG + Intronic
947670825 2:231934389-231934411 CCACCACCTGTGGCCGTTTTCGG + Intergenic
1170029727 20:11932203-11932225 GAAACACATATGGCCTCTTGAGG + Intergenic
1171911609 20:30965435-30965457 GAGCCACTTGTGGCCTATTTTGG - Intergenic
1180869916 22:19140214-19140236 GTACCACCTGAGGGCTCTCTGGG - Intronic
1183166199 22:36148893-36148915 GGACTCCATGTGGCCTCTTTTGG + Intronic
1184843176 22:47064328-47064350 GAACCACAAGTGGCCTCCTGTGG - Intronic
954930998 3:54281161-54281183 GAATCACCTGTGGACACTGTCGG - Intronic
954963849 3:54592587-54592609 GAACCTCCTGTGGTCTGTCTTGG + Intronic
955920154 3:63946901-63946923 GAACAAACTGTGGCCTTGTTAGG + Intronic
957119247 3:76068445-76068467 GAACACACTGTGGCCTCTTAGGG - Intronic
960088067 3:113611782-113611804 GAAACACGTGTTGCCTGTTTTGG + Intronic
960872949 3:122268389-122268411 GCAACTCCTTTGGCCTCTTTGGG - Intronic
964209714 3:154213504-154213526 GAAGCACCTTTGGTTTCTTTAGG + Intronic
964673930 3:159256582-159256604 GGAACACCAGTGGCCTCTCTGGG + Intronic
968698914 4:2045597-2045619 GGATCCCCTGTGGCCTGTTTGGG + Intergenic
971849529 4:31966203-31966225 GAAGCACATGTAGCCTCTTGAGG + Intergenic
973117505 4:46479351-46479373 GAACCACCTGTTTCCTGTGTAGG - Intergenic
974718090 4:65697772-65697794 TAACCCTCTGTGGCCCCTTTGGG + Intergenic
975536845 4:75460075-75460097 GAACCAAGTGTGGCTTCTTTAGG - Intergenic
976469271 4:85408484-85408506 CAATCTCCTGTGGCCTCTTCTGG - Intergenic
980592740 4:134912536-134912558 GAACCTGCTGGGGCATCTTTAGG + Intergenic
980746715 4:137026952-137026974 GAATCACATGAGACCTCTTTTGG + Intergenic
981415567 4:144488818-144488840 GTACCACCTGAGGCATCTGTGGG + Intergenic
986075317 5:4330870-4330892 GGATCACCTGTGGCCTCTCTTGG - Intergenic
989223304 5:38994498-38994520 GAACGAACAGTGGCCTCTATCGG - Intronic
995970245 5:117960659-117960681 TAGCCACCTGTGCTCTCTTTTGG - Intergenic
997369995 5:133353458-133353480 GGAACGCCTGGGGCCTCTTTTGG - Intronic
999919973 5:156306991-156307013 TAACCACCTGTGGTGTTTTTTGG + Intronic
1017781736 6:157720746-157720768 GCCCTGCCTGTGGCCTCTTTAGG + Intronic
1018179136 6:161205318-161205340 GAATGCCCTGTGTCCTCTTTGGG - Intronic
1020241909 7:6401731-6401753 GAACCACCTGAAGCCTCCGTGGG + Intronic
1027904977 7:84167182-84167204 GAACCACATGTGACCTTTCTAGG - Intronic
1027994619 7:85409770-85409792 AAAGCACCTGTGGCCTCAGTTGG + Intergenic
1032752544 7:134856125-134856147 GATCCTCCTTTTGCCTCTTTTGG + Intronic
1036049006 8:5174744-5174766 GAGCCACGTGTGGCCTCTGAAGG - Intergenic
1038202585 8:25428452-25428474 AAACCACCTGTGTCTCCTTTGGG - Exonic
1041602856 8:59742182-59742204 GGACCTGCTGTGGCTTCTTTTGG + Intergenic
1048544725 8:135376172-135376194 GCAACACATGTGGCCTCTTGAGG + Intergenic
1058724538 9:107789410-107789432 GACCCACCTGTCTCCTCATTAGG + Intergenic
1060218938 9:121754415-121754437 GAACCACTTGGGGCCTCCCTGGG + Intronic
1060267856 9:122122596-122122618 TCAGCACCTGTGCCCTCTTTGGG - Intergenic
1187679228 X:21750047-21750069 GAACCACCACAGGCCTCCTTAGG - Intronic
1189356602 X:40314347-40314369 GAACCAGATGGGGACTCTTTGGG + Intergenic
1189604937 X:42667040-42667062 TAACCAACTGTAGCCTGTTTGGG - Intergenic
1195486124 X:105408435-105408457 AAACCACCTGTGTCTCCTTTGGG + Intronic
1197068186 X:122259745-122259767 AAGCCACCTGTGTTCTCTTTTGG + Intergenic
1198495602 X:137189367-137189389 GCTCCACCTGTGACTTCTTTGGG - Intergenic
1200225113 X:154412850-154412872 GATCCACCTGTGACATCTATAGG - Intronic