ID: 1168467331

View in Genome Browser
Species Human (GRCh38)
Location 19:56613754-56613776
Sequence CCCTCCTTACAGAGGCGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168467331_1168467336 -2 Left 1168467331 19:56613754-56613776 CCTCCACGCCTCTGTAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 195
Right 1168467336 19:56613775-56613797 GGCCCTGCGATGAGCGGATGTGG 0: 1
1: 0
2: 0
3: 6
4: 90
1168467331_1168467342 30 Left 1168467331 19:56613754-56613776 CCTCCACGCCTCTGTAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 195
Right 1168467342 19:56613807-56613829 TACAGGAATCAGTGACGTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 88
1168467331_1168467340 13 Left 1168467331 19:56613754-56613776 CCTCCACGCCTCTGTAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 195
Right 1168467340 19:56613790-56613812 GGATGTGGGTTTCCTCTTACAGG 0: 1
1: 0
2: 0
3: 8
4: 110
1168467331_1168467335 -8 Left 1168467331 19:56613754-56613776 CCTCCACGCCTCTGTAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 195
Right 1168467335 19:56613769-56613791 AAGGAGGGCCCTGCGATGAGCGG 0: 1
1: 0
2: 0
3: 17
4: 145
1168467331_1168467337 -1 Left 1168467331 19:56613754-56613776 CCTCCACGCCTCTGTAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 195
Right 1168467337 19:56613776-56613798 GCCCTGCGATGAGCGGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168467331 Original CRISPR CCCTCCTTACAGAGGCGTGG AGG (reversed) Intronic
901733717 1:11298854-11298876 CCCTCCTGACGGAGGCGAGGAGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
902981192 1:20124590-20124612 CCCGCCTTACTGTGGGGTGGGGG + Intergenic
911331371 1:96529470-96529492 CCCTCCCATCAGAGGCCTGGAGG + Intergenic
911855370 1:102869340-102869362 CCCTCCTATCACAGGCTTGGAGG - Intergenic
912907133 1:113718842-113718864 CCCTCCCTTCACAGGCCTGGAGG - Intronic
913208499 1:116563795-116563817 CCCTCCTATCACAGGCCTGGAGG - Intronic
915710984 1:157897486-157897508 CCCTCCTATCACAGGCCTGGAGG - Intronic
918752507 1:188290185-188290207 CCCTCCTATCACAGGCCTGGAGG - Intergenic
918787019 1:188775959-188775981 CCCTCCTCTCATAGGCCTGGAGG + Intergenic
919233528 1:194807353-194807375 CCCTCCCATCAGAGGCCTGGAGG + Intergenic
920266934 1:204730973-204730995 TCCTCCCCACAGAGGGGTGGTGG - Intergenic
921909063 1:220528213-220528235 TCCTCCTGACTGAGGCGCGGCGG + Intronic
922947832 1:229531786-229531808 CACTCCTCTCAGAGGAGTGGTGG - Intronic
1065289944 10:24219861-24219883 CCATGATTGCAGAGGCGTGGTGG - Exonic
1065343689 10:24727909-24727931 TCCTCTTTCCAGATGCGTGGGGG - Intergenic
1066083204 10:31952691-31952713 TCCTGCTGACAGAGGGGTGGTGG + Intergenic
1066460401 10:35608044-35608066 CCCTCCGTGCACGGGCGTGGTGG + Exonic
1068874887 10:61985336-61985358 CCCTCTTTAAAGAGGGATGGTGG + Intronic
1070545881 10:77452128-77452150 TCCTCCTTCCAGAGGCCAGGTGG - Intronic
1073776277 10:106789215-106789237 CCCTCCTATCAGAGACTTGGAGG - Intronic
1073942347 10:108713339-108713361 CCCTCCTATCACAGGCCTGGAGG + Intergenic
1074852136 10:117447465-117447487 AACTCCCTACAGAGGGGTGGGGG - Intergenic
1075977103 10:126705483-126705505 TCCTCCTTACAGAAGTGAGGTGG - Intergenic
1079320452 11:19447515-19447537 CCCACCTCACAGAGGTTTGGGGG + Intronic
1081422762 11:42891114-42891136 TCCTGCTGACAGAGGGGTGGTGG - Intergenic
1082615022 11:55349233-55349255 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1083101143 11:60307258-60307280 CCTTCCTCACAGAAGAGTGGGGG + Intronic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1085588174 11:77731563-77731585 CCCTCCTATCACAGGCCTGGAGG + Intronic
1088427000 11:109714992-109715014 CCCTCCCATCAGAGGCCTGGAGG - Intergenic
1088953169 11:114590596-114590618 CCCTCCCTACAGAGGGGCTGAGG - Intronic
1089692412 11:120195115-120195137 CCTTTCTTACAGAGTTGTGGAGG + Intergenic
1091453089 12:585857-585879 GCCTCCATCCAGGGGCGTGGAGG + Intronic
1092193417 12:6535510-6535532 CCCTCCCCGCAGAGGTGTGGTGG + Intronic
1093596796 12:20972345-20972367 CCCTTCAAACAGAGGCCTGGAGG + Intergenic
1094613652 12:32017049-32017071 ACCTCTTTTCAGAGGGGTGGGGG + Intergenic
1097133456 12:56831454-56831476 TCCTGCTGACAGAGGGGTGGGGG + Intergenic
1099371320 12:81834907-81834929 CCCTTCTTTCACAGGCCTGGGGG + Intergenic
1099898717 12:88681369-88681391 CTCTCCTATCAGAGGCCTGGTGG + Intergenic
1100700449 12:97141885-97141907 TCCTCCTTTCAGAGTCCTGGTGG + Intergenic
1102020059 12:109676004-109676026 ACCTCCTTAGATAGACGTGGTGG + Intergenic
1104041504 12:125134109-125134131 CCCACCTTCCAGAGGCATGGGGG + Intronic
1104795197 12:131512270-131512292 CCCTCCCTGCAGAGGCCTGCTGG - Intergenic
1105841830 13:24260359-24260381 AGCTCCTTACAGAGGCCTGGAGG - Intronic
1107788896 13:43981198-43981220 CCCTCCTGTCAGAGCAGTGGCGG - Intergenic
1111151023 13:84253820-84253842 TCCTGCTGACAGAGGGGTGGTGG - Intergenic
1111323738 13:86664193-86664215 CCCTCCCAACACAGGCTTGGAGG - Intergenic
1113465223 13:110507921-110507943 CCCTCCTTCCACAGGGCTGGCGG + Exonic
1113465321 13:110508448-110508470 CACTCCTTACAAAGGCCTGGTGG - Intronic
1114268763 14:21088855-21088877 CCCAGGTCACAGAGGCGTGGTGG - Exonic
1114531123 14:23397072-23397094 CCCTCCTGACACAGGGGTGATGG - Exonic
1115019153 14:28653865-28653887 CTCTCCTCACAGAGGGGTGTGGG + Intergenic
1118461794 14:65993980-65994002 CCCTCATGGCAGAGGCCTGGAGG + Intronic
1121322913 14:93003020-93003042 CCCTCCTCACAGAGGCCCTGTGG - Intronic
1121721606 14:96112780-96112802 TCCTGCTGACAGAGGGGTGGTGG + Intergenic
1123458211 15:20444647-20444669 CCCTCCTAACTGAGGTCTGGTGG - Intergenic
1123458240 15:20444755-20444777 CCCTCCTAACTGAGGTCTGGTGG - Intergenic
1123458255 15:20444809-20444831 CCCTCCTAACTGAGGTCTGGTGG - Intergenic
1123659811 15:22555600-22555622 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1123659826 15:22555654-22555676 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1123659856 15:22555762-22555784 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1124104931 15:26729105-26729127 GCCCACTTGCAGAGGCGTGGGGG - Intronic
1124264500 15:28220818-28220840 CCCTCCTAACTGAGGTCTGGTGG - Intronic
1124264515 15:28220872-28220894 CCCTCCTAACTGAGGTCTGGTGG - Intronic
1124264545 15:28220978-28221000 CCCTCCTAACTGAGGTCTGGTGG - Intronic
1124313672 15:28650095-28650117 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1124313687 15:28650149-28650171 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1124313717 15:28650257-28650279 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1124691443 15:31826505-31826527 CCCTCCTATCACAGGCCTGGAGG - Intronic
1126480564 15:49114743-49114765 CCCTCCTCAGCCAGGCGTGGTGG - Intronic
1128559106 15:68652863-68652885 CCCACCTTACAGAGGTTTAGAGG + Intronic
1129715336 15:77845215-77845237 CCCTCCTATCACAGGCCTGGAGG + Intergenic
1130900986 15:88206727-88206749 CACTCCTTACAGTGGCCAGGCGG + Intronic
1132336432 15:101051203-101051225 ACCTCCTCTCAGAGGCGTGGGGG + Intronic
1132704473 16:1237169-1237191 CCCTCCTCCCAGAGGAGTGGAGG - Intergenic
1132707043 16:1249256-1249278 CCCTCCTCCCAGAGGGGTGGAGG + Intergenic
1132911934 16:2318228-2318250 CCCTCCTTTCAGAGTAGGGGAGG - Intronic
1133223778 16:4330524-4330546 CCCTCCCTGCAGAGGCCTAGAGG - Intronic
1136702703 16:32158051-32158073 CCCTCCTAACTGAGGTCTGGTGG - Intergenic
1136764982 16:32769491-32769513 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1136803117 16:33100893-33100915 CCCTCCTAACTGAGGTCTGGTGG - Intergenic
1138431372 16:56971245-56971267 GCCTCCTTCCAGCTGCGTGGTGG - Intronic
1203067353 16_KI270728v1_random:1031670-1031692 CCCTCCTAACTGAGGTCTGGTGG + Intergenic
1143456018 17:7068252-7068274 CCCTCCTATCACAGGCCTGGAGG - Intergenic
1143886551 17:10069186-10069208 CCCTCCTTAGAAAGGCCTGCTGG - Intronic
1151057440 17:71049565-71049587 TCCTCATTCCAGAGGGGTGGTGG - Intergenic
1151783266 17:76261750-76261772 CCATCCCCACAGAGGCGGGGAGG + Intergenic
1152291301 17:79441579-79441601 AACTCCTTCCAGAGGCTTGGAGG - Intronic
1153426919 18:4975128-4975150 CCCTCCTATCACAGGCCTGGAGG - Intergenic
1155260670 18:24039110-24039132 CCCACCTTACAGGTGCATGGGGG - Intronic
1159717925 18:71849053-71849075 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1160220357 18:76972484-76972506 CCCTCCCTACACAGGCATCGGGG + Intergenic
1162448839 19:10742156-10742178 CCCTCCTGCCAGAGACTTGGGGG + Intronic
1165947103 19:39450224-39450246 CCCTCCTTAGCTAGGCATGGGGG - Intronic
1168467331 19:56613754-56613776 CCCTCCTTACAGAGGCGTGGAGG - Intronic
925516671 2:4690775-4690797 CCCTTCTAACACAGGCCTGGAGG - Intergenic
926391912 2:12402630-12402652 CCCTCCTATCACAGGCCTGGAGG + Intergenic
927033820 2:19150962-19150984 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
928466519 2:31527747-31527769 CCCTCCTCACAGAGTCTAGGAGG + Intronic
928836940 2:35558891-35558913 CCCTCCTATCAAAGGCCTGGAGG + Intergenic
931628972 2:64282658-64282680 CTCTCCTTCCACAGGCCTGGGGG - Intergenic
933998219 2:87685594-87685616 CCATGTTTTCAGAGGCGTGGAGG - Intergenic
936051045 2:109223728-109223750 CTTTCCTTGCAGAGCCGTGGAGG + Intronic
936295631 2:111265279-111265301 CCATGTTTTCAGAGGCGTGGAGG + Intergenic
937465304 2:122127215-122127237 CCCTCCTATCACAGGCCTGGAGG + Intergenic
937800560 2:126076720-126076742 CCCTCCTATCATAGGCCTGGAGG + Intergenic
937881313 2:126866828-126866850 CCCTCCTATCACAGGCCTGGAGG - Intergenic
938212268 2:129478565-129478587 CTCTCCTTACAGAGAGGTGAAGG + Intergenic
943237989 2:185347517-185347539 CCCTCCTATCACAGGCCTGGAGG + Intergenic
946939690 2:224758084-224758106 CCCTCCTATCACAGGCCTGGAGG + Intergenic
947396638 2:229693950-229693972 CCCTCCTATCACAGGCCTGGAGG + Intronic
948623233 2:239250025-239250047 GCCTCCTTCCAGAGGCGGGAGGG - Intronic
1174414899 20:50360110-50360132 CACCCCTTACAGAGCCTTGGGGG - Intergenic
1175279366 20:57793065-57793087 CCCGCCTTGCTGAGGGGTGGCGG - Intergenic
1175381595 20:58567777-58567799 CCTTCTTTAGAGAGGGGTGGGGG - Intergenic
1175774325 20:61643489-61643511 CCCTCTCTCCAGAGGTGTGGTGG - Intronic
1178127073 21:29527045-29527067 CCCTCCTATCACAGGCCTGGAGG - Intronic
1178684773 21:34702346-34702368 GCCTCCATGCAGAGGCGTGGGGG + Intronic
1179017619 21:37606697-37606719 CCCTCTCTACCGAGGCGTGCAGG - Intergenic
1179936638 21:44610283-44610305 CCCTCCCATCAGAGGCCTGGAGG + Intronic
1181165309 22:20980008-20980030 CTCTCCTTGCAGAGGCGACGAGG + Exonic
1183579049 22:38712302-38712324 CCATTCTCACAGAGGCATGGAGG + Intronic
1183618074 22:38956933-38956955 CCCTTCTGACAGGGGGGTGGGGG + Intronic
1184143766 22:42596090-42596112 CCCACCTCACAAAGGCGTTGTGG + Intronic
1185240442 22:49740364-49740386 CCCTCCCTTCACAGGCCTGGAGG + Intergenic
950146031 3:10650637-10650659 CCCTCCTATCACAGGCTTGGAGG + Intronic
950557009 3:13702137-13702159 CCCACCTTGGAGAGGCATGGTGG - Intergenic
952141115 3:30480268-30480290 CCCTCCTATCACAGGCCTGGAGG + Intergenic
952831456 3:37568345-37568367 CCCTCCTATCACAGGCCTGGAGG - Intronic
958065900 3:88544785-88544807 CCCTCCTATCACAGGCCTGGAGG + Intergenic
960564452 3:119118534-119118556 CCCTCCCATCAGAGGCCTGGAGG - Intronic
960942491 3:122943757-122943779 CCCTCCCCACAGAGGCATGAAGG + Intronic
961068009 3:123892432-123892454 CCCTCCTATCACAGGCCTGGAGG - Intergenic
963671563 3:148258273-148258295 CCCTCCTATCATAGGCCTGGAGG + Intergenic
965066581 3:163857834-163857856 CCCTCCTATCACAGGCCTGGAGG + Intergenic
966972765 3:185060795-185060817 CCCTCCCAACACAGGCCTGGAGG + Intergenic
969692218 4:8710032-8710054 CTCTCCCTACACAGGCGTGGAGG - Intergenic
971193081 4:24446268-24446290 CCCTCCTAACAGATGTGAGGTGG + Intergenic
971948641 4:33315138-33315160 CCCTCCCAACACAGGCCTGGAGG + Intergenic
972847113 4:43004006-43004028 CCCTCATAACATAGGCCTGGAGG + Intronic
973005138 4:44996177-44996199 TCCTGCTGACAGAGGGGTGGTGG - Intergenic
974733562 4:65899974-65899996 CCCTCCCTTCACAGGCCTGGAGG + Intergenic
976842323 4:89445797-89445819 CCCTCCCATCAGAGGCCTGGAGG - Intergenic
978360052 4:107921874-107921896 ACCTCCTTTCAGATGAGTGGTGG - Intergenic
980644318 4:135622494-135622516 TCCTGCTGACAGAGGGGTGGTGG + Intergenic
982215973 4:153082893-153082915 CCATCCTGACCGAGGTGTGGGGG - Intergenic
986496286 5:8344790-8344812 CCCTCCTATCACAGGCCTGGAGG - Intergenic
986601514 5:9477936-9477958 CCCTCCTATCACAGGCCTGGAGG + Intronic
986798057 5:11231830-11231852 CCCTCCCTTCACAGGCATGGAGG + Intronic
987216619 5:15744047-15744069 CCCTCCCTTCACAGGCCTGGAGG - Intronic
987509350 5:18815518-18815540 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
989434634 5:41397185-41397207 CCCTCCTATCACAGGCCTGGAGG + Intronic
990213764 5:53508322-53508344 CCCTCCCTTCACAGGCCTGGAGG - Intergenic
994100287 5:95884015-95884037 CTTTTCTTACTGAGGCGTGGAGG - Intergenic
995667234 5:114555464-114555486 CCCTCCTATCAGAGGTCTGGAGG - Intergenic
997088365 5:130827248-130827270 CCCTCCTATCACAGGCCTGGAGG - Intergenic
998135085 5:139670206-139670228 CCCTCCCTGCAGAGGCGTGGGGG - Intronic
1001181706 5:169526442-169526464 CCCTCCTATCACAGGCCTGGAGG - Intergenic
1002279634 5:178122805-178122827 CCCTCCCTCCATAGGAGTGGGGG + Exonic
1002373964 5:178775208-178775230 CCCACCTTCCGGAGGCCTGGGGG - Intergenic
1003920060 6:10824597-10824619 CTCTCCATACAGATGGGTGGAGG + Intronic
1005286416 6:24332353-24332375 CCTTCCTTACAGAATGGTGGTGG - Intronic
1007600098 6:43076191-43076213 CCCTCCTCGCCGAGGCGGGGAGG - Intergenic
1008508103 6:52250617-52250639 CCCTAATTACCCAGGCGTGGCGG + Intergenic
1008711880 6:54237271-54237293 CCCTGCTTTCTGAGGGGTGGAGG + Intronic
1009637073 6:66280362-66280384 CCCTCCCATCAGAGGCCTGGAGG + Intergenic
1011914695 6:92488873-92488895 CCCTCCATAGAGAAGCGTGTTGG + Intergenic
1012141454 6:95631434-95631456 CCCTCCCAACACAGGCCTGGAGG + Intergenic
1012254391 6:97015786-97015808 CCCTCCCATCAGAGGCATGGAGG + Intronic
1013688045 6:112609077-112609099 CCCTCCTACCACAGGCCTGGAGG + Intergenic
1016139731 6:140594146-140594168 CCCTCCTATCATAGGCCTGGAGG + Intergenic
1016977859 6:149826611-149826633 CCCTTCTCCAAGAGGCGTGGTGG - Intronic
1017907895 6:158769362-158769384 CCCTCCTGGAAGAGGCGCGGAGG - Exonic
1022644635 7:32218907-32218929 CCCTCCTCACAGAGCTGTGCTGG + Intronic
1022909187 7:34883424-34883446 CCCTCCTAACACAGGCCTGGAGG - Intergenic
1023558647 7:41449526-41449548 CCCTACTTCCAGTGGGGTGGGGG - Intergenic
1024557086 7:50613254-50613276 CCCTCCTCTCAGTGGCCTGGGGG - Intronic
1025015691 7:55437257-55437279 CCCTCCTTACAGCTACGAGGCGG - Intronic
1027666437 7:81047034-81047056 CCCTCCTATCACAGGCCTGGAGG + Intergenic
1028011428 7:85649024-85649046 CCCTCCTATCACAGGCCTGGAGG - Intergenic
1031170854 7:118290690-118290712 CCCTCCTGTCACAGGCCTGGAGG + Intergenic
1034904849 7:154934775-154934797 CCCTCCTATCACAGGCCTGGAGG - Intronic
1037415778 8:18648713-18648735 CCCTCCTATCACAGGCCTGGAGG + Intronic
1044611675 8:94098087-94098109 CCCTCCACTCAGAGGCCTGGAGG - Intergenic
1046387872 8:113526739-113526761 TCCTGCTGACAGAGGGGTGGTGG - Intergenic
1047373323 8:124274080-124274102 CCCTTATTAAAGAGGCCTGGGGG + Intergenic
1048813881 8:138312864-138312886 CCCTCATTACTGCGGGGTGGTGG - Intronic
1049724345 8:144138543-144138565 CCCTGCGTACAGAGGAGTCGGGG - Exonic
1051582768 9:18695163-18695185 CCCTCCTATCACAGGCCTGGAGG - Intronic
1051925170 9:22316786-22316808 CCCTCCTGTCACAGGCCTGGAGG + Intergenic
1054909677 9:70442782-70442804 CCCTCCTTTCAAAGAGGTGGAGG - Intergenic
1055778330 9:79790880-79790902 CCCTTCTTTCAGAGACGTGCTGG - Intergenic
1059333071 9:113548679-113548701 CCCTCCTCATACAGGCGAGGAGG + Intronic
1059581776 9:115556664-115556686 CCCTCCTATCACAGGCCTGGAGG - Intergenic
1060431105 9:123552177-123552199 CCCTCCTTACAGAGCCAGGCAGG + Intronic
1061677977 9:132229120-132229142 CCCTCCTTCCTGGGGCTTGGGGG - Intronic
1062518662 9:136948245-136948267 CCCTGCAGTCAGAGGCGTGGAGG - Intronic
1188115642 X:26239107-26239129 CCCTCCTGTCACAGGCCTGGAGG - Intergenic
1189025406 X:37388683-37388705 CCCTCCTATCACAGGCCTGGAGG - Intronic
1194624617 X:96213574-96213596 CCCTCCTGTCACAGGCTTGGAGG - Intergenic
1194688746 X:96956351-96956373 CCCTCCTATCACAGGCCTGGAGG - Intronic
1196706306 X:118720520-118720542 CCCTCCTTGGAGAGGTGTTGTGG + Intergenic
1196809186 X:119615060-119615082 CTTTCCTTACAGAGGCCTGGAGG - Intergenic
1196903578 X:120410170-120410192 CCCTCCTATCACAGGCCTGGAGG - Intergenic
1197265243 X:124362307-124362329 GCCACCTTACAGAGCTGTGGGGG + Intronic
1198966836 X:142236765-142236787 CCCTCCCATCAGAGGCCTGGAGG + Intergenic