ID: 1168468127

View in Genome Browser
Species Human (GRCh38)
Location 19:56620317-56620339
Sequence AGTGAAATGAGAGAAAAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 839
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 755}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168468127_1168468135 19 Left 1168468127 19:56620317-56620339 CCCGATTTTTCTCTCATTTCACT 0: 1
1: 0
2: 2
3: 81
4: 755
Right 1168468135 19:56620359-56620381 CCAAACACACAGGAAGCCAGTGG 0: 1
1: 0
2: 4
3: 48
4: 355
1168468127_1168468132 9 Left 1168468127 19:56620317-56620339 CCCGATTTTTCTCTCATTTCACT 0: 1
1: 0
2: 2
3: 81
4: 755
Right 1168468132 19:56620349-56620371 CTGCCTTTGGCCAAACACACAGG 0: 1
1: 0
2: 2
3: 17
4: 180
1168468127_1168468129 -4 Left 1168468127 19:56620317-56620339 CCCGATTTTTCTCTCATTTCACT 0: 1
1: 0
2: 2
3: 81
4: 755
Right 1168468129 19:56620336-56620358 CACTTCCAGTTTCCTGCCTTTGG 0: 1
1: 0
2: 2
3: 34
4: 557
1168468127_1168468136 20 Left 1168468127 19:56620317-56620339 CCCGATTTTTCTCTCATTTCACT 0: 1
1: 0
2: 2
3: 81
4: 755
Right 1168468136 19:56620360-56620382 CAAACACACAGGAAGCCAGTGGG 0: 1
1: 0
2: 2
3: 29
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168468127 Original CRISPR AGTGAAATGAGAGAAAAATC GGG (reversed) Intronic
900766449 1:4509246-4509268 AAGCAAATGAGAGAAAAAACGGG - Intergenic
901244996 1:7723201-7723223 GGGGAAATGAGAGATGAATCTGG + Intronic
901411525 1:9087654-9087676 AGTGAAACAAGAGAAAAGACAGG - Intronic
902101334 1:13992385-13992407 AGAGTAAAGAGAGAAGAATCTGG - Intergenic
902191523 1:14766483-14766505 AGAGAAAAGAAAGAAAAATATGG + Intronic
902465591 1:16615849-16615871 AGTTACATGAGAGAAATTTCTGG + Intergenic
902602543 1:17550100-17550122 AGTGGAATAGGAGAAAAGTCTGG + Intronic
903482085 1:23661103-23661125 AGTGAAACAATAGAAAAAACTGG - Intergenic
904336610 1:29802083-29802105 AAAGAAATGGGAGAATAATCAGG - Intergenic
905078008 1:35291554-35291576 AGGGAAAAGAAAGAAAAAGCTGG - Intronic
905628652 1:39506152-39506174 AGTAAAATTAGAGAAAAGTCTGG + Intronic
906650175 1:47507732-47507754 AGGGAAATCAGAGAAACATTTGG - Intergenic
906802219 1:48748322-48748344 AGTGAAAGCAGAGACAAATCTGG + Intronic
906876013 1:49540189-49540211 AGAGTAAAGAGAGAATAATCTGG - Intronic
907257504 1:53190953-53190975 AGAGAAATGAGAGATCACTCTGG + Intergenic
907697359 1:56745650-56745672 AATAAAATGTGAGATAAATCGGG - Intronic
908533916 1:65060576-65060598 AATGAAATGAGAGAAAAATAAGG - Intergenic
908660426 1:66429180-66429202 AGGCAAATGAAACAAAAATCTGG - Intergenic
908820049 1:68077001-68077023 AGATAAATGAAAGAAAAAGCTGG - Intergenic
909098573 1:71321445-71321467 AGATAAATGAAACAAAAATCTGG + Intergenic
909362050 1:74772412-74772434 AGTAAAATGAAAGAAATATTGGG + Intergenic
909667123 1:78147140-78147162 AGTTAATTGTGAGAAAGATCAGG - Intergenic
909848230 1:80425522-80425544 AATTAAATGAGAGAAAAGTATGG + Intergenic
909868552 1:80707297-80707319 AGAGAAATGGGAAAAAAGTCAGG + Intergenic
909929668 1:81481593-81481615 AGTTAAATGAGATGAAAATGAGG - Intronic
909932612 1:81514932-81514954 AGTGAAATGATAGAAAAACAAGG + Intronic
910481770 1:87666368-87666390 AGAGCACTGAGAGAAAAATATGG - Intergenic
910735612 1:90453035-90453057 ATTGAATCGACAGAAAAATCTGG - Intergenic
910762975 1:90753316-90753338 AGTGATATCAAAGAAAAATAAGG + Intergenic
910981686 1:92964661-92964683 AGGGAAAAGAGAGAATGATCTGG + Intergenic
911151446 1:94600233-94600255 AATGAGATGAGAGAAAAAACTGG + Intergenic
911232576 1:95376675-95376697 AGTCAAATAAGACAAAAATTAGG + Intergenic
911243594 1:95491960-95491982 TGTGAAATGAGAGCAATAGCTGG + Intergenic
911885702 1:103296467-103296489 AGGGAAATGAGAAGAAAATGAGG + Intergenic
911991315 1:104700330-104700352 AATGAAATGAATGAAACATCAGG - Intergenic
912082960 1:105960323-105960345 AGTGAAATCAGAGATAAAAGAGG - Intergenic
912116007 1:106409019-106409041 AGTGAAGTGTGAGAAATAACTGG + Intergenic
912157997 1:106946036-106946058 AGTGTACTCTGAGAAAAATCTGG - Intergenic
912232481 1:107811435-107811457 AAGCAAATGAGGGAAAAATCTGG + Intronic
912611941 1:111056712-111056734 AGATAAATGAAACAAAAATCTGG - Intergenic
913014632 1:114720538-114720560 AGTGGAATGTGTGAAAGATCAGG - Exonic
913284563 1:117214666-117214688 GGAGACATGAGGGAAAAATCTGG - Intergenic
915423260 1:155802396-155802418 AGTGAAAAAAGAGAAAACTCTGG + Intronic
916225897 1:162489346-162489368 AGTGAAATGAAAGCAAAGTAAGG + Intergenic
916412834 1:164563290-164563312 TGTGAAATCAAAGAAAAAACAGG + Exonic
916550321 1:165843869-165843891 AGTGATATAAGAAAAAAATAAGG - Intronic
917113833 1:171581140-171581162 AATTAAATGAGAGTAAAATGAGG - Intronic
917461836 1:175237630-175237652 AGAGAAATGAAACAAAAACCTGG + Intergenic
917754643 1:178087119-178087141 AGAGACATCAGAGAAACATCTGG - Intergenic
917951985 1:180048007-180048029 AGTAAAATGTTAGAATAATCTGG - Intronic
917955501 1:180092742-180092764 AGGAAAATCAGAGAAGAATCTGG + Exonic
918320546 1:183360105-183360127 AGTGAAATGATACAGAAATAAGG - Intronic
918364386 1:183790972-183790994 AGGAAAATGGGAGAAGAATCAGG + Intronic
918577673 1:186082599-186082621 AGAGAAATGGGAGAATAATTTGG + Intronic
918771382 1:188565207-188565229 AGTTAAATGAAAGATAATTCTGG + Intergenic
918887453 1:190213752-190213774 ATTGAAATGAGAGAGAAAGGAGG + Intronic
919006432 1:191904534-191904556 AGTCAAATGTGAGAAAACACAGG - Intergenic
919073163 1:192781665-192781687 AGAGAAATGAAACAAAAAGCTGG - Intergenic
919521640 1:198596700-198596722 AATGATATGGGAAAAAAATCAGG + Intergenic
920776857 1:208947139-208947161 AGTAGAAAGAGAGAGAAATCAGG + Intergenic
921323794 1:213970678-213970700 AGTGAAATGAAAGCAAACTTTGG - Intergenic
921699831 1:218256059-218256081 TGTGAAATATGAGCAAAATCTGG + Intergenic
922828917 1:228540788-228540810 ATTGTAATGATAGAGAAATCTGG - Intergenic
923050166 1:230385762-230385784 TGTGAAATGGGGGCAAAATCAGG - Intronic
923393986 1:233542799-233542821 AGAGAAATGGGATAAATATCAGG + Intergenic
923824384 1:237483803-237483825 AGTGAAATGTCAGTGAAATCTGG + Intronic
924131289 1:240911261-240911283 AATGAAATGAGAGAAAGAGATGG - Intronic
924563161 1:245173757-245173779 AGAGAAAGGAGAGAAAAAGGTGG - Intronic
924620576 1:245657092-245657114 AGTGAAAAGAAAGAAAAGTGAGG - Intronic
924829987 1:247583363-247583385 AGATAAATGAGACAAAAATCTGG + Intergenic
1063135442 10:3212666-3212688 AGTGAAAAAAGTGAAAACTCAGG - Intergenic
1063824434 10:9878329-9878351 AGAGAAAAGAGAGAAAGATGGGG - Intergenic
1064828865 10:19439232-19439254 AGTTAAAAGAGAGAAGAAGCTGG + Intronic
1064866121 10:19882459-19882481 AGTGAAGTTTGAAAAAAATCGGG + Intronic
1064910617 10:20397867-20397889 GGTGAAATGATAGAAAATTTCGG + Intergenic
1065492440 10:26295305-26295327 AATAAAATTGGAGAAAAATCAGG - Intronic
1065492996 10:26301562-26301584 AGAGAAAGGAAAAAAAAATCTGG - Exonic
1066049928 10:31623853-31623875 AATGAAATCAGAGAAACATTTGG + Intergenic
1066978869 10:42392869-42392891 AGTGAAATGACAGAAAAGATGGG + Intergenic
1068353013 10:55873873-55873895 AGTGCATAAAGAGAAAAATCTGG - Intergenic
1068387228 10:56347030-56347052 AGTGATATGAGAGGAAAAAAGGG + Intergenic
1068566102 10:58577241-58577263 AGTGGAATGAGAGAACAATGAGG + Intronic
1068607696 10:59024408-59024430 AGGGAAATCAGAGAAACACCAGG + Intergenic
1069133972 10:64741186-64741208 AGTGATATCAGATAAAACTCCGG + Intergenic
1069194783 10:65537557-65537579 AGTCAAGTGAGAGCCAAATCAGG + Intergenic
1070465159 10:76714525-76714547 AGATAAATGAAACAAAAATCTGG + Intergenic
1071921901 10:90359910-90359932 AGTAAAATGTGGCAAAAATCAGG - Intergenic
1072041116 10:91607933-91607955 AGTGAGAAGAGATAAAAACCTGG - Intergenic
1072187557 10:93055573-93055595 TGTGAAAGGAGGGAAAAATGTGG + Intronic
1072199530 10:93145747-93145769 AGTGAAATGTGGGAAAAGCCTGG + Intergenic
1073219232 10:101855921-101855943 ACTGGATTGAGAGAAAATTCTGG - Intronic
1073411420 10:103345293-103345315 AGTGAAATGAGAGGCAAGCCTGG + Intronic
1073831112 10:107384634-107384656 AGTGAAAAAAGAGGAAAAACAGG - Intergenic
1073852326 10:107635217-107635239 AGTGATATGAGAGGGAAAACAGG - Intergenic
1074071433 10:110073668-110073690 AGCAAAATGACAGAAAAATAGGG - Intronic
1075432143 10:122394768-122394790 TGTGAAGAGAGAGAAAAATCAGG - Intronic
1075522670 10:123153208-123153230 TGTGAAGTGAGAGAAAATTGTGG - Intergenic
1077238221 11:1494552-1494574 AATGAAAGGAGAAAAAAATATGG + Intronic
1077602771 11:3585013-3585035 ACTTAAATGAGAGAGAAAACAGG + Intergenic
1077680485 11:4236102-4236124 AATGAAATGAGAGAAAGAATGGG - Intergenic
1077684766 11:4281520-4281542 AATGAAATGAGAGAAAGAATGGG - Intergenic
1077690425 11:4336410-4336432 AATGAAATGAGAGAAAGAATGGG + Intergenic
1078028321 11:7721295-7721317 AATGAAATGGGAGAAAAGGCTGG - Intergenic
1078706893 11:13752514-13752536 AGATAAATGAGACAAAAAGCTGG + Intergenic
1079105210 11:17567365-17567387 AGTGAAATGACAGAATGATCAGG - Intronic
1079193485 11:18302803-18302825 AGTCAAAGGAGAAAAAAAGCGGG + Intronic
1079290805 11:19186138-19186160 GGAGGAATGAGAGAAAAATTGGG - Intronic
1080486478 11:32713170-32713192 AGTGAAATGGAAAAAATATCAGG + Intronic
1080672270 11:34391999-34392021 AGATAAATGAAACAAAAATCTGG - Intergenic
1080858642 11:36133914-36133936 ACTGAAAGCTGAGAAAAATCTGG + Intronic
1080943249 11:36943005-36943027 AGTGAAATGTGAGAAAAGATTGG + Intergenic
1081193440 11:40132519-40132541 AGCAAAATGAAAGAAAATTCTGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081518354 11:43856627-43856649 AATGAAATGAGAGGAAAAAAGGG - Intergenic
1083002139 11:59302237-59302259 AGTGAAAGGAGAGAAGAAAATGG + Intergenic
1083033222 11:59613619-59613641 ACTTGAATGAGAGAAAAATCTGG + Intronic
1084021242 11:66419670-66419692 GGTGAAAAGAGAAAAAAAGCGGG + Intergenic
1084142592 11:67242975-67242997 AGGGAAAAGAAGGAAAAATCAGG - Intronic
1084258656 11:67959542-67959564 ACTTAAATGAGAGAGAAAACAGG + Intergenic
1084814087 11:71635638-71635660 ACTTAAATGAGAGAGAAAACAGG - Intergenic
1085815109 11:79728595-79728617 ACTGAAAAAAGAGAAAACTCAGG - Intergenic
1086353661 11:85969984-85970006 AGTGAAATGAGAGATTAAGGAGG + Intronic
1086388537 11:86336256-86336278 AGTGTAATGAGAGTAACATATGG + Intronic
1086525225 11:87716831-87716853 AGTGAGATTAGAGAAAGATAAGG - Intergenic
1086723023 11:90145113-90145135 AATGAAATGGGAGAAAAACTTGG + Intronic
1086892080 11:92270215-92270237 AGTGAAGTGGGAGGAAAACCAGG - Intergenic
1087294490 11:96354861-96354883 AGTGAAATGAGAGAGGATCCTGG + Intronic
1087313511 11:96578067-96578089 AGTGAACTGAGATTAAAACCAGG + Intergenic
1087567492 11:99880036-99880058 AGTGAACGGGGAGAAAAACCTGG - Intronic
1087942027 11:104109249-104109271 AGTGAAAGTTTAGAAAAATCAGG + Intronic
1087993534 11:104775865-104775887 AGTGAAAAGTGAGATAAATAAGG + Intergenic
1088057666 11:105604765-105604787 AGTGACTTGAGAGAAGAATGAGG + Intergenic
1088108957 11:106239162-106239184 AGTAAGAGGAGAAAAAAATCAGG - Intergenic
1088141926 11:106627687-106627709 AGTGGAATGAGAGAATTTTCTGG - Intergenic
1088232077 11:107683463-107683485 TGTGAGAAGAGAGAAAAAGCTGG + Intergenic
1088525724 11:110751774-110751796 AGATAAATGAAAGAAAAAGCTGG - Intergenic
1089568155 11:119383459-119383481 AGTGAAGAGAGAGAAAGATAGGG + Intergenic
1090634738 11:128683882-128683904 AGGGATGGGAGAGAAAAATCGGG + Intergenic
1090778360 11:129984686-129984708 AGGGAGATGGGAGAAAAATCAGG - Intronic
1091418684 12:315126-315148 AGTGGAATGAGAGAAAAAGAAGG + Intronic
1091497716 12:986919-986941 AGCAAAATGAGGGAGAAATCAGG - Intronic
1091954439 12:4626665-4626687 AATGAAATGAGAGGCACATCAGG - Exonic
1092034203 12:5316755-5316777 AGTCCCATGAAAGAAAAATCAGG - Intergenic
1092060135 12:5543004-5543026 AGATAAATGAAAGAAAAAGCTGG - Intronic
1092076953 12:5681802-5681824 AGGGTAATGAGAGAAAAGTAGGG - Intronic
1092274938 12:7053330-7053352 ATGGAAATCAGAAAAAAATCAGG - Intronic
1092429991 12:8400551-8400573 ACTTAAATGAGAGAGAAAGCAGG + Intergenic
1093027229 12:14255988-14256010 AGTGAAAGGAGAGAGGAATAAGG + Intergenic
1093037800 12:14349518-14349540 AGTGAAATTATAGCAAAATTAGG + Intergenic
1093090911 12:14919331-14919353 TGCGAAATGAGAGACAGATCAGG + Intronic
1093134476 12:15433982-15434004 AGTGAAAGGACAGAAAATTTTGG - Intronic
1093338340 12:17937899-17937921 ATTGGAATCAGATAAAAATCAGG - Intergenic
1093672010 12:21888154-21888176 AGAAAAATGTCAGAAAAATCAGG + Intronic
1093798601 12:23344157-23344179 AGAAAGATGAGAGCAAAATCTGG - Intergenic
1093831971 12:23772177-23772199 AGAGAAATGGTAGAAATATCAGG + Intronic
1093852996 12:24063752-24063774 AATGAAATGGGAAAAAACTCTGG + Intergenic
1093919692 12:24845610-24845632 AATTAAATGAGGGAAAAATAAGG - Intronic
1093948666 12:25138900-25138922 AGATAAATGAAATAAAAATCTGG + Intronic
1095270761 12:40215817-40215839 ATTGAGAGGAGAGAAAAGTCGGG - Intronic
1095462017 12:42453533-42453555 AGTGAAATAATGGAAAAATTTGG + Intronic
1096140248 12:49237116-49237138 TGAGAAATAAGATAAAAATCCGG + Intronic
1096196597 12:49652561-49652583 AGTGAAATTAAAGCAAAATGAGG - Intronic
1096223127 12:49844721-49844743 AGTGAAACTAGAGAAACAGCAGG - Intergenic
1096780314 12:53987909-53987931 AGAGACAGGAGAGAAAATTCGGG + Intronic
1097904612 12:64906862-64906884 AGTGAAAAGTAAGAAGAATCAGG + Intergenic
1098127410 12:67313751-67313773 AACGGAATGAAAGAAAAATCTGG - Exonic
1098317965 12:69211993-69212015 AGTGGAGAGAGAGAGAAATCTGG - Intergenic
1098698134 12:73585199-73585221 AGTGACAGGAGAAAAAAATCAGG + Intergenic
1098862060 12:75721352-75721374 AATGAATTGAGAGAATATTCAGG + Intergenic
1099072263 12:78060099-78060121 AGTGAAGAGGGAGCAAAATCAGG - Intronic
1099203335 12:79700604-79700626 AAAGAAATGAGAGAGAAATAAGG - Intergenic
1099238699 12:80113937-80113959 AGTGAAAGGAAAAAAAAAGCAGG - Intergenic
1099635004 12:85202605-85202627 ATTGTAAACAGAGAAAAATCAGG - Intronic
1099695787 12:86016855-86016877 ATTAAAATGAGAGACAAATGTGG - Intronic
1099741827 12:86647476-86647498 ACTGAGAAAAGAGAAAAATCAGG - Intronic
1099861448 12:88229395-88229417 AGTTAAATGAGAGAGAAAAAGGG - Intergenic
1100122624 12:91386401-91386423 AATAAAGTGAGAGTAAAATCAGG + Intergenic
1100417020 12:94388650-94388672 AGTGAAAAGAGAAAATAATTTGG + Intronic
1100662739 12:96717768-96717790 ATTGAAATGTTAGAAATATCTGG + Intronic
1100822826 12:98447581-98447603 AGTGAAAAGTGAGAAAAGGCTGG - Intergenic
1100951572 12:99856111-99856133 AGATAAATGAGACAAAAAGCTGG + Intronic
1101782600 12:107849081-107849103 AGTGAAGTGAGAGAAAAGATGGG - Intergenic
1101809260 12:108093485-108093507 ATTGAAATCAGGGAAAAACCTGG + Intergenic
1101988076 12:109462755-109462777 AGGGAATTCACAGAAAAATCTGG - Intronic
1102251325 12:111389531-111389553 AGTGACATAGGAGAAAAACCAGG + Intergenic
1102522490 12:113487303-113487325 AGTCAAATGATAGAAAACTGGGG - Intergenic
1103185549 12:118953980-118954002 AGTGAAATGAGGGAACACTTGGG - Intergenic
1103196651 12:119049389-119049411 AATGAAATTAGAGAAATAACAGG + Intronic
1104809246 12:131610690-131610712 AGAGAAATGGGAGGAAAACCAGG - Intergenic
1105721134 13:23115819-23115841 AGTGAAATGGAAGGAAAATTAGG - Intergenic
1105908542 13:24837876-24837898 AGATAAATGAAAGAAAAAGCTGG + Intronic
1106174776 13:27320887-27320909 AGTGAAGTAGGAGAAAAATCAGG + Intergenic
1106872348 13:34035604-34035626 ACAGAAATGAGAGAAGAAACAGG - Intergenic
1106897256 13:34317023-34317045 AGTGAGATGGGAGAAAACACAGG + Intergenic
1107371425 13:39754101-39754123 AATGAAATGGGAGGAAAATTAGG - Intronic
1107580975 13:41785205-41785227 AGTCATATGAGAAAAAAATGAGG - Intronic
1108898573 13:55366927-55366949 AGTGAAATTTGAGAAAACTCAGG - Intergenic
1109567310 13:64133952-64133974 AGATAAATGAAACAAAAATCTGG - Intergenic
1109595264 13:64544700-64544722 ATTGTAATGAGAAAAAACTCAGG + Intergenic
1109720587 13:66270603-66270625 AATGAAATGAAAAAAAAAACGGG + Intergenic
1110396165 13:75031894-75031916 AATGCAATGAGAAAAAAATAAGG - Intergenic
1110485316 13:76034478-76034500 AGAGAGATGAGGGAAAAGTCTGG - Intergenic
1110669763 13:78163599-78163621 TGTGAAATAAGAGAGAAATACGG + Intergenic
1110838130 13:80108690-80108712 TGTGAAATGAGAGAAAAAGTAGG - Intergenic
1111101737 13:83597121-83597143 ATGGAAATGAGAAAAAAAGCAGG - Intergenic
1111151280 13:84256475-84256497 AATGAAATGAGACAAAACTCCGG - Intergenic
1111323155 13:86656998-86657020 AGTTAAGTGAGAGAAAAGTAAGG - Intergenic
1111554565 13:89863425-89863447 AGTGGAATGAGAGGAAAAGATGG - Intergenic
1111961173 13:94812318-94812340 GGTGAATGGAGAGAAATATCAGG - Intergenic
1112710849 13:102127198-102127220 AGTAAAAAGAGAGAAAAAACTGG + Intronic
1112875223 13:104029434-104029456 AGCAAACTGAGAGACAAATCAGG + Intergenic
1112928486 13:104706111-104706133 AGTGAAATGAAACAAAAATTGGG - Intergenic
1113060631 13:106318930-106318952 TGTGAAATAGGAGAAAAATTAGG - Intergenic
1113189186 13:107724383-107724405 AAAGAAATAAGATAAAAATCAGG - Intronic
1113317060 13:109192110-109192132 ATAAAAATCAGAGAAAAATCAGG - Intronic
1113706583 13:112437531-112437553 AGTGAAAGAAGAAAAAAATGAGG - Intergenic
1114137763 14:19871499-19871521 AGTGAAAAGTGAAAAAATTCTGG + Intergenic
1114410064 14:22492531-22492553 AATGAGATGAAAGAAAATTCTGG + Intergenic
1114749956 14:25192783-25192805 AATGAAATGAGAGAAAGATGGGG + Intergenic
1114752553 14:25221675-25221697 AGTAAAATAGAAGAAAAATCTGG + Intergenic
1116394301 14:44429726-44429748 AGTGAAGTGAGAGAAAAGACAGG - Intergenic
1116622026 14:47217302-47217324 AATGAAGTGATAGAAAAACCTGG + Intronic
1116962056 14:50976998-50977020 AGTTAAATAAAAGCAAAATCTGG + Exonic
1117068185 14:52031710-52031732 AGTGAAATGATAGAGAATCCAGG - Intronic
1117925815 14:60778171-60778193 AGTGAAATGACATTGAAATCTGG + Intronic
1118032418 14:61831699-61831721 ACTGAAGTGAAAGAAAAATCTGG - Intergenic
1118167752 14:63354944-63354966 AAAGAAATGAGAAAAAAGTCTGG + Intergenic
1118555957 14:67021992-67022014 AGAAGAGTGAGAGAAAAATCTGG - Intronic
1118596785 14:67441732-67441754 AGTGGAGTAAGGGAAAAATCAGG + Intergenic
1119582421 14:75798404-75798426 AGATAAATGAAACAAAAATCTGG - Intronic
1120219751 14:81718910-81718932 ATCGAAATGAGAAAAAAATATGG + Intergenic
1120533409 14:85662123-85662145 AATGAAATGAGTGAGAAATGAGG + Intergenic
1121479353 14:94249918-94249940 AAGGAAATGAGAGTCAAATCTGG + Intronic
1122621720 14:103061798-103061820 AGAAAAATGAGAGAGAGATCTGG + Intergenic
1202845642 14_GL000009v2_random:171269-171291 AGAGAAAGGAGAGACAAATATGG - Intergenic
1202915039 14_GL000194v1_random:161537-161559 AGAGAAAGGAGAGACAAATATGG - Intergenic
1123460458 15:20465620-20465642 AATAAAATGTTAGAAAAATCTGG + Intergenic
1123657604 15:22534796-22534818 AATAAAATGTTAGAAAAATCTGG - Intergenic
1123793197 15:23744672-23744694 ATTATAATGAGAGAAAAATAAGG - Intergenic
1124311514 15:28629994-28630016 AATAAAATGTTAGAAAAATCTGG - Intergenic
1125075397 15:35609690-35609712 GGTGAAAGGAGAGAAAATCCTGG - Intergenic
1125265664 15:37877832-37877854 AGAGAAATGAGAGATAAACTGGG - Intergenic
1125292230 15:38162777-38162799 AGTGAAATGACAGAGAAATGGGG + Intergenic
1125665101 15:41424151-41424173 AGTGGAATGAGAGAGAGATGAGG + Intronic
1125741810 15:41970507-41970529 AATATAATGAGAGAGAAATCTGG + Intronic
1126184413 15:45817460-45817482 AGATAAATGAAACAAAAATCTGG - Intergenic
1126244814 15:46492273-46492295 AGATAAATGAAACAAAAATCTGG + Intergenic
1126644025 15:50856979-50857001 AGGGAAATGAGAGAGGAAGCTGG + Intergenic
1127170502 15:56295780-56295802 AGTTAACTAAGGGAAAAATCCGG - Intronic
1127217693 15:56841750-56841772 AGTAAACTGAAAGATAAATCTGG + Intronic
1127633393 15:60847189-60847211 AAAGAAATGGGAAAAAAATCGGG + Intronic
1127984431 15:64058664-64058686 AGTGTCATGAAAGAAAAATATGG + Intronic
1127991745 15:64124109-64124131 AAGGAAATGAGAGACAACTCAGG - Intronic
1128773933 15:70304291-70304313 AGTGTATTGAGAGAAAAATTAGG + Intergenic
1128815605 15:70605914-70605936 AGTGAAATAAGTGAAAGGTCTGG - Intergenic
1129143390 15:73623753-73623775 AGCTCAATGAGAGAAAAATATGG - Intronic
1129225927 15:74170488-74170510 AGAGAAATGAGAGAGACACCAGG - Intergenic
1129479321 15:75810541-75810563 ACTGAAATGAGAGAAAGCTGGGG + Intergenic
1130323522 15:82859888-82859910 ATTAAAATGAGACAAAAACCCGG + Intronic
1130639520 15:85658379-85658401 TGTGGAATGAGAAAAACATCAGG - Intronic
1130779820 15:87024177-87024199 AGATAAATGAAACAAAAATCTGG + Intronic
1131042285 15:89281101-89281123 ACTGAAATAAAAGAAAAATACGG - Intronic
1131341037 15:91601118-91601140 AGTGAGGTGGAAGAAAAATCAGG - Intergenic
1131426517 15:92349700-92349722 AGTGAAATGAGAAAGAGATTTGG + Intergenic
1131874872 15:96794458-96794480 AATGAACTGAGACAAAAATGAGG - Intergenic
1132062627 15:98704902-98704924 TGTGAGAGGAGAGAAGAATCAGG + Intronic
1132607298 16:798941-798963 AGACAAATGAGAGGCAAATCAGG + Intronic
1133366209 16:5212332-5212354 ACTTAAATGAGAGAGAAAACAGG - Intergenic
1133554207 16:6889348-6889370 AGGGAAAAGAGAGCAAAATGAGG - Intronic
1133780177 16:8932620-8932642 AGAGAAAGAAAAGAAAAATCAGG + Intronic
1136030349 16:27498265-27498287 AATGAGCTGAGAGAAAACTCAGG - Intronic
1136054407 16:27677690-27677712 AGAGAGATGAGAGATAAATATGG - Intronic
1136124393 16:28167060-28167082 AGTGAAATGAGAGGAGAAGCAGG - Intronic
1136704863 16:32178803-32178825 AATAAAATGTTAGAAAAATCTGG + Intergenic
1136763052 16:32750604-32750626 AATAAAATGTTAGAAAAATCTGG - Intergenic
1136805048 16:33119782-33119804 AATAAAATGTTAGAAAAATCTGG + Intergenic
1136932264 16:34429779-34429801 AGATAAATGAGACAAAAACCTGG - Intergenic
1136972308 16:34982035-34982057 AGATAAATGAGACAAAAACCTGG + Intergenic
1138398033 16:56721793-56721815 AGGGACATGAGGGAAACATCAGG + Intronic
1139668223 16:68473068-68473090 AGTGAAGGGAGAGAGAACTCAGG - Intergenic
1139784248 16:69378458-69378480 AGCGAAAAAAGAGAAAAAACTGG + Intronic
1140028536 16:71314198-71314220 AGAGAGATGAGAGAAAGGTCTGG + Intergenic
1140058529 16:71546913-71546935 AGAGAAATGGAAGAAAAATTGGG - Intronic
1140192687 16:72831482-72831504 AGTTCAAACAGAGAAAAATCAGG + Intronic
1140581802 16:76239887-76239909 TTTGAAAAGAGATAAAAATCAGG - Intergenic
1141058562 16:80842176-80842198 AATGAAATCAGAAAAAAATGAGG + Intergenic
1141486245 16:84342181-84342203 AGAGAAATCAGAGGGAAATCTGG - Intergenic
1203065203 16_KI270728v1_random:1010926-1010948 AATAAAATGTTAGAAAAATCTGG - Intergenic
1143936884 17:10495347-10495369 AGGCACATGAGAGAAAAATTAGG + Intronic
1144087127 17:11820908-11820930 AGGGAAATAAGAGAAAAAATGGG - Intronic
1144214548 17:13043718-13043740 AGTGAAATGTAAGAAATATAAGG - Intergenic
1144394252 17:14828226-14828248 ATCGAAATGAGAGCAAACTCCGG + Intergenic
1147292585 17:39455903-39455925 ATTTAAAAGACAGAAAAATCAGG + Intergenic
1148022687 17:44563736-44563758 ATTGAACTGAGTGAATAATCTGG - Intergenic
1148209713 17:45800792-45800814 TGTGAAAGGAGAGAGAAAACAGG + Intronic
1149022691 17:51988076-51988098 AGGGAAATGAGGGAAGAATTGGG + Intronic
1149119742 17:53148091-53148113 AGTGAGATAAGAAAAGAATCAGG + Intergenic
1149160909 17:53691535-53691557 ACTGCAATTAAAGAAAAATCTGG - Intergenic
1149211001 17:54300963-54300985 AGTGTTATGAGAGAAAAATAAGG - Intergenic
1150035717 17:61794703-61794725 AATAAAATGAAAAAAAAATCAGG + Intronic
1151511832 17:74565542-74565564 TGTGAATTAAAAGAAAAATCTGG + Intergenic
1153960843 18:10138727-10138749 AGTCATATGGTAGAAAAATCTGG + Intergenic
1154085053 18:11295985-11296007 AGGGAAATAAGAGAAAAACATGG - Intergenic
1156526274 18:37770276-37770298 AGTGAAATGTGAGAGAAAAGAGG - Intergenic
1157171562 18:45411671-45411693 AGTGAGCTGAGAGGAAAATATGG + Intronic
1157233481 18:45941197-45941219 AGTGAAATGGTGGAGAAATCAGG + Intronic
1157442743 18:47722934-47722956 AGTGAGACTAGAGGAAAATCTGG - Intergenic
1158062340 18:53360531-53360553 ATTGAAATGAGAAAAAAAAGTGG + Intronic
1158657141 18:59347962-59347984 AGACAAATGAGAGAAAATCCTGG + Intronic
1158734058 18:60059618-60059640 AGTTAAATGAGAGAAAAAAAAGG - Intergenic
1158863930 18:61619361-61619383 AGTGAAGTGAGAGACAACACAGG - Intergenic
1159140726 18:64390738-64390760 AATGAAATGAGACAAAATTGAGG - Intergenic
1159465441 18:68776913-68776935 AGTGAAATGCGGGAAAAAAATGG - Intronic
1159639775 18:70849961-70849983 AGAGAGCTGAGAGAAAAATCAGG - Intergenic
1159851811 18:73534230-73534252 ACTGCAATGAGAGAAAAGTCAGG + Intergenic
1160164981 18:76502979-76503001 AGTGGAAAAACAGAAAAATCAGG + Intergenic
1161448444 19:4330647-4330669 AGGGAAATCAGAGGGAAATCAGG + Intronic
1163608681 19:18290148-18290170 TATGAAATGAGAGCAAAGTCAGG + Intergenic
1164070951 19:21767529-21767551 AGAGAAGTGAGAGCAAAACCTGG + Exonic
1164380454 19:27733280-27733302 AGTCTAATGATAGAAACATCTGG - Intergenic
1164381453 19:27740018-27740040 AGTCTAATGAGAGAGAAACCTGG - Intergenic
1165464326 19:35963846-35963868 AGGGAGATGAGAGAAAAGTGAGG + Intergenic
1165718503 19:38062589-38062611 AATAAAATGAGAGCAAAAACTGG - Intronic
1168026290 19:53646116-53646138 ATATAAATGAGAAAAAAATCTGG - Intergenic
1168468127 19:56620317-56620339 AGTGAAATGAGAGAAAAATCGGG - Intronic
925695756 2:6576735-6576757 AGTGAAGATAGAAAAAAATCAGG + Intergenic
926838210 2:17048205-17048227 AGTGAAAAGAGAGAAATATATGG - Intergenic
926962129 2:18369150-18369172 ACTGAAATGTGAGAAAAAAATGG - Intergenic
927080205 2:19620217-19620239 AGATAAATGAAACAAAAATCTGG + Intergenic
927428188 2:23004422-23004444 ATTGAAATGAAAGAAATATAAGG - Intergenic
927725536 2:25419621-25419643 TCAGAAATGATAGAAAAATCAGG + Intronic
927856356 2:26530161-26530183 ATTGGAAGGAGAGAAAGATCAGG + Intronic
927931494 2:27048525-27048547 AGTGATCTGAGAGAAAAAAAAGG + Intronic
928323268 2:30300684-30300706 AGGCAAAGGAGAGAAAAACCAGG + Intronic
928785174 2:34875475-34875497 TGTGAAATGACAGAAATATTTGG - Intergenic
928890093 2:36194826-36194848 ACTGAAATGAAGAAAAAATCTGG + Intergenic
929125334 2:38518404-38518426 TGGCAAATGAGGGAAAAATCAGG + Intergenic
929241794 2:39661020-39661042 AGTGAAATGAGAAACTTATCAGG + Intergenic
929428718 2:41869516-41869538 AGTGAAATGGAAGAAATATGAGG + Intergenic
929602505 2:43213154-43213176 AGGGAAGTGAGAGAAAAGACTGG + Intergenic
929677442 2:43951260-43951282 AGTAAAATAAGATAAAAATTAGG + Intronic
929722641 2:44386459-44386481 AGACAAATGAAAGAAAAAGCTGG - Intronic
929804575 2:45133348-45133370 AATTAAATGAGATAAAAAGCAGG + Intergenic
929806128 2:45146494-45146516 AGATAAATGAAAGAAAAAGCTGG + Intergenic
929817394 2:45244858-45244880 ACTGAAATTATAGAATAATCTGG - Intergenic
930820785 2:55644516-55644538 TGAGAAATGAGAGAAAGACCAGG - Intronic
930887947 2:56349663-56349685 AGGGAAATGAAAGTAAAATATGG + Intronic
931259307 2:60603360-60603382 AGTGAGATGACAGATAAATGAGG - Intergenic
931490032 2:62735403-62735425 AGTGACAGGAGAGAAGAATTAGG - Intronic
931524879 2:63142082-63142104 AGATAAATGAGACAAAAAGCTGG - Intronic
932256010 2:70287498-70287520 ATTCACATGAGAGAAAAAGCAGG - Intronic
932296917 2:70632398-70632420 AGTAAAAATAGAGAAAGATCTGG - Intronic
932738488 2:74273182-74273204 AGTTAGATAAGAGTAAAATCTGG + Intronic
933183128 2:79249711-79249733 AATAAAAAGAGAGTAAAATCAGG - Intronic
933720841 2:85396592-85396614 AGAGAAATCAGAGGAAAAACAGG - Intronic
934739763 2:96711775-96711797 AATAAAAAGAGAGATAAATCAGG + Intronic
935186107 2:100734393-100734415 AGTGACTTGTGAGACAAATCAGG + Intergenic
935829703 2:106988230-106988252 AGGGAGATGAAAGAACAATCTGG + Intergenic
936094513 2:109521572-109521594 AGTGAAAAGAGTGAAATCTCGGG - Intergenic
936473818 2:112822638-112822660 AGTGAGAAGAGAGAAACATCTGG - Intergenic
936911563 2:117598952-117598974 GGTGATATGAGAGTAAAATGTGG - Intergenic
937657939 2:124398407-124398429 ACGGAAAGGAGAGAAAAAGCAGG + Intronic
937663272 2:124455092-124455114 AGATAAATGAAACAAAAATCTGG + Intronic
938773719 2:134522789-134522811 AGACAAATGAGAGAAAAATGGGG - Intronic
938813656 2:134877638-134877660 AGTGATCTGAGAGAGAAATGGGG + Intronic
939400131 2:141682066-141682088 AGTAAAATAAGAGAAAAGTAAGG + Intronic
939439093 2:142219873-142219895 AGTGAAAAGAGAAAAAAAGAAGG - Intergenic
939679871 2:145117139-145117161 AGAGAAATGAGAAAAAAAGCAGG - Intergenic
940016413 2:149110866-149110888 AGTAAAAGGAGAGAACAATGGGG + Intronic
940400931 2:153246965-153246987 AATGAAAAGAGAAAAAAAGCAGG + Intergenic
940476143 2:154165767-154165789 AGTGAAATTAGACCAAGATCTGG + Intronic
941112725 2:161434181-161434203 AGAGAAAGGGGAGAAAAATATGG - Intronic
941201452 2:162516371-162516393 AGTGTAAGGAGAGACAAAGCAGG + Intronic
942107339 2:172645913-172645935 AGTGAAATGTTTTAAAAATCAGG - Intergenic
942967265 2:181911562-181911584 ATTAAAGTGAGAAAAAAATCTGG - Intronic
943223204 2:185136240-185136262 AGAGAAATGAGAGAAATGTGAGG - Intergenic
943838526 2:192547685-192547707 TGAGAAATGAGAAAAAAATATGG - Intergenic
944033262 2:195263005-195263027 AGAAATATGAGAGAAAAAGCTGG - Intergenic
944652879 2:201849338-201849360 AGTGAAAGAAGAGAACAATCGGG - Intronic
945075710 2:206037122-206037144 TGTGAAATGAGAGATACACCTGG + Intronic
945345142 2:208704452-208704474 AGACAAATGAGAGAAAGATCTGG - Intronic
945752295 2:213803309-213803331 AATGTAATGAGAGAATAATGAGG + Intronic
946034285 2:216729512-216729534 AGTGAAAGGAAAGATAAATTGGG + Intergenic
946675803 2:222157985-222158007 AATGAAATGAAAGTAAAATGTGG + Intergenic
947790279 2:232862556-232862578 AGAGACATGACAGAAAAAACTGG - Intronic
948166222 2:235864649-235864671 AGTGAAAGGAAAGAAAAACGAGG + Intronic
1169100730 20:2946283-2946305 AGGTAAATGGGAGAAAAATGGGG - Intronic
1169485125 20:6023816-6023838 AGTGAAATGCAATAAAAATGAGG - Intronic
1169545052 20:6641282-6641304 AGTGAAAAGGGAGAAAAAAGAGG + Intergenic
1169921486 20:10739106-10739128 AGTGAAATAATGTAAAAATCTGG + Intergenic
1169973100 20:11292195-11292217 AGTGCAATGAAAAAGAAATCTGG - Intergenic
1170197350 20:13703014-13703036 ATTCAAATGAGAGGCAAATCTGG + Intergenic
1170547368 20:17445883-17445905 AGAGAACTAAGAGAAAAGTCTGG + Intronic
1170985247 20:21251903-21251925 GGTGAAATGTGAGTAAAGTCTGG + Intergenic
1172006522 20:31822248-31822270 AGTTAAAAAAAAGAAAAATCAGG + Intronic
1172269410 20:33645343-33645365 AATCAAATGAGAAAAAAAACAGG - Exonic
1172815041 20:37679576-37679598 TGTTAAATGATAGAAAAATAAGG + Intergenic
1172858924 20:38032351-38032373 AGTGCAATAAGAGCAAAAGCAGG + Intronic
1173070274 20:39757757-39757779 TGTGAATTGACAGAAAAATCAGG + Intergenic
1173356233 20:42293426-42293448 AGTGAAGTAGGAGAAAAGTCTGG - Intronic
1174830133 20:53804862-53804884 AGTGAAATGCAACAAAATTCGGG - Intergenic
1174974938 20:55321574-55321596 AGTCACTTTAGAGAAAAATCTGG - Intergenic
1174975733 20:55331537-55331559 TGTGAAATCATAGAAAAACCTGG + Intergenic
1176634390 21:9176182-9176204 AGAGAAAGGAGAGACAAATATGG - Intergenic
1176638922 21:9278610-9278632 AGAGAAAGGAGAGACAAATATGG + Intergenic
1176910243 21:14556867-14556889 TGAGAAATGAAAGAAAGATCTGG + Intronic
1177124535 21:17180029-17180051 AGATAAATGAAAGAAAAACCTGG + Intergenic
1178177566 21:30120746-30120768 AGTGAAATGACAATGAAATCAGG - Intergenic
1178365909 21:31988637-31988659 AGAGAAAAGAGAGAAAAATGAGG - Intronic
1178866443 21:36331722-36331744 AATGAATTGTGAGTAAAATCAGG + Intronic
1179145192 21:38761935-38761957 AGTGAAAAGAGAGAAGAAAAGGG - Intergenic
1179235733 21:39543996-39544018 AGTAAAATGGGAGAAAAACGTGG + Intergenic
1179396847 21:41047998-41048020 AGGAAAAGGAGAGAAAAAGCTGG + Intergenic
1180372228 22:12051452-12051474 AGAGAAAGGAGAGACAAATATGG + Intergenic
1180390245 22:12224189-12224211 AGAGAAAGGAGAGACAAATATGG - Intergenic
1180415689 22:12710278-12710300 AGAGAAAGGAGAGACAAATATGG + Intergenic
1180422966 22:12886117-12886139 AGAGAAAGGAGAGACAAATATGG + Intergenic
1182497804 22:30722599-30722621 AGAGAAAAGAAAGAAAGATCAGG - Intronic
1182911732 22:33990099-33990121 AGTCAAGGGAGAGAAAAAGCTGG - Intergenic
1182956076 22:34427777-34427799 TCTGAATTGGGAGAAAAATCAGG + Intergenic
1183615729 22:38944155-38944177 AGTGAGATGAAAGAAAAAGAAGG - Intergenic
1184339487 22:43878430-43878452 AGTTAAATAAGATAAAAACCAGG + Intergenic
1184482290 22:44754871-44754893 AGTGAAATGAGGGTAAAATCAGG - Intronic
949207604 3:1458964-1458986 AATGATATGAGAGAAGAATAAGG - Intergenic
949283926 3:2379179-2379201 AGTGAAATAAAAGAAAAAATGGG - Intronic
949342388 3:3044131-3044153 AGAGAAAAGAGAGAAAAAGCAGG + Intronic
949651179 3:6161395-6161417 ATTAAAAAGAGAGAAAAATATGG - Intergenic
949668363 3:6368000-6368022 AGTGAAGTAAGAGAAAAACCAGG + Intergenic
949703733 3:6790666-6790688 GGAGAAATAAGAGAAGAATCTGG + Intronic
949855949 3:8461348-8461370 TGTGGAATGAGAGAAAAAGGGGG - Intergenic
950124257 3:10501886-10501908 AGTGAAATGGGTGAAAACCCAGG + Intronic
952097196 3:29967912-29967934 AGATAAATGAAACAAAAATCTGG - Intronic
952224790 3:31364471-31364493 AGAGAAATGAGGGAGAAATTAGG - Intergenic
952332901 3:32381199-32381221 AGAGAAAGGAGAGAAAAAAGTGG - Intergenic
952581886 3:34843730-34843752 AGAGAAGTGTGAGAAAAGTCAGG - Intergenic
952701328 3:36330958-36330980 ACTGATATGAGTCAAAAATCAGG - Intergenic
953002181 3:38946020-38946042 AGGGAAATGAGAAAAAGATATGG - Intronic
953276995 3:41511332-41511354 AGAGAAATGAAACAAAAAGCTGG + Intronic
953564564 3:44020574-44020596 ACACAAATGAGAGAAAAATTGGG - Intergenic
953942935 3:47117682-47117704 AGTGTAATTACAGAATAATCAGG + Intronic
954505013 3:51061774-51061796 AGTGAGGTGAGAGGAAAAGCAGG - Intronic
955102242 3:55861577-55861599 AGAGAAATGAAAAAAAAATTAGG - Intronic
955278981 3:57575573-57575595 AGTGAAATGACAGATAAACTAGG - Exonic
956399898 3:68866329-68866351 AGTGAGATTAGAGGCAAATCTGG + Intronic
956442127 3:69290704-69290726 AATTAAATGAGAGAACAATCGGG - Intronic
956614317 3:71156091-71156113 ACTTAATTGAGAGAGAAATCAGG + Intronic
957073613 3:75584057-75584079 ACTTAAATGAGAGAGAAAACAGG + Intergenic
957104136 3:75865293-75865315 ATTCAAATGAAAAAAAAATCAGG + Intergenic
957225499 3:77439752-77439774 AGGAAAATGAGAGGAAAATTGGG - Intronic
957337434 3:78849356-78849378 AATGAAATGAGAGATAAATTGGG - Intronic
957479481 3:80772918-80772940 TTTAAAATGAAAGAAAAATCTGG - Intergenic
957921487 3:86754239-86754261 AGTTAAATGAAACAAAAATATGG - Intergenic
958441988 3:94166181-94166203 AGTGAAGACAGAGAAAACTCTGG - Intergenic
958626393 3:96629992-96630014 AATGAAGACAGAGAAAAATCTGG - Intergenic
958629500 3:96668765-96668787 AGTGAAGTGAGAGTGAAAGCAGG + Intergenic
958687398 3:97417136-97417158 AATGAAATGAAAGACATATCAGG - Intronic
958969660 3:100597935-100597957 AGAGAAATGAAAGAAAAAGCTGG - Intergenic
958992529 3:100863615-100863637 AGTGAAGTATGAGAAAAATGAGG - Intronic
959100055 3:102000186-102000208 AGTGGAACCAGGGAAAAATCTGG + Intergenic
959170931 3:102842694-102842716 TGTGAAATGAGAGAAAAGGCAGG + Intergenic
959397297 3:105856420-105856442 AGTAGATGGAGAGAAAAATCTGG + Intronic
959436439 3:106320389-106320411 AGAGAAATGAAACAAAAAGCTGG + Intergenic
960339150 3:116454384-116454406 TATGAAATTAGAGGAAAATCAGG + Intronic
960516804 3:118611012-118611034 AGAGAAATGAAACAAAAAGCTGG + Intergenic
960532771 3:118783706-118783728 AGTCAAATGTGAGCAAAATAAGG + Intergenic
960653560 3:119978630-119978652 AGTGAAGTGAGAGAAAAGATGGG - Intronic
961280466 3:125762663-125762685 ACTTAAATGAGAGAGAAAACAGG - Intergenic
961407436 3:126691426-126691448 AGATAAATGAAACAAAAATCTGG + Intergenic
961692422 3:128679849-128679871 CGTGAAATGAGACAACGATCTGG - Intronic
961873932 3:130006873-130006895 ACTTAAATGAGAGAGAAAACAGG + Intergenic
962106398 3:132395227-132395249 ACTGAAGAGATAGAAAAATCAGG + Intergenic
962308480 3:134309445-134309467 GGTGAACTGAGAGAAGAATGGGG + Intergenic
962503112 3:136015762-136015784 AGAGAAATGAAACAAAAAGCTGG - Intronic
963257872 3:143163872-143163894 AGTGTAAGGAGAGAAGAAACTGG + Intergenic
963438341 3:145302305-145302327 AGTGAGATGTTAGAAACATCTGG + Intergenic
963635074 3:147784548-147784570 AGATAAATGAAAGAAAAAGCTGG - Intergenic
963859675 3:150295914-150295936 AGTGACATGAGAAACAAATCTGG - Intergenic
964252927 3:154740813-154740835 AGATAAATGAAACAAAAATCTGG - Intergenic
964402814 3:156316782-156316804 AGTAAGATGAGAGTAAAGTCTGG - Intronic
965313705 3:167164011-167164033 AGTGGCTTGAGAGAAAGATCAGG - Intergenic
965456982 3:168913428-168913450 AGGGAAAAGAGAAAGAAATCAGG + Intergenic
965664332 3:171076257-171076279 AATGAAATTAGAGAAAAGGCAGG + Intronic
965844138 3:172941717-172941739 ACTGAAATGCGAGAAAAAATTGG + Intronic
965872141 3:173276447-173276469 AGTTAAATGAGAGAGAAAAAGGG - Intergenic
965941349 3:174186036-174186058 AGTGAAATGAGTGATAAGACAGG + Intronic
965992505 3:174837187-174837209 AGAGAAATGAAAGAAAAAGCTGG + Intronic
966179774 3:177177547-177177569 AGTCAAATAATAGAAAAAACGGG - Intronic
1202747973 3_GL000221v1_random:126409-126431 AGAGAAAGGAGAGACAAATATGG - Intergenic
969081338 4:4620944-4620966 AGTGAAATGAGATAAATGTGAGG + Intergenic
969171983 4:5371526-5371548 AGGGAAATAAGACAAGAATCAGG - Intronic
969309425 4:6344729-6344751 AGTGGAAACAGAGAAAACTCTGG - Intronic
969545908 4:7827590-7827612 AGGGAGAGGAGAGAAAAATGAGG + Intronic
969736751 4:8996932-8996954 ACTTAAATGAGAGAGAAAACAGG - Intergenic
969795943 4:9528515-9528537 ACTTAAATGAGAGAGAAAACAGG - Intergenic
970019813 4:11555337-11555359 ATTGAAAAGAGAGAGCAATCAGG - Intergenic
970232093 4:13921436-13921458 AATGAAAAGAGAGAAAAAAGGGG - Intergenic
970861606 4:20710080-20710102 AGTGAAATAAGGAAAACATCAGG + Intronic
971168255 4:24206430-24206452 AGTTACATGAAAGAAAAATCAGG + Intergenic
971787235 4:31120214-31120236 AGGGAAATGGGAGAAAAAACAGG - Intronic
971843496 4:31887852-31887874 AAGGAAATGAAAAAAAAATCAGG - Intergenic
971926351 4:33014105-33014127 TGTGAAGTGAGATAAAACTCTGG - Intergenic
971944525 4:33256123-33256145 AGTGAAGTGAGAGAAAAGACGGG + Intergenic
972001625 4:34043286-34043308 AGTGATCTGAGAGAAACCTCAGG + Intergenic
972138433 4:35923800-35923822 AATGCAAAGAGAGAAAAATGAGG - Intergenic
972927507 4:44029481-44029503 AGTAGAATGATAGTAAAATCAGG + Intergenic
972969320 4:44552978-44553000 AGTGTAATGAAGGAAAATTCTGG - Intergenic
974112927 4:57546328-57546350 ATTGATATGAGAGAAAAAGAAGG + Intergenic
974113661 4:57555004-57555026 AGTGATAAGAGAAACAAATCTGG + Intergenic
974155386 4:58065040-58065062 ATGGAAAACAGAGAAAAATCAGG + Intergenic
974241416 4:59253293-59253315 AGAGAAATGGAAGAAAAAACTGG + Intergenic
974591791 4:63958700-63958722 TGTGAAATGTGAAAAAAACCTGG - Intergenic
974784027 4:66594107-66594129 ATAGAAATTAGAGAGAAATCTGG + Intergenic
974963134 4:68728652-68728674 AGTGAAATGAAATAAAAAGCTGG - Intergenic
974978874 4:68927356-68927378 AGTGAAAGGAGAGTGAAATGTGG - Intergenic
975061835 4:70012796-70012818 AGATAAATGAAACAAAAATCTGG - Intergenic
975091011 4:70404272-70404294 ATTGAAGTAGGAGAAAAATCAGG - Intronic
975173430 4:71259515-71259537 AGTGAAATGGAAGAACAAGCAGG + Intronic
975501443 4:75089897-75089919 AGAGAATAGAGAGAAAAATGTGG - Intergenic
976147880 4:82060551-82060573 AGCGAAATGACAGAAAGTTCAGG - Intergenic
976300107 4:83508768-83508790 AGTTAAATGAGAGAGAAAAAGGG + Intronic
976416650 4:84784114-84784136 AGTGAGAAGGGAGAAAAACCAGG - Intronic
976904931 4:90225743-90225765 AATGAAAAGAGACAAAAATGAGG - Intronic
977152475 4:93530095-93530117 AGTGAAAGGAGAGAATAAATTGG - Intronic
977442846 4:97091375-97091397 TGGGAGATGAGAGAGAAATCAGG + Intergenic
977720936 4:100239660-100239682 AGTGGCCTGAGAGAAAATTCAGG + Intergenic
977813625 4:101387639-101387661 AGATAAATGAAAGAAAAAGCTGG - Intergenic
977958748 4:103060842-103060864 TGTGAAATTGGAGACAAATCAGG + Intronic
978111624 4:104971190-104971212 AGTGAAGTAAGACAATAATCAGG - Intergenic
978316679 4:107445583-107445605 AGATAAATGAAACAAAAATCTGG - Intergenic
979011354 4:115374210-115374232 ATTGAAATGAGACAAATATTTGG - Intergenic
979164899 4:117516577-117516599 AGTGGGATGATAGAAAAATATGG - Intergenic
979360449 4:119757742-119757764 AGTGAGGTGGGAGAAAAACCAGG - Intergenic
979399257 4:120227953-120227975 AGGAAAAGGAAAGAAAAATCTGG - Intergenic
979918914 4:126474906-126474928 AGTGAAAAGAAAGAAAAGCCAGG + Intergenic
980007770 4:127560548-127560570 AATTAAATGAGAAAAAAATCAGG + Intergenic
980190434 4:129518283-129518305 ACTTAAATCAGAAAAAAATCTGG - Intergenic
980238112 4:130134735-130134757 AGATAAATGAAACAAAAATCTGG + Intergenic
981058587 4:140394878-140394900 ATTGATATCAGAAAAAAATCAGG + Intronic
981103053 4:140851844-140851866 AGTGAAATCTGAGTAAACTCTGG - Intergenic
981680351 4:147390364-147390386 AGTGAAAAAAGACAAAAATTTGG + Intergenic
981871215 4:149487877-149487899 AGTGATATGAAATTAAAATCAGG + Intergenic
982743617 4:159083538-159083560 AGTGAAATGTGAAAGAAATAAGG - Intergenic
982822547 4:159960772-159960794 AGTAACATGTGAGAAATATCAGG - Intergenic
982836842 4:160129793-160129815 GGTGAAATGTGGGAGAAATCAGG - Intergenic
982985063 4:162196674-162196696 GGTGAAAGGAGAAAAAAATTAGG + Intergenic
983086511 4:163451786-163451808 AGATAAATGAGACAAAAAGCTGG + Intergenic
983365246 4:166778382-166778404 ATTCAAATGAAAGCAAAATCTGG + Intronic
983860117 4:172695569-172695591 CATGAAATGAGAGAAATCTCAGG - Intronic
983917354 4:173307154-173307176 TCTGCAATGAGAGAAAAATCAGG - Intronic
983990251 4:174109544-174109566 GTTGAAATGTCAGAAAAATCTGG - Intergenic
984183572 4:176514856-176514878 AGTGATATGAGGGAAAAGTGGGG - Intergenic
984715313 4:182919108-182919130 AGTGAAATGCGGGAACATTCAGG - Intergenic
984985987 4:185329879-185329901 AGTGAAGTGAGAGACAAGACTGG + Intronic
985077315 4:186228787-186228809 AGAGAAATGAGATCTAAATCTGG - Intronic
1202753810 4_GL000008v2_random:37020-37042 AGAGAAACGAGAGACAAATATGG + Intergenic
986085868 5:4445694-4445716 TGTGAAAGAAGAGAAAAATTGGG + Intergenic
986931834 5:12834550-12834572 AGTGATTTGAGAAAAAAATCAGG + Intergenic
987370901 5:17192062-17192084 GGTGAAATGAAAGAAAAGTAAGG - Intronic
987427861 5:17794099-17794121 AGTGACATTAGAGAAAAATTAGG + Intergenic
987468941 5:18307025-18307047 ATTGACATGTGACAAAAATCAGG + Intergenic
987527663 5:19074193-19074215 AGATAAATGAAACAAAAATCGGG + Intergenic
987803192 5:22725092-22725114 AGTAAAACATGAGAAAAATCCGG + Intronic
987942478 5:24558902-24558924 AATTTAATGAGAGAAAAATCTGG - Intronic
987966274 5:24880055-24880077 AGTGATATGAGAGAAAGAGCAGG - Intergenic
988071952 5:26302181-26302203 AATAAAATGAAAGAAAAATAAGG - Intergenic
988533976 5:32049799-32049821 AGTAAAAGCAGAGAAAAAACTGG + Intronic
988569191 5:32347283-32347305 ACTGGAAAGAGAAAAAAATCAGG + Intergenic
988637138 5:32996696-32996718 GGTGGAATGAGAGAAAACTGTGG - Intergenic
989361375 5:40605267-40605289 AGTAACATGAGAAAAAGATCAGG - Intergenic
989620900 5:43383429-43383451 ACTGAAATGGGAGAAAAGTGGGG + Intronic
990036164 5:51322826-51322848 AGTGAAATTACAGAAAAACTGGG + Intergenic
990037545 5:51340301-51340323 AGTGAAAGAATAGAAAAATCTGG + Intergenic
990101841 5:52200710-52200732 GGGGAAAAAAGAGAAAAATCAGG - Intergenic
990573743 5:57105013-57105035 AGTGAATGGAAAGAAACATCAGG - Intergenic
991665547 5:68996132-68996154 AGAGAAATGGGAGAAACATTAGG - Intergenic
992348348 5:75903513-75903535 AGTGGAATGAAAGAAAAGTTCGG - Intergenic
992508631 5:77411973-77411995 AGTTCAATAACAGAAAAATCAGG + Intronic
993186339 5:84626285-84626307 AGTGAAATTAAAGAAAAAAGTGG - Intergenic
993325874 5:86535416-86535438 AATGGAATGAAATAAAAATCAGG - Intergenic
993514902 5:88819422-88819444 AGAGAAATGAGAGAAAAGATTGG - Intronic
993948310 5:94141486-94141508 AGATAAATGAAAGAAAAAGCTGG - Intergenic
993996404 5:94728748-94728770 AAGAAAATGAGAGAGAAATCAGG - Intronic
994330134 5:98495015-98495037 AGATAAATGAAAAAAAAATCTGG + Intergenic
994580354 5:101633446-101633468 AGTGATATGACAGTAAAGTCCGG - Intergenic
994933438 5:106219158-106219180 ACTTAAATGAGAGAAATACCAGG + Intergenic
995007207 5:107214180-107214202 AGTGAAATGGCAGAACAATTAGG + Intergenic
995053056 5:107728577-107728599 AGTAAAATCAGAGAAGAATGGGG - Intergenic
995348064 5:111143584-111143606 AGTGAAATGAGAATAAAAGTAGG + Intergenic
995699677 5:114920393-114920415 AGTTAAATGAAACAAAAAGCTGG + Intergenic
996011020 5:118481887-118481909 AGATAAATGAAACAAAAATCTGG + Intergenic
996032230 5:118718414-118718436 AGATAAATGAGACAAAAATCTGG + Intergenic
996123781 5:119702309-119702331 AGATAAATGAAACAAAAATCTGG - Intergenic
996261724 5:121479392-121479414 AGAGAAATGTAAGAAAAATTTGG - Intergenic
996334570 5:122368787-122368809 AGTGAATGGAGAGAAACTTCAGG - Intronic
996461009 5:123743045-123743067 CCTGAAATGAGAGTTAAATCTGG + Intergenic
996513071 5:124339193-124339215 AGTAACATGAGAGAAAGAACAGG + Intergenic
996633851 5:125667156-125667178 AGTGAAATGACAGAAAAGATGGG + Intergenic
997062302 5:130521643-130521665 AGTGCAATGGCAGAAAAATGAGG + Intergenic
997063946 5:130541133-130541155 AGTAAAATGAGATAAAGATTTGG - Intergenic
997405010 5:133638663-133638685 AGTGCTATGGGAGAAAAAGCAGG - Intergenic
998606840 5:143644162-143644184 AGACCAATAAGAGAAAAATCTGG + Intergenic
998871156 5:146553559-146553581 AGGGAAATGAGGGAAGATTCTGG - Intergenic
999001204 5:147924788-147924810 AGGGAAAAGAGAGAGAAATAAGG + Intergenic
999552200 5:152701588-152701610 AGGAAAAACAGAGAAAAATCAGG - Intergenic
999732945 5:154489498-154489520 AGGGACATAAAAGAAAAATCTGG - Intergenic
1000109444 5:158093878-158093900 AGTGAGGTAAGAGAAAAACCAGG - Intergenic
1000163360 5:158622768-158622790 AGGGGAATGAGATAAAGATCTGG - Intergenic
1000584679 5:163082611-163082633 AGATAAATGAAAGAAAAAGCTGG + Intergenic
1000723797 5:164742461-164742483 AGTGAAGGGAGAGAAAAAGAGGG + Intergenic
1000752984 5:165119865-165119887 CCTCAAATGAGAGAAAAATCTGG + Intergenic
1000762942 5:165249150-165249172 ATTGAAATCAGAGAAACCTCAGG + Intergenic
1000808478 5:165828713-165828735 AGAGCAATCAGATAAAAATCAGG - Intergenic
1001055255 5:168444211-168444233 AGTGAAGTGAGAGAGAATTAAGG - Intronic
1001187500 5:169589154-169589176 AGTGAAATGTGAGAAATAAAGGG - Intronic
1001202720 5:169733124-169733146 AGAAAAAGGACAGAAAAATCAGG - Intronic
1001488884 5:172141599-172141621 ATTTAAAAGAGAGAAAAATAAGG + Intronic
1001746276 5:174095004-174095026 AGTGTAATGAGAGCAAAACTAGG + Intronic
1002780532 6:361750-361772 AGTGAAAGGTGACAAGAATCAGG - Intergenic
1003210787 6:4064147-4064169 AGTGAAATGAGATAGCTATCAGG - Intronic
1003265098 6:4558837-4558859 AGTGTAAAGAGAGAAGAATGAGG + Intergenic
1003796541 6:9611818-9611840 AGAGATATGAAAGAAAATTCTGG + Intronic
1003883165 6:10496771-10496793 AGTGAAATCAGAATAAAGTCTGG - Intronic
1003905408 6:10694727-10694749 ACTGCAAGGAGAAAAAAATCGGG - Exonic
1004096818 6:12563736-12563758 AGATAAATGAAAGAAAAAGCTGG + Intergenic
1004349819 6:14881197-14881219 TGTGCAAAGAGAGAAAAGTCAGG - Intergenic
1004711694 6:18177405-18177427 AGTTAAATGAAACAAAAAGCTGG - Intronic
1004752709 6:18580187-18580209 CCTGAAATCAGAGAAAAACCAGG - Intergenic
1004794875 6:19070379-19070401 AGTGAAGTAACAGAAAATTCTGG + Intergenic
1004962262 6:20803251-20803273 AGGGAAAGGAGAGAAAAGGCTGG - Intronic
1006014630 6:31070472-31070494 AGTGACATGAAAGAAAGATGAGG - Intergenic
1006626055 6:35398679-35398701 AGTGATATCAGAGCAAAACCTGG + Intronic
1007354812 6:41306471-41306493 AGCGAAATCAGAGATAAACCAGG - Intergenic
1007913137 6:45535903-45535925 AGTAAAATGAGAGACAAGACTGG + Intronic
1008042028 6:46812419-46812441 AGACAAATGAAACAAAAATCTGG - Intronic
1008096818 6:47347442-47347464 TGTGAAATAATAGAAAAATAAGG + Intergenic
1008198369 6:48554207-48554229 AGTGAAAAGAAAGAAAAAGTTGG + Intergenic
1008453836 6:51685317-51685339 AAAGAAAAGAGAGGAAAATCTGG - Intronic
1008689918 6:53966417-53966439 AGTGAAAGGAGAAAACAACCAGG - Intronic
1008884689 6:56419459-56419481 AGTAAAATGTGAGGAAAATCTGG - Intergenic
1009561498 6:65250985-65251007 AGTGATATGAAAAAAATATCCGG + Intronic
1009721960 6:67483190-67483212 TGTAAAATGAAAGAAAAATGAGG + Intergenic
1010264925 6:73855535-73855557 AGAGAAATGACAGTAGAATCTGG - Intergenic
1010304045 6:74296445-74296467 AGTGAAGTGGGAGAAGAATCAGG - Intergenic
1010499410 6:76578441-76578463 TTTGAAAAGAGAGTAAAATCAGG - Intergenic
1010890584 6:81305260-81305282 AGGGAAAAGAGAGAAAAAATAGG - Intergenic
1011090012 6:83586887-83586909 AGTGAAATGATAAAAAATTCTGG - Intronic
1011893036 6:92191327-92191349 AGATAAATGAAAGAAAAACCTGG - Intergenic
1012325498 6:97911072-97911094 AGTGAAGGAAGAGAAACATCAGG + Intergenic
1013989798 6:116240558-116240580 AGTGAGATGAGAGAAAATGATGG + Intronic
1014548220 6:122756871-122756893 AGTGAAATGAGAGGAAAACAAGG - Intergenic
1014593179 6:123298157-123298179 AGTTAAAAGAAAGAAAAACCGGG + Intronic
1014723727 6:124950636-124950658 AGAGGAATGAGAGCAAAGTCAGG - Intergenic
1014879829 6:126709934-126709956 AGTGAGAAAAGAGAAAAGTCAGG - Intergenic
1015053576 6:128872717-128872739 AGTGATATGAGAGACAAAGAGGG - Intergenic
1015513844 6:134065535-134065557 AGTGAAAGAAGAGAAAATTCGGG + Intergenic
1015567689 6:134590501-134590523 ATAGAAAAGAGAGAAAAAGCTGG - Intergenic
1015804705 6:137096837-137096859 GTTAAAATGAGATAAAAATCTGG + Intergenic
1016006840 6:139098031-139098053 AGTGAAATGTGAGTAAAGTATGG - Intergenic
1016078059 6:139820971-139820993 TGTGAGATGAGAGAAAAACCAGG - Intergenic
1016128164 6:140432599-140432621 AGGGATAGGAGAGAAAAATTGGG - Intergenic
1016791954 6:148075590-148075612 AGGGAAAGGAAAGAAAAATAAGG - Intergenic
1017210056 6:151845906-151845928 AATGCAATGATAGAAAAACCTGG + Intronic
1017507065 6:155078500-155078522 GGTGAAATGACAGAGAAACCAGG - Intronic
1017581923 6:155874460-155874482 AGACAAATGAAAGAATAATCTGG + Intergenic
1017821424 6:158051573-158051595 AGTGAAGTGAGTGCAAAATGAGG - Intronic
1017887428 6:158610635-158610657 AGTGAAATGAGTGAGAATTCTGG + Intronic
1017888531 6:158620685-158620707 AGTGAAGTGAGAGAAAAGATGGG + Intronic
1017997479 6:159544968-159544990 AGTGAAGTGAGGGAGAATTCTGG - Intergenic
1018159281 6:161022315-161022337 AGTTAAATGAGAGAAAAAGTGGG - Intronic
1019064535 6:169285613-169285635 TGTGAAATGACACAAAAATAGGG - Intergenic
1019530964 7:1503196-1503218 AGAGAAAGGAGAGAGAAAACCGG + Intronic
1020458645 7:8403042-8403064 AGTGAAAAAAGAGAGAAATATGG - Intergenic
1020888946 7:13854348-13854370 AGAGAAATGAGATAACAATTTGG + Intergenic
1021266330 7:18528376-18528398 AGTGAAAACAGAAAAAAATTAGG + Intronic
1021518178 7:21509314-21509336 AGTTAAAGGAGAGAAAAAAAAGG - Intronic
1021779931 7:24094062-24094084 GGAGAAAGGAGAGAAGAATCAGG - Intergenic
1022066116 7:26859181-26859203 AATGAAAGCAGAGAGAAATCTGG - Intronic
1022222211 7:28324502-28324524 AGTGAGGTGGGAGAAAAACCAGG - Intronic
1022590962 7:31662317-31662339 AGTGAAATGAAGCAAAAATTTGG + Intergenic
1022662600 7:32380746-32380768 AGTGAGTTGGGAGAAAAACCAGG - Intergenic
1023015582 7:35966994-35967016 AGTTAAAGGAGAGAAAATTAGGG + Intergenic
1023114099 7:36843677-36843699 AGTGAGATGAGAGAAGAAATGGG + Intergenic
1024065350 7:45727689-45727711 AGTTAAAGGAGAGAAAATTAGGG - Intergenic
1025723454 7:64037073-64037095 AGGGATATGAGGGATAAATCTGG - Intronic
1026439192 7:70428593-70428615 AAGGAAATGAGAGGAAAATGAGG - Intronic
1027544265 7:79506479-79506501 ATTGAAGTAAGAGAAAAAACAGG - Intergenic
1028324863 7:89510211-89510233 AGTAAAATAAGAGGAAAATCAGG + Intergenic
1028486085 7:91359112-91359134 AGTAAAATGATAGATAAATTGGG - Intergenic
1028633797 7:92964634-92964656 AGTGAAAAAAAAAAAAAATCTGG + Intergenic
1029053432 7:97714235-97714257 AGTTAAATGAAAGAAAAAGCTGG + Intergenic
1029075699 7:97932208-97932230 ACTTAAATGAGAGAGAAAGCAGG + Intergenic
1029917716 7:104229562-104229584 AGAGAAATTACAGAAAAATTAGG + Intergenic
1030560564 7:111079415-111079437 AGTGAATTTAGAAAAAAATTAGG - Intronic
1030947695 7:115745643-115745665 CCTGAAATGATACAAAAATCTGG - Intergenic
1032376133 7:131419795-131419817 GGTGAAATCAGAGAAATAGCTGG + Intronic
1032811651 7:135425380-135425402 AGTGACAAGTAAGAAAAATCAGG + Intronic
1033003444 7:137533472-137533494 AGTGAAAGGAGAGAAAGAAATGG - Intronic
1033179676 7:139163602-139163624 ATTGAAAGAAGAGAAAAATAGGG + Intronic
1033903497 7:146172518-146172540 AGAAAGAGGAGAGAAAAATCAGG - Intronic
1035278570 7:157763288-157763310 AGGGAAGGGAGAGAAAAATGAGG - Intronic
1036241826 8:7088124-7088146 ACTGAAATGAGAGAGAAAACAGG - Intergenic
1036260008 8:7231979-7232001 ACTTAAATGAGAGAGAAAACAGG + Intergenic
1036306605 8:7607543-7607565 ACTTAAATGAGAGAGAAAACAGG - Intergenic
1036312051 8:7690548-7690570 ACTTAAATGAGAGAGAAAACAGG + Intergenic
1036357453 8:8055531-8055553 ACTTAAATGAGAGAGAAAACAGG - Intergenic
1036614705 8:10379400-10379422 AGTGAAATGAGAAAAGACTCGGG - Intronic
1036830907 8:12018960-12018982 ACTTAAATGAGAGAGAAAACAGG + Intergenic
1036901044 8:12669398-12669420 ACTTAAATGAGAGAGAAAACAGG + Intergenic
1037646612 8:20798187-20798209 AGAGAAAGGAGAGGAAAAGCCGG - Intergenic
1037665480 8:20965812-20965834 AGTGCAATTATAGAAACATCTGG - Intergenic
1038782665 8:30581426-30581448 ACTGAAATGAGAGAGAAAGGGGG - Intronic
1038875485 8:31543821-31543843 ATTGAAAGGACAGAAAAATACGG - Intergenic
1039000846 8:32978604-32978626 AGATAAATGAAAGAAAAAGCCGG + Intergenic
1039810250 8:41041270-41041292 AGATAAATGAAAGAAAAAGCTGG - Intergenic
1039933913 8:42022723-42022745 AGTGAAATGATATACAAATGAGG + Intronic
1040670851 8:49688653-49688675 AGATAAATGAAAGAAAAATCTGG - Intergenic
1040752620 8:50728861-50728883 AGTGGAATGAGATAAGAATATGG - Intronic
1040822614 8:51581077-51581099 CCTGAAATCAAAGAAAAATCAGG + Intronic
1041105207 8:54436007-54436029 AGTAAAAAGAGAGAGAAATGTGG - Intergenic
1041127115 8:54653986-54654008 AGAGGAATGATATAAAAATCAGG + Intergenic
1041367394 8:57122802-57122824 AGTGAGATCAGGGATAAATCTGG + Intergenic
1041368819 8:57137500-57137522 AGTTAATTAACAGAAAAATCAGG + Intergenic
1042050063 8:64694057-64694079 ACTGAAAAGAAAGAAAAATAAGG + Intronic
1042157960 8:65865228-65865250 AGTTAAATGAGAGAGAAAAAGGG - Intergenic
1042235161 8:66604654-66604676 AGGTAAATGTGACAAAAATCTGG + Intronic
1042258294 8:66829477-66829499 AGTAAGATAAGAGAAAAACCAGG + Intronic
1042329596 8:67564277-67564299 AGAGACTAGAGAGAAAAATCTGG - Intronic
1043140040 8:76576375-76576397 AGTAAAATAAGAGAAAGAGCTGG - Intergenic
1043188010 8:77179721-77179743 AAGGAAATCAGAGAGAAATCTGG - Intergenic
1044593778 8:93939337-93939359 AATGAAATGACTGAACAATCTGG - Intergenic
1044803208 8:95978213-95978235 TGTAAATTGAGAGAAAAATAGGG - Intergenic
1044947623 8:97405303-97405325 AGATAAATGAAACAAAAATCTGG - Intergenic
1045816316 8:106281043-106281065 TTTCACATGAGAGAAAAATCTGG - Intronic
1046037657 8:108863578-108863600 TGTGAAATGAGCGATATATCTGG + Intergenic
1046465731 8:114600568-114600590 AATAAAATGAGAAAAAAATAAGG + Intergenic
1046694349 8:117321943-117321965 AGTGATATCAGATGAAAATCTGG + Intergenic
1047210236 8:122834769-122834791 AGTTAAATGAGAGAGAAAAAGGG + Intronic
1047711895 8:127560922-127560944 AGTCAAATGAGAGTCAAAGCAGG + Intergenic
1048035383 8:130672878-130672900 AGTAAAATGAGGAAAAAATGAGG - Intergenic
1048158300 8:131984858-131984880 AGTGTAATCAGAGAAAATGCTGG + Intronic
1048302554 8:133262202-133262224 AGTAAGATGAGAAAAAAATTAGG + Intronic
1049581627 8:143414123-143414145 AGAGAAAGGAGAGAAAAAGGTGG + Intergenic
1050185098 9:2965007-2965029 AGTGACATGTTAGTAAAATCTGG + Intergenic
1050269659 9:3929034-3929056 AGTGAAATAAGAGAAAACTAAGG - Intronic
1050390993 9:5144232-5144254 AATGAAATGAAGGAGAAATCAGG - Intronic
1050428813 9:5540426-5540448 AGAGAAATGAAACAAAAATCTGG + Intronic
1050747882 9:8898416-8898438 AGTAGAATGAGAGAACAGTCAGG - Intronic
1050801933 9:9626203-9626225 CGTGAAAGGAAATAAAAATCAGG - Intronic
1050923514 9:11234943-11234965 AGTGAAGTGAGAGACAAGACTGG + Intergenic
1050963208 9:11764800-11764822 AGTGAAATGTGAAATAAACCAGG + Intergenic
1050980621 9:12009328-12009350 AGTGAAATATGAAAAAAATGTGG - Intergenic
1052444720 9:28545638-28545660 AGTGAAAGGAGAGGAAAAAGAGG + Intronic
1052529832 9:29667908-29667930 AGTGAAGTGAGAGCAAAAAATGG - Intergenic
1054725529 9:68646446-68646468 AGTGAATGGAGAGAAAACTCAGG - Intergenic
1055204174 9:73707724-73707746 AATGATATGGGAGAAAAACCAGG - Intergenic
1055435746 9:76290380-76290402 AGTGAAATGAACCAAAAACCAGG - Intronic
1056745301 9:89296342-89296364 AGTGAAGTGAGAGAAAAGACAGG - Intergenic
1056987706 9:91378993-91379015 AGTGATTTAAGAGAAACATCTGG - Intergenic
1057007327 9:91572143-91572165 AGAGAACAAAGAGAAAAATCAGG + Intronic
1057022674 9:91712376-91712398 AGGGAAAAGAGAGAAGGATCTGG + Intronic
1057642699 9:96840944-96840966 AGATCAATGAGAGAAAAAGCTGG + Intronic
1058152458 9:101477772-101477794 AATAAAATGGGAGAACAATCAGG - Intronic
1058262695 9:102855751-102855773 GGTGATAGGAGAGAAAAAGCAGG + Intergenic
1058406010 9:104674766-104674788 AGTTAAATGAGAGAGAAACCTGG - Intergenic
1058540434 9:106006578-106006600 AGACAAATGAAACAAAAATCTGG - Intergenic
1058808843 9:108619493-108619515 AGTGAAAGGAGGGGAAAATAGGG - Intergenic
1059112146 9:111567592-111567614 AATGAAATCAGAGAGATATCAGG + Intronic
1059632143 9:116136126-116136148 TGTGAAATGGGAGAACAGTCAGG + Intergenic
1059674029 9:116519699-116519721 AGATAAATGAAACAAAAATCTGG + Intronic
1059939080 9:119340191-119340213 AGTTAAATAAGATATAAATCAGG + Intronic
1060121172 9:120991153-120991175 AGTGAAATGAGAAATAAAAATGG + Intronic
1061977727 9:134079312-134079334 AGTGAAATGACAGATAAACTAGG + Intergenic
1203757228 Un_GL000218v1:143823-143845 AGAGAAAGGAGAGACAAATATGG - Intergenic
1203716611 Un_KI270742v1:156491-156513 AGAGAAAGGAGAGACAAATATGG - Intergenic
1203534599 Un_KI270743v1:21743-21765 AGAGAAACGAGAGACAAATATGG + Intergenic
1186139286 X:6553970-6553992 TGAGAAACTAGAGAAAAATCAGG - Intergenic
1186958066 X:14704464-14704486 AGCTAAATGACAGAAAAGTCTGG + Intronic
1187208500 X:17206051-17206073 AGGAAAATGAAAGAAAGATCAGG + Intergenic
1187210262 X:17223261-17223283 GATGAAATGAGAGACATATCTGG - Intergenic
1187751940 X:22476156-22476178 AGATAAATGAAACAAAAATCTGG - Intergenic
1188072594 X:25735488-25735510 AGAGAGATGAGAGAAAGGTCTGG - Intergenic
1188389103 X:29597975-29597997 AGATAAATGAAACAAAAATCTGG - Intronic
1188409375 X:29852194-29852216 AATGAAATGGGAGATGAATCTGG + Intronic
1188457905 X:30388186-30388208 AGTGAAAAGAGAGAGCAAGCGGG + Intergenic
1188602379 X:31983931-31983953 ACTGAAATGTGATAACAATCTGG - Intronic
1188712966 X:33424764-33424786 AGTTAAAAAAAAGAAAAATCTGG - Intergenic
1190342665 X:49309838-49309860 AGTGAAAAGCTAGAAAAGTCAGG + Intronic
1191229463 X:58082625-58082647 ATTCAAATGAGAGAGAAACCTGG + Intergenic
1192141363 X:68649479-68649501 GGTGGAATGAGAGAAAAGTAGGG + Intronic
1192347343 X:70321946-70321968 AGAAAAGTGAGAGGAAAATCAGG - Intronic
1192348379 X:70332552-70332574 TGTGAAAAAAGAGAAAAATAGGG + Intronic
1192572868 X:72221006-72221028 AATGAAGTGAGAGAAAAGACGGG - Intronic
1192574738 X:72234242-72234264 AGTGAAGTAAGAAGAAAATCCGG + Intronic
1192586599 X:72323838-72323860 AATTAAGTGAAAGAAAAATCAGG + Intergenic
1192978535 X:76313942-76313964 AGATAAATGAAGGAAAAATCTGG - Intergenic
1193015599 X:76730000-76730022 AGACAAATGAAAGAAAACTCTGG + Intergenic
1193966253 X:87990117-87990139 TGTCAAATGAAAGAAAAATGAGG + Intergenic
1194108052 X:89796421-89796443 AATGAATTGAAAGAAAAATTTGG + Intergenic
1194136513 X:90151149-90151171 AGTGATATGAAATAAAAAGCAGG - Intergenic
1194232215 X:91338490-91338512 AGATAAATGAAACAAAAATCTGG + Intergenic
1194265625 X:91750326-91750348 ATTCAAATGGGAGAAAAATCTGG + Intergenic
1194604887 X:95966204-95966226 AGTGAATTGAGAGAAGCATGGGG - Intergenic
1194759007 X:97771766-97771788 GGTGAGATATGAGAAAAATCTGG - Intergenic
1194995839 X:100590643-100590665 AGTGAAATGAGACAGATATGTGG - Intronic
1195236970 X:102910264-102910286 AGTGAAAAAAGGGAAATATCAGG - Intergenic
1195250728 X:103043754-103043776 AGTGAAAGGAGGGAGAAATTGGG - Intergenic
1195445182 X:104944255-104944277 AAAGAAAGAAGAGAAAAATCCGG - Intronic
1196494502 X:116308037-116308059 AGTGATATGAAATTAAAATCAGG + Intergenic
1196522511 X:116690807-116690829 AGTGACATAAGAGAAAAATAAGG + Intergenic
1196600124 X:117591794-117591816 ATGGAAAGCAGAGAAAAATCAGG + Intergenic
1196822715 X:119714914-119714936 AGTGAAATTAGAGATAAGTTAGG + Intergenic
1196947963 X:120847223-120847245 AGATAAATGAAACAAAAATCTGG - Intergenic
1196986031 X:121272558-121272580 AGTGAAATAAGAAATAAAACAGG - Intergenic
1197077155 X:122365511-122365533 ATGGAAAAGAGAGAAAAATGAGG - Intergenic
1197115774 X:122831681-122831703 TGGGACAAGAGAGAAAAATCAGG + Intergenic
1197800719 X:130345038-130345060 AGTGGAATGACACAAAAATGGGG - Intronic
1197976982 X:132176260-132176282 GGTGAGATGAGAGGAAAATGAGG - Intergenic
1198068957 X:133128935-133128957 CGTGAAACAAGAAAAAAATCTGG + Intergenic
1198433302 X:136589464-136589486 AGTGATATTTGAGAAAACTCAGG + Intergenic
1198932151 X:141872873-141872895 AGTGAAGTGAGAGAAAAGATGGG + Intronic
1199282393 X:146017413-146017435 AGAGAAATTAGAGAAAATACAGG + Intergenic
1199412571 X:147541680-147541702 AATGGAATGAAAGTAAAATCTGG + Intergenic
1199507228 X:148577744-148577766 TGTAAGATGAGAGAAAAATCTGG - Intronic
1199619988 X:149690760-149690782 AGTGATGCCAGAGAAAAATCCGG - Intronic
1199670539 X:150144309-150144331 AGTTAAGTGAGAGAGAAAACAGG - Intergenic
1200460708 Y:3451152-3451174 AATGAATTGAAAGAAAAATTTGG + Intergenic
1200482268 Y:3721099-3721121 AGTGATATGAAATAAAAAGCAGG - Intergenic
1200582773 Y:4970768-4970790 ATTCAAATGGGAGAAAAATCTGG + Intergenic
1201056080 Y:9993763-9993785 AGTGAAGTGAGAGAAAAGATGGG - Intergenic
1201170810 Y:11261444-11261466 AGAGAAAGGAGAGACAAATATGG - Intergenic
1201173065 Y:11289984-11290006 ATTCAAATGAAAAAAAAATCAGG + Intergenic
1201325869 Y:12757471-12757493 AATAAAATGATAGAAAAAACTGG - Intronic
1201461324 Y:14228405-14228427 AATAAAATGAGATAAAAATGAGG + Intergenic
1201629333 Y:16052377-16052399 AGTGAAATGTGGGAAACTTCAGG + Intergenic
1201636457 Y:16128176-16128198 AGTGAAGTGAGAGAAAAGACAGG - Intergenic
1202330519 Y:23747878-23747900 AGTAAAATGAGAGAAAAGATGGG - Intergenic
1202347813 Y:23953486-23953508 AGTAAAATGAAAGAAAAGTTGGG - Intergenic
1202522960 Y:25716605-25716627 AGTAAAATGAAAGAAAAGTTGGG + Intergenic
1202540250 Y:25922183-25922205 AGTAAAATGAGAGAAAAGATGGG + Intergenic