ID: 1168468975

View in Genome Browser
Species Human (GRCh38)
Location 19:56625645-56625667
Sequence TGGCTGAAGCAGAGTGAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1306
Summary {0: 2, 1: 21, 2: 105, 3: 303, 4: 875}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168468975_1168468983 30 Left 1168468975 19:56625645-56625667 CCCTGCTCACTCTGCTTCAGCCA 0: 2
1: 21
2: 105
3: 303
4: 875
Right 1168468983 19:56625698-56625720 CCCAGCCCACTCCCACCGCAGGG 0: 1
1: 0
2: 6
3: 52
4: 490
1168468975_1168468981 29 Left 1168468975 19:56625645-56625667 CCCTGCTCACTCTGCTTCAGCCA 0: 2
1: 21
2: 105
3: 303
4: 875
Right 1168468981 19:56625697-56625719 GCCCAGCCCACTCCCACCGCAGG 0: 1
1: 1
2: 5
3: 47
4: 419
1168468975_1168468978 7 Left 1168468975 19:56625645-56625667 CCCTGCTCACTCTGCTTCAGCCA 0: 2
1: 21
2: 105
3: 303
4: 875
Right 1168468978 19:56625675-56625697 CTTTCGTTCAGTCCCAGCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168468975 Original CRISPR TGGCTGAAGCAGAGTGAGCA GGG (reversed) Exonic
900559049 1:3294631-3294653 TGGCTGAAGGGGAGGCAGCACGG - Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901046473 1:6399154-6399176 TGGCTGGAGCTAAGTGAGCCAGG - Intergenic
901369471 1:8784111-8784133 TGGTGGGAGCAGAATGAGCAGGG - Intronic
901444856 1:9301939-9301961 TGGCAGAAGCACTGTGTGCAGGG - Intronic
901583260 1:10263879-10263901 TGGGTGGAGCAGAGTAAACAGGG - Intronic
901862136 1:12081214-12081236 AGGCCCCAGCAGAGTGAGCAGGG + Intronic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902109238 1:14064426-14064448 AGGCTGCAGCAGAGTGACCTGGG - Intergenic
902124350 1:14196148-14196170 TGGTTGGAGGAGGGTGAGCAAGG + Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902531618 1:17094298-17094320 TGGGTGGGGCAGAGTGAGCGAGG - Intronic
902551390 1:17221729-17221751 TGGCTGGAGCTAAGTGAGCGAGG + Intronic
902608786 1:17584795-17584817 TGGCTGGAGTGGAGGGAGCAAGG + Intronic
902907076 1:19566279-19566301 TGCCTGTAGCAAAGTGAGCAAGG + Intergenic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903293503 1:22329298-22329320 TGGCTGGAGTAGAGTGGGCAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903476753 1:23624787-23624809 TGGCTGTAGCCAAGTGAACACGG + Intronic
903598066 1:24511921-24511943 TGACTAGAGCAGAGGGAGCACGG + Intronic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
903681821 1:25102556-25102578 TGGCTGGAGCAGAGTGAATGGGG - Intergenic
904395591 1:30219361-30219383 TGGCCGGAGCAAAGGGAGCAGGG + Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904634844 1:31871960-31871982 TGGCTGAAGCTCAGTGAACCAGG + Intergenic
904706981 1:32398582-32398604 TGTCTGGAGCAGAGTGACTAAGG - Intergenic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
904914048 1:33956960-33956982 TGGCTGGAGCATGGTGAGGAAGG - Intronic
905004079 1:34696309-34696331 TGACTGGAGCAGTGTGAGCCGGG - Intergenic
905034741 1:34910541-34910563 TGGCTGCCGCAGAGAAAGCAAGG - Intronic
905078441 1:35295399-35295421 TAGCTGAACATGAGTGAGCAAGG + Intronic
905270300 1:36783222-36783244 GGGCAAAAGCTGAGTGAGCAAGG + Intergenic
905395561 1:37664216-37664238 TGGCTGGAGCAGGGGGAGCCTGG - Intergenic
905518929 1:38582592-38582614 TGGCTGTAGCACAGTGAGTGGGG - Intergenic
905722743 1:40220346-40220368 TGGCCTAATAAGAGTGAGCATGG - Intronic
905945819 1:41900800-41900822 AGGCTGAAGGAGAGGGAGAAAGG + Intronic
906263012 1:44407333-44407355 TGGGGGGAGCAGAGTGGGCAGGG + Intronic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906693440 1:47808515-47808537 TGGCTGAAGCTGAGCCAACAAGG + Intronic
906883332 1:49617159-49617181 TAGCTGAAACAGAGTGAGTGAGG - Intronic
906889064 1:49687290-49687312 TGGCTGTAGCAGAGATAGAAAGG + Intronic
906920009 1:50054057-50054079 TGGCTTGAGAGGAGTGAGCAAGG + Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907561845 1:55398269-55398291 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
907898971 1:58720071-58720093 TGGCTGGAGTGGAGTAAGCAAGG - Intergenic
908121686 1:60991803-60991825 TGGCTGGAGGAGACTGGGCAAGG - Intronic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908641396 1:66228025-66228047 TGGCTGGAGCAAAGTGAGTGAGG - Intronic
908642248 1:66238299-66238321 AGGCTGAATCACACTGAGCAGGG + Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
908769761 1:67585254-67585276 TGGAGGAAGCTGACTGAGCACGG + Intergenic
908783552 1:67713470-67713492 GGCCTGAAGCAGGGAGAGCAGGG + Intronic
909034432 1:70581133-70581155 TGGTAGAAGCACAGTGGGCAGGG - Intergenic
909419366 1:75446302-75446324 TGGCTGAAGTAGATTGAGTGAGG - Intronic
909679063 1:78270993-78271015 TGGTTGGAACAGAGCGAGCAAGG - Intergenic
910002173 1:82354242-82354264 TGGCTATAGCAGAGTGGGCAAGG - Intergenic
910104397 1:83615680-83615702 TGGCTGGGGCACAGTGAGTAAGG + Intergenic
910184205 1:84518657-84518679 TGATTGAAGCAGAGAGAGTAGGG - Intergenic
910547061 1:88430401-88430423 GGGCTGAGGGAGAGGGAGCATGG + Intergenic
910670182 1:89764334-89764356 TGGAAGAAACAGAGTGAACAAGG - Intronic
910672092 1:89783771-89783793 TAGCTGAAGTGGAGTGAACAAGG + Intronic
910677763 1:89832000-89832022 TGTGTGAAGCAGTGTCAGCAGGG + Intronic
910742369 1:90533948-90533970 TGGCTGAAGAAGGGTTAGAATGG - Intergenic
910864431 1:91775345-91775367 TGGCTGGAGTGGAGTTAGCAAGG - Intronic
910963717 1:92786847-92786869 TGGCTGGAGCACAGACAGCAGGG - Intronic
911031770 1:93496449-93496471 TGGCTGAAGTGCAGTGATCACGG + Intronic
911058712 1:93729664-93729686 TGGCTGATGCAGAGGTATCAAGG - Intronic
911140180 1:94492785-94492807 TGACTGAAGCACAATGAGAAAGG + Intronic
911162368 1:94694099-94694121 TGGCTAGAGTAGAGTGAACAAGG + Intergenic
911164028 1:94709285-94709307 CGGCTGCAGCTGAGTGAGCCAGG - Intergenic
911686434 1:100782069-100782091 TGGCTGAAGTAGAGTAATCAGGG - Intergenic
911830848 1:102549998-102550020 TGGTTGAAGCAGAGGAAACATGG + Intergenic
912022286 1:105120297-105120319 GGGGTGAAGCAGAGTTAGTAGGG - Intergenic
912023749 1:105140101-105140123 TGGTTGAAGTAGAAAGAGCAAGG - Intergenic
912111956 1:106354251-106354273 TGGTTTGAGCAGAGTAAGCAAGG + Intergenic
912342975 1:108935886-108935908 TGGCTAAAGTAGAGTAAGCACGG + Intronic
912552309 1:110492214-110492236 TGGGTGAAGCAGAGGGGACAAGG - Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913187697 1:116384557-116384579 TGGCTAAAGCTGAGTGACCGTGG - Intronic
913314190 1:117536276-117536298 AGGCTGGAGCAGAATGAGCTAGG + Intergenic
913408802 1:118527347-118527369 TGTTTGGAGAAGAGTGAGCAAGG + Intergenic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
914697230 1:150095741-150095763 TGGCTGGAGCATAGTGAATAAGG + Intronic
914976504 1:152368648-152368670 TGGCTAGAGCAGAGAGAGTAAGG - Intergenic
915098259 1:153479396-153479418 TGGTGGAAGCAAAGTGAGAATGG - Intergenic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
915951431 1:160192166-160192188 AGGCTGAAGTAGAGTGCGAAAGG + Intronic
915989569 1:160500344-160500366 GGGCTGGAGCAAAGTGAACAAGG - Intronic
916292732 1:163184455-163184477 TGACAGAAGAAGAGTTAGCAAGG + Intronic
916924159 1:169499833-169499855 TGGCTGAAGCCAAATGAGCAAGG - Intergenic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917486122 1:175456093-175456115 TGGCTGGACTAGGGTGAGCACGG - Intronic
917926753 1:179795514-179795536 TGGCAGAAGGTGAGTGAGCAAGG - Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918565515 1:185925874-185925896 TGGCTGAAGCCCATTGAGCCAGG + Intronic
918843906 1:189583692-189583714 TGGCCAGAGCAAAGTGAGCAGGG - Intergenic
919304029 1:195807078-195807100 TGGTTGAAATACAGTGAGCAGGG - Intergenic
919494171 1:198243013-198243035 TGGCTGGAGTACGGTGAGCAAGG - Intronic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920010318 1:202862162-202862184 TGGCCAAAGCAGACTGAGGAGGG + Intergenic
920012807 1:202881792-202881814 TGCCTGAAGCATAATGAGCCGGG - Intronic
920076203 1:203338778-203338800 TGGCTGCAGCACAGAGAGAAAGG - Intergenic
920646231 1:207806338-207806360 AGGGTGGAGCAGAGGGAGCATGG + Intergenic
921004001 1:211075077-211075099 TAGCCGAATAAGAGTGAGCAAGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921190532 1:212704200-212704222 TGGCTGGAGTGGAGTGAGGAAGG + Intergenic
921353278 1:214259844-214259866 TGGCTAGAGCTGAGTGAGCAAGG - Intergenic
921655866 1:217736614-217736636 TGACTGAAGCATAGTGATCCTGG + Intronic
921670147 1:217916073-217916095 TGGCCAGAGCAGAGTGAGAAAGG - Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
921800182 1:219393539-219393561 TGGCTGATGCAGGGTTAGCCTGG + Intergenic
921819750 1:219603956-219603978 TGACTGTAGCAGAATGAGAAGGG + Intergenic
921862400 1:220053534-220053556 TGGCTGAAGTAAAATGAACAAGG - Intergenic
922348709 1:224718386-224718408 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
922503128 1:226110889-226110911 TGGCTGGAGCAAGGTCAGCAAGG - Intergenic
922627113 1:227059919-227059941 TGGCTGAAGTTGAGTCAGGATGG - Intronic
923167169 1:231376910-231376932 TGGCTGGAACACAGCGAGCACGG + Intronic
923300807 1:232638856-232638878 TTGCTGAAGAATAGGGAGCAAGG - Intergenic
923333498 1:232947137-232947159 TGACTGAAGCAGAGGGACAAGGG - Intergenic
923660719 1:235954824-235954846 TGGCTGCAACAGTGAGAGCATGG - Intergenic
1063120997 10:3105716-3105738 AGGCTGAGACAGAGTGAGCCTGG + Intronic
1064392968 10:14957468-14957490 TGGCTGCAGCAGAATGATCCGGG + Intergenic
1064618568 10:17191139-17191161 AGCCTGGAGTAGAGTGAGCAAGG + Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065071662 10:22031218-22031240 TGGCTGGGGCTGAGGGAGCAAGG - Intergenic
1065229288 10:23580350-23580372 TTGCTGTAGCAGAGTGTGCTGGG + Intergenic
1065797620 10:29321785-29321807 GGGCTGGGACAGAGTGAGCAGGG - Intergenic
1066005928 10:31146214-31146236 TGGCTGAAGGAGCGTGACCTGGG - Intergenic
1066123257 10:32312119-32312141 AGGCTGAAGCACAGTGAGTGAGG + Intronic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1066461984 10:35620303-35620325 TGTCTGAAGCAGAGGGAGACTGG - Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1068000929 10:51333166-51333188 TGGCTGAAGCAGAAATAGCTTGG + Intronic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1070309832 10:75265161-75265183 TGGCTGGAGCAGAATAAACAAGG + Intergenic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071172930 10:82888951-82888973 TGACTGGAGCGGAATGAGCAAGG + Intronic
1071237059 10:83661469-83661491 TGGAGGAAGCAGGGTGAGAAAGG - Intergenic
1071409650 10:85376417-85376439 TGGCTGAAGCATGGTGAACAGGG - Intergenic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1073081959 10:100865960-100865982 TGGGTGAAGAAGTGTGAGGAAGG + Intergenic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073478248 10:103768449-103768471 TGGCTGGAGTGGAGTGAGCCAGG + Intronic
1073510594 10:104040255-104040277 TGGATGAAGCTGAATGAGCTGGG - Intronic
1073709698 10:106022448-106022470 TGGTTGAAGGATAGTGAGAAAGG + Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074074277 10:110107380-110107402 TGGATGAAGTAGATCGAGCAGGG + Intronic
1074632374 10:115272951-115272973 TGGCAGAAGCATTGTGAGCGAGG + Intronic
1075085677 10:119412877-119412899 TCGCTGCAGCTGGGTGAGCAGGG + Intronic
1075282459 10:121151664-121151686 TGGCTGGAACAGAGTAAACAAGG - Intergenic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1076645250 10:131949240-131949262 TGGCTGATGCACACTGAGCTTGG + Intronic
1077032436 11:474537-474559 TGGCTGAGGCAGAGTGCGCTGGG - Intronic
1077440492 11:2566602-2566624 AGTCTGAAGGAGAGTGACCAGGG + Intronic
1077581597 11:3420818-3420840 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1077846486 11:6030586-6030608 TGGCTGAAGCTCAGGGAGCAAGG - Intergenic
1078093495 11:8282492-8282514 TGGCTGAAGGGGAGGGAGCATGG - Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078357958 11:10646951-10646973 TGACTGAAGGAGAATGAGGAAGG + Intronic
1078567185 11:12426375-12426397 TGGCTGGAGCATGGTGAGTAAGG + Intronic
1078797714 11:14609716-14609738 TGGCTGGAGTGCAGTGAGCAAGG + Intronic
1078865249 11:15291255-15291277 TGGCAGCAGGAGGGTGAGCAGGG + Intergenic
1079340013 11:19604018-19604040 TGGCTGGGGGAGAGGGAGCAAGG + Intronic
1079360351 11:19765654-19765676 AGGCTAGAGCACAGTGAGCAAGG - Intronic
1079445681 11:20554441-20554463 TGGCTGAAGCAAAGGAAGGAAGG - Intergenic
1079546080 11:21633455-21633477 TGGCTGGAGCAGAATAAACAGGG - Intergenic
1080157641 11:29130693-29130715 TGACTGTAGCAGAGTGGACAGGG + Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080609792 11:33893989-33894011 AGGCTGAAGCAGGGCTAGCAGGG - Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1080849942 11:36059510-36059532 GGGCTGAAGCAGAGTGCCCAGGG - Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081443682 11:43108647-43108669 AGACTGAAGCAGAGACAGCAAGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1081552754 11:44129403-44129425 TGGCTGGAGCAGAGTAAAGAAGG - Intronic
1081564818 11:44252145-44252167 TGTCTGAAGCATATTGAGTATGG + Intergenic
1081633460 11:44704982-44705004 TGGCTGGAAAGGAGTGAGCAAGG - Intergenic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1082896675 11:58199014-58199036 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1082999814 11:59280972-59280994 TGGCAGAAGCATTGTGTGCAAGG - Intergenic
1083001641 11:59297720-59297742 TGCCTGCAGCAGAGTGGGAAAGG + Intergenic
1083172288 11:60930194-60930216 TAGCTGAAGCAGAGAGTGCATGG + Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083554343 11:63614066-63614088 TGTCTGAGGCAGGGGGAGCAGGG + Exonic
1083751461 11:64763173-64763195 TGGCAGAATCAGAGAGAGAAAGG - Intergenic
1083761672 11:64822036-64822058 AGGCTGATGAAGAGGGAGCAGGG - Intergenic
1083853900 11:65382727-65382749 TGGCTGCAGCAGAGAAAGCAAGG - Intronic
1083944233 11:65915303-65915325 TGGCTCCAGCTGGGTGAGCATGG + Intergenic
1084020004 11:66411699-66411721 TGGGTGAACCATGGTGAGCAGGG - Intergenic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1084179237 11:67438315-67438337 TGGCAGAAGCTGAGTGGGAAGGG + Exonic
1084238510 11:67803641-67803663 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1084398448 11:68930003-68930025 TGGCTGAAGCAGTGAGTGCTGGG - Intronic
1084647141 11:70465106-70465128 TGGCTGGAGCCAGGTGAGCAGGG + Intergenic
1084833907 11:71789192-71789214 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
1085448342 11:76615904-76615926 GGGCTGAAGCAGGGTGGGGATGG + Intergenic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1085862107 11:80246256-80246278 TGGCTGGAGCAGGATGAGCAGGG + Intergenic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1086395491 11:86411204-86411226 TGGCTGAGGCATAGTGACCAAGG - Intronic
1086592548 11:88533238-88533260 TAGATGAAGCAATGTGAGCAAGG - Intronic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1087498276 11:98917962-98917984 TGGGGGAAGCACAGTGATCATGG - Intergenic
1088220344 11:107564132-107564154 TGGCTGAACCGGACTCAGCATGG - Intronic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088345297 11:108817294-108817316 TGACTGGACTAGAGTGAGCAGGG - Intronic
1088527528 11:110772985-110773007 TGGTTGAAGCAGAGCAAGCAAGG - Intergenic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1089869413 11:121658864-121658886 TGGCAGAGGCAAAGTGAACATGG + Intergenic
1089977743 11:122747051-122747073 TGGCTGAAGCAGAGGCTGCGGGG + Intronic
1090014820 11:123076653-123076675 GGTCTGGAGCATAGTGAGCAAGG + Intronic
1090641542 11:128733488-128733510 TGGCTGATGCTGAGTGAACACGG + Intronic
1090753863 11:129771514-129771536 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1090968644 11:131620531-131620553 TAGCTGGGGCTGAGTGAGCAAGG - Intronic
1091111462 11:132972813-132972835 GGCCTCAAGCAGAGGGAGCAGGG - Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091938253 12:4450651-4450673 TGGCTGGAGCATAGTAAGGAGGG - Intergenic
1091979584 12:4854274-4854296 GGGCTGAAGCATAGAGAGCTGGG + Intergenic
1091992198 12:4964394-4964416 TGGCTGAAGCAGTGTGAATGAGG - Intergenic
1092072078 12:5639648-5639670 TGGCTGACACTGAGTGAGCAAGG + Intronic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092155113 12:6277124-6277146 TGGCAGGAGCAGAGCAAGCAAGG + Intergenic
1092409198 12:8241266-8241288 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1092733406 12:11556237-11556259 TGCAGGAAGCAGAGAGAGCAGGG + Intergenic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1092922396 12:13244421-13244443 TGGCAGAAGCACTGTGTGCAGGG + Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093349544 12:18080987-18081009 TGTGTGAAGGAGAGTGAGCAGGG + Exonic
1094100213 12:26753549-26753571 TGCCTGAAGCAGGGTGGGGAAGG - Intronic
1094178015 12:27561661-27561683 TGGCTGGAGCAAACTGAACAAGG - Intronic
1094398958 12:30040362-30040384 TGGCTGAAGCAGAGTGTCAGGGG - Intergenic
1094480521 12:30877690-30877712 TGGCTGGAGCAGACCCAGCAAGG - Intergenic
1094765696 12:33592148-33592170 TGGCAGAAGGATAGAGAGCAAGG + Intergenic
1095683959 12:45010990-45011012 TGGATGCATCAGAGGGAGCATGG + Intergenic
1095781558 12:46065778-46065800 TGGCTGGAGTGGAGTGATCAAGG - Intergenic
1095948553 12:47767834-47767856 TGTCTGAAGTAAAATGAGCAAGG + Intronic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096235494 12:49923456-49923478 TGGCTGGAGCGGAGTGGCCAAGG + Intergenic
1096782387 12:53998703-53998725 TGGGTGAAGAAGAGGGGGCATGG - Intronic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1097723029 12:63044365-63044387 TGGCTGGAGTGGAGTGGGCAAGG - Intergenic
1097826236 12:64177306-64177328 TCGCTAAAGGAGACTGAGCAGGG + Intergenic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098287167 12:68919009-68919031 TGGCTGGAGCCCAGTGAGCAAGG - Intronic
1098336654 12:69411845-69411867 TGGCCGATGCCAAGTGAGCAAGG + Intergenic
1098391908 12:69978466-69978488 TGGCTGAAGAAGTGTGGCCAGGG + Intergenic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1098498544 12:71165065-71165087 TGGCTGCAGCAGCATGAGTAAGG - Intronic
1098828781 12:75333015-75333037 TGGCTGATGCAGAATAAGCCAGG + Intronic
1099048800 12:77757991-77758013 TAGTTGAAGCAAAGTAAGCAAGG - Intergenic
1099209347 12:79765269-79765291 TGGCTGAAGCCAAGTAAACAAGG - Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1100193049 12:92213349-92213371 TGACTGCAGTGGAGTGAGCAAGG + Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100275070 12:93064287-93064309 AGGCTGAAGCCGAGTGGGCAAGG - Intergenic
1100283920 12:93146142-93146164 TGGCTAAAGAATAGTGAGCCAGG - Intergenic
1100442215 12:94627550-94627572 TGGCTGGGGCAGTGTGAGCAGGG - Intronic
1100554519 12:95679858-95679880 TGGCTGGAACAGAGTAAGCTGGG - Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101484069 12:105133183-105133205 TACCTGAAGCACTGTGAGCAGGG - Intronic
1101563156 12:105879435-105879457 TGGCTGGGGCAGAGTGACCCAGG + Intergenic
1101579956 12:106033591-106033613 TGACTGAAGCTAAGTGAGCAAGG + Intergenic
1101699223 12:107155984-107156006 TGGCTGGGGTAGAGTGAGCCAGG + Intergenic
1101714855 12:107301804-107301826 TGGATGCAGCAAAGTGAGCAAGG - Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102247945 12:111367087-111367109 TGGCTGGAGCTGAGTGAACAAGG - Intronic
1102330041 12:112021196-112021218 TGGCTGGAGCTGGGTGAGAAAGG - Intronic
1102416639 12:112768413-112768435 TGGCTGGAGCAGAGAGGACAAGG - Intronic
1102764678 12:115422479-115422501 TGGCTGGAGCAGAGAAAGCAGGG - Intergenic
1102781717 12:115571288-115571310 TGGCTGGAGCAATGTAAGCAAGG + Intergenic
1102807463 12:115794536-115794558 TGGCTGGAGAAGAGTGACCAAGG + Intergenic
1102951482 12:117034418-117034440 TGGGTGGAGAAGACTGAGCAGGG - Intergenic
1103007954 12:117436769-117436791 TGGATGAGGCAGCGTGAGGAAGG - Intronic
1103158842 12:118710563-118710585 TGGGTGCAGCAGAGAGAGAAAGG - Intergenic
1103338890 12:120210725-120210747 TGGCAGAAGCCGAGTGTGCTGGG - Exonic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103865424 12:124047989-124048011 TGGCTGGAGCATAGTGAGAGAGG - Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1103952107 12:124556997-124557019 TGGCTGAGACAGAGCGGGCAAGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104054753 12:125220886-125220908 TGGCTGACAAAGAGTGAGTAAGG - Intronic
1104089912 12:125507657-125507679 TGGCTCAGGCAGAATGAGCAGGG + Intronic
1104121590 12:125805171-125805193 TGGCTGTAGAGGAGTGAGCAAGG + Intergenic
1104169007 12:126261639-126261661 CCGCTGGAGCAGAGTGAGCCAGG + Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104417480 12:128607249-128607271 GGGCTGGAGGAGAATGAGCAAGG + Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1105438200 13:20395035-20395057 TGGATGAACCACAGTGAGAACGG - Intergenic
1105665583 13:22552344-22552366 TGGCTGGAGCAGAGTGGGACAGG + Intergenic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1106700318 13:32222017-32222039 GGACTAAAGCAGAGCGAGCAGGG + Intronic
1107131394 13:36900094-36900116 TGGCAGGAGTAGAGAGAGCAAGG - Intronic
1107200817 13:37714646-37714668 TGGCTGGAGCACAGAGAGCAAGG - Intronic
1107708977 13:43134027-43134049 TGGCTGAGGCAGAGGGAGTGAGG + Intergenic
1107760667 13:43674973-43674995 TGGCTAAAGCACAGTGAACAAGG + Intronic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1107845517 13:44508751-44508773 TGGCTGGAGCATGGGGAGCAAGG - Intronic
1108038303 13:46315432-46315454 TGGCTGGAACAAAGTAAGCAGGG + Intergenic
1108224055 13:48269551-48269573 TGGCTGTAGAGGAGTGAGAAAGG - Exonic
1108519142 13:51229980-51230002 TGACTGAAGTTGAGTGTGCACGG - Intronic
1108853598 13:54766013-54766035 AGAGTGAAGCAGAGTGATCATGG - Intergenic
1109933174 13:69244092-69244114 TGGCAGAAGCATTGTGTGCAAGG + Intergenic
1110467141 13:75814916-75814938 TGGCTGGAGCAGAGGGAGTGGGG + Intronic
1110469441 13:75842265-75842287 GGGCTGGAACAGAGTGAGTAAGG - Intronic
1110812420 13:79825623-79825645 TGGTTCAAGGTGAGTGAGCAAGG - Intergenic
1111071046 13:83168118-83168140 TTCCTGAAGTAGAGTGAGCTAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112117698 13:96375030-96375052 TGGCTACAGCACAGTGAGTAGGG - Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1112204799 13:97314139-97314161 TGGCTAGAGCAGAGTGAGTGAGG - Intronic
1112574922 13:100627175-100627197 TGGCTGGAGCACAGAGAGCAGGG + Intronic
1112609936 13:100946177-100946199 TGGCTGGAGTAGCCTGAGCAAGG - Intergenic
1112725823 13:102303070-102303092 TGGGTGGAGCAGAGTGAGTCGGG - Intronic
1112759458 13:102677529-102677551 TGGCAGAAGCAGAGTTTGTATGG - Intronic
1112783322 13:102925833-102925855 GGGCTGGAGCAGGGTGGGCAAGG + Intergenic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1114406784 14:22464184-22464206 TGGCTGAAAAAGAGTGAAGAGGG - Intergenic
1114456325 14:22856411-22856433 TGGCTGGAACAGAATGATCAAGG + Intergenic
1114465773 14:22921446-22921468 AGGCTGAAGCAGTGTAAGCAAGG + Intronic
1114811582 14:25906628-25906650 TGGCAATAGCACAGTGAGCAAGG + Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115321647 14:32086216-32086238 TGATTGAAGCAGAATGAGAAAGG + Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115787980 14:36847719-36847741 TGGCTGCAGCAGAGGGTGCCTGG + Intronic
1115803162 14:37019197-37019219 TGGCTGAAGTATAGTAATCAAGG - Intronic
1115829123 14:37315309-37315331 TGATTGAAGTACAGTGAGCAAGG + Intronic
1115919170 14:38353928-38353950 TGGCTGGAGAGCAGTGAGCATGG - Intergenic
1115963802 14:38864725-38864747 TGGTGGAAGGAGAGGGAGCATGG - Intergenic
1115995119 14:39188087-39188109 TGGCTGGAGCAGTGTATGCAAGG + Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117308765 14:54501623-54501645 TGACTGGAGCAGAATGAGCTGGG + Intergenic
1118142925 14:63104489-63104511 TGTCTGGAGCATAGTGAGTAAGG - Intergenic
1118589375 14:67389982-67390004 TGACTGAAGCTCAGTGAGGAAGG + Intronic
1118608916 14:67524443-67524465 TGGCTGAGGAGGAGTGAGAAGGG + Intronic
1118816303 14:69316667-69316689 TGGCTGGAGCAGAGCAAGTAAGG + Intronic
1119600190 14:75970669-75970691 TGGCTGGAGCATGGTGAGCTGGG - Intronic
1119674223 14:76541815-76541837 GGGCTGAAGCAAAGAGAGGAGGG + Intergenic
1119734644 14:76974109-76974131 TGCCTGAAGCAGAATGAGAGTGG + Intergenic
1119897254 14:78230717-78230739 TGGCTGGGGCACAGTGAACAAGG + Intergenic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1119975134 14:79016780-79016802 TGGCTGGAGCAGGGAGAGCTTGG - Intronic
1120703373 14:87723131-87723153 TGGCTGGAGAAGAGTGGGCAAGG + Intergenic
1120782072 14:88494286-88494308 TGGCTGGAACAGAGCAAGCAGGG + Intronic
1120962626 14:90139400-90139422 TAGCTAAGGCACAGTGAGCAAGG + Intronic
1121813605 14:96912678-96912700 GGGCTGGGGCAGAGTGAACAGGG + Intronic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122126654 14:99582069-99582091 TGGCTGATCCTGAGTGAACATGG - Intronic
1122314056 14:100815345-100815367 TGGCACACGCAGAGTCAGCATGG + Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1122816734 14:104317674-104317696 CGGGTGAAGCAGAGCGTGCACGG - Intergenic
1122957285 14:105076641-105076663 GGGGTGACGCAGAGTGGGCAAGG + Intergenic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124400190 15:29341225-29341247 TGAATGAGGCAGAGTGAGTAGGG - Intronic
1124604334 15:31159863-31159885 CCGCTGAAGCAGTGTGAGCCAGG - Intronic
1124647521 15:31449389-31449411 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1125011109 15:34876776-34876798 TGGTTGAAGCTTAGTGAGTAAGG - Intronic
1125935671 15:43633444-43633466 TGACTGGAGTAGAGTGAGCAGGG - Intronic
1125948442 15:43729908-43729930 TGACTGGAGTAGAGTGAGCAGGG - Intergenic
1125975494 15:43947771-43947793 TTGCTGAAGCAGAGGCAGCTGGG + Intronic
1126073782 15:44888567-44888589 TGGCAGAATCACAGTGAACAAGG + Intergenic
1126084407 15:44998287-44998309 TGGCAGAATCACAGTGAACAAGG - Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126563536 15:50071075-50071097 TGGCTACAGCAGATTGAACAAGG - Intronic
1127102943 15:55586597-55586619 TAACTGCAGCAAAGTGAGCAAGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127883783 15:63181280-63181302 TGTCTGAACCAGTGAGAGCAAGG + Intergenic
1127931983 15:63602842-63602864 TGGCTGGAGCAGAGTGAATGAGG + Intergenic
1128072169 15:64804559-64804581 TGGATGAAGGAGAGTGAGGTGGG + Intergenic
1128077597 15:64837641-64837663 TGACAGAAGCTTAGTGAGCAAGG - Intergenic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128523068 15:68388220-68388242 TGGCTGGAGTAGAGTGAGCTAGG - Intronic
1128622996 15:69167866-69167888 TGGCTGAAGGAAAGTAAGCAAGG - Intronic
1128625348 15:69196219-69196241 TGACTGAAGTGGAGTGAGCATGG + Intronic
1129108268 15:73323300-73323322 TGGCTGCAGCGGGGTGAGCAGGG + Exonic
1129113462 15:73351843-73351865 TGTCTGCAGCAGAGTGTGCAAGG - Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1129666050 15:77579928-77579950 TGGGGGAAGCAGTGTGAGCTGGG - Intergenic
1130919080 15:88329036-88329058 TGGCTGGAGCAGAAGGACCAAGG + Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131934611 15:97489685-97489707 TAGCTGGAGTGGAGTGAGCAAGG - Intergenic
1131998334 15:98154966-98154988 TGGCTGTAGCACAATGAGGAGGG + Intergenic
1132439659 15:101847501-101847523 AGGCTGAACCTGAGTGTGCAAGG - Intergenic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1133350167 16:5096069-5096091 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1133755341 16:8758449-8758471 TGGCTGGAGCAGAGAGAGTGGGG + Intronic
1134075797 16:11290485-11290507 TGGCTGGAGCAGAGAGAGGTGGG + Intronic
1134363820 16:13557831-13557853 TGGCTGGAGAGGAGTGAGCCAGG - Intergenic
1134447257 16:14340201-14340223 TGGCTGCAGCAGAGCGAGTCGGG + Intergenic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135038464 16:19098200-19098222 TGGCTGGAGCTGAGTGATCTAGG - Intergenic
1135165956 16:20139352-20139374 TGGCTGGAGTGCAGTGAGCAAGG - Intergenic
1135195067 16:20387467-20387489 GGTCTGGAGCAGAGTGAGCTGGG + Intronic
1135197647 16:20407993-20408015 TGGCTGGAGCAGACTGAGACAGG + Intergenic
1135251172 16:20901579-20901601 TGGCTGAAGCAAACAGAGCCAGG + Intronic
1135522594 16:23188953-23188975 GGGCAGAGGCAGAGTGAGCTGGG + Intronic
1135651491 16:24210270-24210292 TGGCCAGAGCAGAGTGACCAAGG - Intronic
1135722569 16:24829775-24829797 TGTCTGAGACAGAGTGGGCAAGG + Intergenic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1135814643 16:25621407-25621429 TGGCTGAAATATAGTGAACACGG - Intergenic
1136044188 16:27602397-27602419 TGGCTGGAACAGACTGAACAAGG - Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136109689 16:28057059-28057081 TGGCTGAAGAAGAGTGACTGTGG + Intronic
1136368415 16:29820632-29820654 TGTCTGAATCAGAGTGGGGAAGG + Intronic
1137370748 16:47903694-47903716 TGACTGAGGCTGAGTGAGCAAGG + Intergenic
1137816556 16:51403611-51403633 TGGCTGGAGCACAGAGAACAAGG - Intergenic
1138197209 16:55060496-55060518 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1138413813 16:56859774-56859796 TGGCTGGAGCAGAGGGACCAAGG - Intergenic
1138495109 16:57404100-57404122 TGGCTGGGGCAGAGTGAACCAGG + Intergenic
1138614875 16:58157360-58157382 TGGCTGAAGTAGACTCAGCCAGG - Intergenic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1140089608 16:71826949-71826971 TGGCTAAGGCAGAGTAAACAAGG + Intergenic
1140130618 16:72157537-72157559 TGGCTGGAGCAGAGACAGTAAGG + Intronic
1140278698 16:73534163-73534185 TGGCTGGAGCTGAATGGGCAAGG - Intergenic
1140325188 16:73994598-73994620 TGGCTGAAGAAAGGTGAGCCAGG - Intergenic
1140735636 16:77895517-77895539 TGGCAGAAGCAGAGGAAGAAGGG + Intronic
1141011804 16:80407784-80407806 TGGGTGAGACAGAGTAAGCATGG + Intergenic
1141034224 16:80613933-80613955 TGGCTCATGCACAGTGAGCAGGG - Intronic
1141232828 16:82186423-82186445 TGGATTAAGAAGAGTGAACAGGG + Intergenic
1141278889 16:82612943-82612965 GGTGTGAAGCAGAGTGTGCAAGG + Intergenic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141658612 16:85429641-85429663 GGGCTGGAGCAGAGCCAGCAAGG - Intergenic
1141888411 16:86909759-86909781 AGGCTGAAGCAGAGAGGGAAGGG - Intergenic
1142586203 17:975524-975546 TGGCTGGAGCAGGCTGACCAGGG + Intronic
1142792857 17:2281827-2281849 TGGCTGGGGGAGAGAGAGCACGG - Intronic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144346501 17:14354463-14354485 TGGCTGGAGCAGGGGGACCAAGG - Intergenic
1144826984 17:18110794-18110816 TGGCTGGAGCAGAGTGATTGAGG - Intronic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1146438571 17:32874017-32874039 TGGATTAAGCAGCATGAGCAGGG - Intronic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1146675383 17:34769771-34769793 TGGCTGGAGCACAGTGAACGTGG - Intergenic
1147355549 17:39893195-39893217 TGGCTGAAGCATTATGAGCAGGG + Intergenic
1147584694 17:41647587-41647609 TGGATGAGGCAGGGTGAGGAAGG + Intergenic
1147669902 17:42170962-42170984 TGGCTGCAGCGCAGGGAGCACGG + Intronic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148717421 17:49725682-49725704 TGGCTGGAGCAGAGTGTGTCAGG + Intronic
1148785213 17:50142907-50142929 TGGCTGGGGCATAGAGAGCAGGG - Intronic
1150909356 17:69371795-69371817 TGGCCTCAGCAGAATGAGCAAGG + Intergenic
1150943203 17:69715989-69716011 TGGGTGAGAGAGAGTGAGCAGGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151335582 17:73437857-73437879 TGGCTGGATCAAAGCGAGCATGG - Intronic
1151392720 17:73798503-73798525 TGGCTGAATCATAGTTGGCAAGG - Intergenic
1151544122 17:74781858-74781880 TGGCTGAAGCACAGCAAGCCGGG - Intronic
1152268367 17:79309428-79309450 TGGGTGGGGCAGAGGGAGCAAGG - Intronic
1153080219 18:1214535-1214557 TGGCTGAAGGGGAGTTAGAAGGG - Intergenic
1153364314 18:4236978-4237000 TGCCTGAACCAGAAGGAGCAGGG - Intronic
1153583620 18:6599709-6599731 TGGCTGAAGTGAAGTGATCAAGG + Intergenic
1154138626 18:11802920-11802942 TGTCTGGAGAAGAGTGAGCCAGG + Intronic
1155457072 18:26029171-26029193 TGACTGAAGCAGAGTGAATGAGG + Intronic
1156537737 18:37880151-37880173 TGGCTGAAGAAGTGTGGGAATGG + Intergenic
1156773457 18:40758366-40758388 TGGCTTAAGCATTGTGACCATGG + Intergenic
1156898436 18:42273141-42273163 TGATTGAAGAAAAGTGAGCAGGG + Intergenic
1157191474 18:45585775-45585797 TGGCTCATGCAGAGGGAGAAGGG - Intronic
1157446950 18:47753304-47753326 TGGCTGGAACAAAATGAGCAGGG - Intergenic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158278470 18:55794499-55794521 TTGATGAGGGAGAGTGAGCAGGG + Intergenic
1159718184 18:71851118-71851140 TGGGTGAAGCTGACTGAGAAAGG - Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1160019155 18:75167060-75167082 TGGCTGAAGCAGTGTCTGCCAGG - Intergenic
1160104894 18:75964855-75964877 ATCCTGAACCAGAGTGAGCAGGG + Intergenic
1160433163 18:78826211-78826233 CGGCTGAACCAGGGTGAGCATGG - Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161243336 19:3235072-3235094 TGGCTGGAACAGAGGGAGCGAGG - Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161283376 19:3457268-3457290 CGGCTGCAGCTGAGTGAGCATGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161301605 19:3545398-3545420 TGGCTGGAGTAGAGGGAGGAGGG - Intronic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161431290 19:4233705-4233727 TGGCCACAGCAGAGTGAGCAAGG - Intronic
1161451750 19:4350237-4350259 TGGCTGGAGCCGAGTGAGTAAGG + Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161501039 19:4615833-4615855 TGGCTGGGGCAGAGTGAACGAGG - Intergenic
1161503813 19:4633203-4633225 TGGCTGGAATAGAGTGAGCTAGG + Intergenic
1161515469 19:4693836-4693858 TGGCTGGAGCACAGGGAGGAGGG - Intronic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161629354 19:5344490-5344512 TGGCGGGAGCAGAGTGAGCGAGG - Intergenic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161760584 19:6168176-6168198 TGGCTAGAACAGAGTGAGCAAGG - Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161857043 19:6772138-6772160 TGGCTGGAGCACAGTGAAGAGGG + Intergenic
1161860753 19:6796446-6796468 TGCCTGGAGCAGAGTAAGCGAGG - Intronic
1162080392 19:8214512-8214534 TGGCTGGAGCAAACTAAGCAAGG + Intronic
1162087846 19:8259367-8259389 TGGCTGGAGCAGAGTGGGTGAGG + Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162156382 19:8680923-8680945 TGGCTGGAGTGGAGTGAGTAAGG + Intergenic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162308222 19:9888602-9888624 TGGCGGAAGCAGATGGAGTAGGG - Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162397780 19:10427421-10427443 TGTCTGAGGCAGAGTGAGCGAGG + Intronic
1162400720 19:10445013-10445035 TGGCTGGAGCAGAATGAGTGAGG + Intronic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162467745 19:10852681-10852703 TGGCTGAAGGATGGTGAACAAGG + Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162734533 19:12738843-12738865 TGCCTGAAGCTTAGTGAGCCAGG + Intronic
1162844455 19:13381678-13381700 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1163017786 19:14467418-14467440 TGGCTGGAGGAGAGTGAGTGAGG + Intronic
1163113505 19:15175858-15175880 TGGCTGGAACAGAGTGAGTGAGG + Intronic
1163122113 19:15224162-15224184 TTGCTAAGGCAGAGTGAGCGAGG - Intergenic
1163262876 19:16201819-16201841 AGGCTGGAGCAGAGTGAACCAGG + Intronic
1163704353 19:18803711-18803733 TGACTGGAGCAGAGTGAGGGAGG + Intergenic
1163731463 19:18951958-18951980 TGACTGAAGCAAAGTGAGTTGGG + Intergenic
1163810802 19:19430229-19430251 TGGCTGGAGAAGAATTAGCAGGG - Intronic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1165064621 19:33221675-33221697 TGGCTGAGGCTGGGTGAGCAGGG + Intronic
1165323875 19:35102806-35102828 CGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1165433119 19:35783602-35783624 TGGCTGGAGCTGAGTGAGTGAGG + Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165794092 19:38508698-38508720 TAGCTGAAGCAGAGTCATCGAGG + Intronic
1165814466 19:38633160-38633182 TGGCCAGAGCAGAGTAAGCATGG + Intronic
1165891234 19:39113497-39113519 TGGCTGCAGCAGAGTGGGCGAGG - Intergenic
1165899390 19:39161753-39161775 TGGCTGGAGCAGGGTGGGCGAGG - Intronic
1165940249 19:39411336-39411358 TGGCTGGAGCAGAGTGGCCAAGG - Intergenic
1165996449 19:39847151-39847173 TGGGTGGGGCAAAGTGAGCAAGG + Intergenic
1166051700 19:40264538-40264560 TGGCTGGAGCAGTGTGAGCTAGG - Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166171695 19:41032198-41032220 TGGCTGAAATAGAGTGAAGAAGG + Intergenic
1166730268 19:45055374-45055396 TGGCTGGAGCAGGGAGAGCGAGG + Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167112017 19:47468183-47468205 TGGCTGAGGCAGACTGGGCAAGG - Intronic
1167531896 19:50022970-50022992 TGGCTGACTCAGCGTGAGCAAGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167842308 19:52131958-52131980 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1167896668 19:52587345-52587367 TGGCTGGAGCAGAGGGAGTGAGG - Intergenic
1167906109 19:52661997-52662019 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167945109 19:52981839-52981861 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168237255 19:55071277-55071299 TGGCTGAGTCAGACTGTGCAGGG + Intronic
1168302173 19:55411396-55411418 AGGATGAAGCAAAGAGAGCATGG - Intergenic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
1168516696 19:57015199-57015221 TGTCTGAAGAGGAGTGAGCAAGG - Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927253384 2:21018440-21018462 TGGCTGGAGCAGAAAGACCAGGG - Intronic
927389791 2:22582363-22582385 TGGCTGAAGCTGAAGGAGCTGGG - Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927631800 2:24780942-24780964 AGGCTGGAGCAGAGTGACCGAGG + Intergenic
928074454 2:28250277-28250299 TGGCTGGAGCACAGTGAGTAAGG + Intronic
928103244 2:28451848-28451870 TGGCTGGAGAGGAGTCAGCAGGG + Intergenic
928105891 2:28470416-28470438 TGCCTGCAGCAGAGTGACCTTGG - Intronic
928576056 2:32656495-32656517 TGCCTGGAGCAGAGTGTGAAGGG + Intronic
929001368 2:37350229-37350251 TGACCGAAGCATGGTGAGCAAGG + Intronic
929836404 2:45404834-45404856 TGGCCAGAGCAGAGTGAGCAAGG - Intronic
929879986 2:45827121-45827143 TGACTGGAGCAGAGTGTGGAGGG - Intronic
930203274 2:48564361-48564383 TGGCAGAAAGAGAGTGAGCTAGG + Intronic
930277965 2:49335777-49335799 TGGCTGGAGCAGACTGAACGAGG + Intergenic
930511410 2:52349908-52349930 TGGCTGCAACAGAGTGGGCAAGG - Intergenic
930675040 2:54191313-54191335 TGGCTGGAGTACAGGGAGCAAGG - Intronic
930870594 2:56166996-56167018 TGTTTGAGGCAGAGTGAACAAGG + Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931380743 2:61750964-61750986 TGGCTGGAGCAAAGTGATCAAGG + Intergenic
931631716 2:64307960-64307982 TGGCTGAGGCAGAGAGAGACAGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
932055065 2:68435000-68435022 TGGCAAAAGCACAGTGGGCATGG + Intergenic
932311313 2:70744600-70744622 TGGCTGAAGCTGAGTGGCAAAGG + Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932527683 2:72488969-72488991 TAGCTGGAGTGGAGTGAGCAAGG - Intronic
932692908 2:73928612-73928634 TGACTGAAGTCGAGTGAGCAAGG + Intronic
932741307 2:74293060-74293082 AGGGTGAAGCAGAGGGGGCAGGG + Intronic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
933124432 2:78586544-78586566 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934475228 2:94588933-94588955 TGGCTGGAGGAGGGAGAGCAGGG - Intronic
934678191 2:96265061-96265083 TGGCTGAAGCAGAGATAGCCAGG - Intronic
935608030 2:104990360-104990382 TGGCTGGAGCAGTGTGAGTAAGG + Intergenic
936003769 2:108863454-108863476 TAGCTGAAGCAGAGTTAGTGAGG + Intronic
936629375 2:114184929-114184951 TGGGGGAAGCTGAGTGAGAAGGG + Intergenic
936893998 2:117406077-117406099 TGGGTGAAGCTAAGTGAGCATGG + Intergenic
937246390 2:120496807-120496829 GGGCTGAAGCAGAAGGAGAAGGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
938932428 2:136098590-136098612 TGGCTGAGGCCTGGTGAGCAAGG - Intergenic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
939680753 2:145129224-145129246 TGGCTGTAATAGGGTGAGCAAGG + Intergenic
940012849 2:149073026-149073048 TGGCTGGAGAATAGTGAGCAGGG + Intronic
940452568 2:153858283-153858305 TGATTGAAGCAGAGTAAGAAAGG + Intergenic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941417324 2:165237359-165237381 TGGCTAAAGTAGAGTGAGTGAGG + Intergenic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941598580 2:167509708-167509730 TGGCTGGAGCAGTGTGAGTTAGG + Intergenic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
942110939 2:172682242-172682264 TGGCTGTAGTAGAGAGAGCAGGG + Intergenic
942345320 2:174996783-174996805 TGGCTGGAGTGGAGTCAGCAAGG - Intronic
942363063 2:175193136-175193158 TGTGTGAAGCAGAATGAGCAAGG - Intergenic
942504461 2:176626905-176626927 GGGCTGAAGCAGAAAGAGCAAGG - Intergenic
942989228 2:182179051-182179073 TGACTGAATCAGAGTAAGCCTGG - Intronic
943392641 2:187288701-187288723 TGCCTGAAGCTGAGAGAGCCTGG - Intergenic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944207176 2:197169098-197169120 TGGCTGAAGGAGAGTGAAGGAGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945196487 2:207241992-207242014 TGCCTAAAGCACAGTGAGAAAGG + Intergenic
945684183 2:212949315-212949337 TGGCTGAAGCAGAGTCAAGTTGG - Intergenic
945935706 2:215900899-215900921 TGGATGAAGGAGATTGAGAATGG - Intergenic
946162303 2:217842781-217842803 TGGCTGGAGTAGAGTGATCAAGG - Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946440837 2:219693762-219693784 TGGCTGGAGCAGAGAGTGCAGGG + Intergenic
946523953 2:220497568-220497590 AGGCTGGGGTAGAGTGAGCAGGG + Intergenic
946855740 2:223948084-223948106 AGGCTGGAGCAGAGTGAGTGAGG + Intergenic
946863974 2:224026092-224026114 TGGCGGAAGCAGAAAGATCATGG - Intronic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
947010534 2:225561380-225561402 TGGCTGGAACAGAGTGAACCTGG + Intronic
947406250 2:229780590-229780612 TGGCTCGAGCATAGAGAGCAAGG - Intronic
947787273 2:232834639-232834661 TGCCTGAAGGAGAGAGAGAAAGG - Intronic
947806261 2:232970430-232970452 TGGAGGAAGCAGAGTGGGAAGGG + Intronic
948631272 2:239304186-239304208 TGCCTCAAGCAGTGTGAGCTCGG + Intronic
1168731842 20:90727-90749 TGGCTGTAGTGGAGTGAACAAGG - Intronic
1168770156 20:409239-409261 GGGCTCCAGTAGAGTGAGCATGG - Intronic
1168772065 20:421702-421724 TGGCTGGAGCAGAGGGATGAAGG + Intronic
1168807121 20:678164-678186 TGGCTGGAGCAGAGAATGCATGG - Intergenic
1168809407 20:694445-694467 TGGCTGGAGCACAGTGAACAAGG + Intergenic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1168957232 20:1842784-1842806 GGGCTGGAGCAAAGTGAGCGAGG - Intergenic
1169000330 20:2163622-2163644 TGGCTGCAGCAGAGGAAGCAAGG + Intronic
1169104541 20:2983291-2983313 TGGCTGAAATTGAGTGAGCAAGG + Intronic
1169432094 20:5545603-5545625 TGGCTGAAGCAGGGTGTAAAAGG + Exonic
1170110325 20:12797939-12797961 TGGCTGGAGCAGCTTGAGGAAGG - Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170770464 20:19328201-19328223 TGGCTGGAGCAGAATGAGGGAGG + Intronic
1170774337 20:19362720-19362742 TGGCTGAAGTAGAAACAGCAGGG - Intronic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172008540 20:31833358-31833380 TGGATGGAGTGGAGTGAGCAAGG + Intronic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1172359742 20:34303562-34303584 TGGCTGAACCAGCGAGAGGACGG - Intronic
1172384396 20:34523457-34523479 TGGCTGAAGGGCAGGGAGCAGGG - Intronic
1172460919 20:35118017-35118039 TGGCTGGAGCGGAGCAAGCAAGG - Intronic
1172577389 20:36019667-36019689 TGGCTGGAACAGACTAAGCAAGG + Intronic
1172784071 20:37454458-37454480 TGGCTGGAGCAACATGAGCAAGG - Intergenic
1172872992 20:38147360-38147382 TGCCTGGAGTGGAGTGAGCAGGG - Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173337267 20:42122890-42122912 AGGCTGAAGCACAGGGTGCATGG - Intronic
1173341558 20:42157070-42157092 TGGCAGAGGAAGAGTGAGCAAGG - Intronic
1173539422 20:43840494-43840516 GGGCTGGAGCAGAGTGATCAAGG + Intergenic
1173617090 20:44410294-44410316 TGGCTGATGGCGAGTGAGCGTGG + Intronic
1173669352 20:44787174-44787196 TGGCTGGAGCAGACAGAGCAAGG + Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1173838740 20:46142462-46142484 TGACGAGAGCAGAGTGAGCAAGG - Intergenic
1174118754 20:48246565-48246587 TGGCTGGAGCATAGTGACCCTGG - Intergenic
1174166001 20:48583986-48584008 TGGCCGGGGCAGAGTGAGTAGGG + Intergenic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1174222809 20:48970765-48970787 TGTGTGAAACAGAGTGAGCCAGG + Intronic
1174278340 20:49419921-49419943 TGGCTGGAGGGGAGTGAGCAAGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174299259 20:49569565-49569587 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1174302106 20:49589872-49589894 TGGCTGGAGCTGAGTGAGTTGGG - Intergenic
1174308522 20:49632231-49632253 TGGCTGGAGTAGAGGGGGCAGGG - Intergenic
1174313949 20:49682433-49682455 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1174421246 20:50400444-50400466 TGGCTGCAGCAGAATGAGTGAGG + Intergenic
1174428278 20:50448804-50448826 TGGCTGGAGGAGAGTGAGTGAGG - Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174943938 20:54964007-54964029 TGGCTGAAGTATAGTGAGGGAGG + Intergenic
1175143463 20:56878207-56878229 TGGCTGCAGCCGTGTGAGCCAGG + Intergenic
1175270702 20:57731923-57731945 TGGCAGCAGGAGAGAGAGCACGG + Intergenic
1175955235 20:62605668-62605690 TGGCTGATGGAGAGGGAGCTGGG + Intergenic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177286314 21:19055916-19055938 TGACTGAAGCTTAGTGAGGAAGG + Intergenic
1177459228 21:21388475-21388497 TTGCTGAAGCTGAATAAGCAAGG + Intronic
1177770422 21:25508525-25508547 TGGCTACTGCAGAGTCAGCAAGG - Intergenic
1177927634 21:27238357-27238379 TGGCTGCAGCAGAGTAAGTGAGG - Intergenic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178601567 21:33999203-33999225 TGGCTGGAGCAGGGTGACAAGGG - Intergenic
1179224536 21:39442268-39442290 TGGCTGAAGCCCAGTGAGAAGGG + Intronic
1179231313 21:39506351-39506373 TGGCTGAAGTAGAGTGGTGAGGG + Intronic
1179818871 21:43924982-43925004 TGGCTGAAGTGCAGTGAGGAAGG - Intronic
1179834881 21:44024264-44024286 TGACTGAAGCAGCATGAGCTGGG - Intronic
1180125807 21:45789621-45789643 TGGCCGGAGCAGAGCGAGCAAGG + Intronic
1180203868 21:46244845-46244867 TGGCTGAAGCAGGCTGTGCTCGG - Exonic
1180713100 22:17853298-17853320 AGGCTGCAGCAGAGTGGGCTGGG - Intronic
1180914945 22:19479464-19479486 TGGCTGAAGCAGAGGCAGTCTGG - Intronic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1181001925 22:19991839-19991861 TGCCCGGAGCACAGTGAGCATGG + Intronic
1181175015 22:21030349-21030371 TGGCTGTAGCAGAGAGAGTGGGG + Exonic
1182759750 22:32712725-32712747 GGTCTGAAGCTGAGTGAGAAAGG - Intronic
1182874150 22:33675565-33675587 TGGGTGAAACAGGGTGAACAAGG + Intronic
1182936464 22:34227443-34227465 GGGCTAAACCAGAGTGAGCAAGG - Intergenic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1183154397 22:36063908-36063930 TGACTGGAGGAGAGGGAGCAAGG - Intergenic
1183849787 22:40575633-40575655 TGGCTGAAGAAAAGTCACCATGG - Intronic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184327186 22:43797825-43797847 TGGTTGAGGCAGAGGGAGCCGGG - Intronic
1184714454 22:46273033-46273055 AGGCTGCAGCAGGGTGAGAAGGG - Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1184825777 22:46949904-46949926 GGGCTGGAGCAGCCTGAGCAGGG + Intronic
1185179824 22:49352885-49352907 TGGCTGGAGCCAAGTGACCAAGG + Intergenic
949252600 3:2005281-2005303 TGGCTGAAGCAGAGAAAGTAAGG + Intergenic
949371893 3:3344179-3344201 TGGTTGGAGCAGGATGAGCAAGG - Intergenic
949478331 3:4470062-4470084 TGGCTACAGTGGAGTGAGCAAGG + Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950223272 3:11212865-11212887 TGGCTGGAGCTGAGTGAGTGAGG - Intronic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950563422 3:13749186-13749208 GGCCTGAGGCAGAGTGAGCCAGG - Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
951975691 3:28505256-28505278 TGGCTGAAGAAGAGAGTGCAGGG + Intronic
952121699 3:30252695-30252717 TGGCCAGAGCACAGTGAGCAAGG + Intergenic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952254328 3:31682407-31682429 TGGCTGGAGCAGGGTGAACAGGG - Intronic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953239355 3:41134868-41134890 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
953339733 3:42123348-42123370 TGGCTCAAGCAGGGGGAACAGGG + Intronic
953416201 3:42719352-42719374 TGCCTGAGGCAGAGTGGGGAAGG - Intronic
953468410 3:43145861-43145883 TGGCAGAAGCACTGTGAGCAGGG - Intergenic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953768679 3:45762717-45762739 TCACTGAAGCAAACTGAGCATGG + Intronic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
954199917 3:49018077-49018099 TGGCTCAAGCGGAGTGCGCAGGG + Exonic
954235445 3:49253540-49253562 TGGCTGAAACATGGTGAGCAAGG - Intronic
954365582 3:50144445-50144467 TGGCCGAGGCAGAGGCAGCAGGG - Intergenic
954652091 3:52171318-52171340 TGGTTGGAGCAGGGAGAGCAGGG - Intergenic
954731199 3:52663821-52663843 AGGCTGAAGCAGGGGGATCATGG + Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955088789 3:55729224-55729246 TGGCTGGCGTAGAGTGAGCAAGG - Intronic
955243876 3:57205530-57205552 TGGCTGGAACACAGTGAACATGG - Intronic
955961795 3:64348301-64348323 TGGCTCAAACACAGGGAGCAGGG + Intronic
956084136 3:65591714-65591736 TGGCAGAAATAGAGTGAACAAGG - Intronic
956277558 3:67519285-67519307 TGGCTGGAGCACAGGGTGCAAGG - Intronic
956373441 3:68588782-68588804 TGGCAGAAGCAGAGTGAATGAGG + Intergenic
956488108 3:69742515-69742537 TGGCTGTAGCAGAGGGAGGTAGG - Intronic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956593750 3:70944631-70944653 TGGCTGCTGCAGAGTAAACATGG - Intergenic
956829193 3:73028827-73028849 TGGCTGAAGTAGACTGATCAAGG + Intronic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957054459 3:75433432-75433454 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
957199841 3:77119102-77119124 TGGCAGGAGAAGAGAGAGCAAGG - Intronic
957259701 3:77885032-77885054 TGGCTGGAGTACATTGAGCAAGG + Intergenic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
958192766 3:90204639-90204661 TGGTTAAAGCATAGTGAGCAAGG - Intergenic
958255649 3:91321753-91321775 TGGCTGAGGCAGAGCCAGCAGGG - Intergenic
958271709 3:91508249-91508271 TGGCTGGTGCACGGTGAGCATGG + Intergenic
958438206 3:94123671-94123693 TGGCTGGAGCAAGGTGAGCCAGG - Intronic
958624562 3:96607320-96607342 TGGGTGCAGCACAGTGAGCATGG - Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960658330 3:120030525-120030547 TGACTGAAGGATTGTGAGCAAGG - Intronic
961524616 3:127488804-127488826 TGGCTGAAGCAGCCTGCCCAGGG - Intergenic
961947130 3:130703235-130703257 TGGCTGGAGCAAAGTGAGCGAGG - Intronic
962129279 3:132655441-132655463 TGCCTGAAGTAGTGTAAGCAAGG - Intronic
962501617 3:135999941-135999963 TGGGTGGAGCAGAGAAAGCAAGG - Intronic
962649716 3:137476268-137476290 TGGCTGCAGCAGACTGAGTGAGG - Intergenic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
962904263 3:139787949-139787971 TGGTTGTAGCAGATTAAGCAAGG - Intergenic
963280289 3:143377874-143377896 TGGCTGGAGCTGAGTAAGCAAGG - Intronic
963608878 3:147440292-147440314 AGTCTGAAGCATAGTGAACAAGG + Intronic
963661543 3:148133237-148133259 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
963730152 3:148963414-148963436 TGGCTGGAGAAAAGTGAGCAAGG + Intergenic
963747852 3:149143220-149143242 TGGATGAAGAATAGTAAGCAGGG - Intronic
963897031 3:150697892-150697914 TGGCTGCAGTGGAGTAAGCAGGG - Intronic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964248085 3:154677517-154677539 TAGCTGAGGTTGAGTGAGCAAGG + Intergenic
964361954 3:155907913-155907935 TGGTTGGAGCAGAGTAAGCATGG + Intronic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964747666 3:160027089-160027111 TGGTTAAAGCAAAGTGGGCAAGG + Intronic
964948605 3:162258858-162258880 TGTCTAGAGCAGAGTGAGAAAGG + Intergenic
965387275 3:168059974-168059996 TGACTGAGGCAGGGTGAGCCCGG + Intronic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966108467 3:176365291-176365313 TTGCTGAACCAGACTAAGCAGGG + Intergenic
966311308 3:178596965-178596987 TGGCTGGAGAAGAGAGAACAGGG + Intronic
966323927 3:178733304-178733326 TGGCTGGAGTAGAGTGAGCTGGG + Intronic
966390409 3:179447257-179447279 AGGCTGGAAGAGAGTGAGCAGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966514705 3:180805997-180806019 TGGCTGCACCAGGGTTAGCATGG + Intronic
966567199 3:181396576-181396598 TGGCTGCAGTAGAGTGAGGCTGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
966723528 3:183088040-183088062 TGGCTGGAACACAATGAGCAAGG + Intronic
967248446 3:187512855-187512877 TGGATGCAGCACACTGAGCAGGG + Intergenic
967636503 3:191808098-191808120 TGGCTGATGCTGTGGGAGCAGGG - Intergenic
967856292 3:194119972-194119994 TGACTGGGGCAAAGTGAGCAAGG - Intergenic
967912315 3:194552511-194552533 TGGCCGCAGCAGAGTGGGCAAGG - Intergenic
967989347 3:195119893-195119915 TGGCTGAAGCAGGGAAGGCAGGG + Intronic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968339986 3:197947464-197947486 TGGCTGGAGCCCAGAGAGCAAGG - Intronic
968356204 3:198109448-198109470 TGACTGAGGCAGGGTGAGAAAGG + Intergenic
968471548 4:784835-784857 TGGATGGAGCTGAGTGAGAATGG + Intergenic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
968997272 4:3953742-3953764 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
969369004 4:6719263-6719285 AGGCTGCAGGGGAGTGAGCAAGG - Intergenic
969471123 4:7389893-7389915 AGGCTGAAGGACAGTGAGCAGGG + Intronic
969517441 4:7655465-7655487 TGGCGGCTGCAGAGTGGGCAAGG + Intronic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969756742 4:9154940-9154962 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
969816712 4:9692509-9692531 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
970279030 4:14433809-14433831 TGGCTGAGGTGCAGTGAGCAAGG - Intergenic
970873397 4:20842377-20842399 TGGCTGGAGCAGAGTAAATAGGG + Intronic
970965665 4:21925009-21925031 TGACTGGAGTAGAGTGAGTAAGG - Intronic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971270676 4:25141828-25141850 TGGCTGGAGCAAAAAGAGCAAGG - Intronic
971271134 4:25147029-25147051 TGGCTGAACCATAATGAACAAGG - Intronic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972462350 4:39316328-39316350 TGGTTGGAGCATAGTGACCAAGG - Intronic
972514891 4:39802300-39802322 TGTCTAGTGCAGAGTGAGCAAGG - Intergenic
972779785 4:42277013-42277035 TGGCTGAAGTATAAGGAGCAAGG + Intergenic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973786514 4:54337493-54337515 TGACTGGAGCACAATGAGCAAGG - Intergenic
973827497 4:54723334-54723356 TGGCTGAGGCAGAGGTGGCAGGG - Intronic
974133070 4:57780332-57780354 TGGATGCATCATAGTGAGCAAGG + Intergenic
975270090 4:72421191-72421213 TGGCTAGAGCAGAAAGAGCAAGG - Intronic
975329768 4:73099946-73099968 TGGCAGAAGCAAAGTAAGTATGG - Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975475781 4:74821751-74821773 TGGCAGGAGCACAGTGAGTAAGG + Intergenic
975496871 4:75045239-75045261 TGGTTATAGCAGAGGGAGCAAGG + Intronic
975578870 4:75889321-75889343 TGGCTGGAGAAGAGGGAGCCAGG - Intronic
975654627 4:76629315-76629337 TGGCTGGGGCAGAGTGAGTGAGG + Intronic
975654885 4:76631641-76631663 TGACAGAAGCACAGCGAGCAGGG + Intronic
975881169 4:78909536-78909558 TGGCTGGAATATAGTGAGCAAGG - Intronic
976005918 4:80430843-80430865 TGGCTGAAGCGGAGAAAGCTAGG - Intronic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976229401 4:82825596-82825618 TAGCTGGAGCAGAGAGAACAAGG + Intronic
976347468 4:84021255-84021277 TGGCTAAGACAGAGTGAACATGG + Intergenic
976369202 4:84267523-84267545 TGGCTGAAGGACAGGGAGGAGGG - Intergenic
976553343 4:86421935-86421957 AGGCTGGAGTACAGTGAGCATGG - Intronic
976674124 4:87685627-87685649 AGGCTGGAGGAGGGTGAGCAAGG - Intergenic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977314897 4:95433848-95433870 AGGCTGAAGATGAGTGAGCTGGG - Intronic
977336111 4:95701591-95701613 TGACTGAAGCAGAATAAGAAAGG - Intergenic
977370708 4:96131292-96131314 TGGCTGAAACAAAGTGAGTAAGG - Intergenic
977593083 4:98848615-98848637 TGCCTGCAGCAGAGTGGGGAAGG + Intergenic
977855553 4:101886318-101886340 TGGCTGAAGCAGAAACAGCAAGG + Intronic
978226789 4:106344747-106344769 TGGCTCAAGTGGAGTGAACAAGG - Intronic
978312409 4:107399039-107399061 TGGCTAAAACAGAGTGAACAAGG + Intergenic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
978874714 4:113625608-113625630 TGTCTGTAGAAGAGTGAACAGGG + Intronic
979006177 4:115300102-115300124 TGGCTAAAGCAAAATAAGCAAGG - Intergenic
979840615 4:125435676-125435698 TGTCTGGACCAGAGTGAGAAAGG + Intronic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980369640 4:131850676-131850698 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
981069790 4:140523184-140523206 TGGCTGGAGGAGAAAGAGCAAGG - Intergenic
981605762 4:146538304-146538326 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982090354 4:151875160-151875182 TGGCTGGAGTAGAGAGAGCAAGG + Intergenic
982195388 4:152906789-152906811 TGACTGCAGCAGAGTGAATAAGG - Intronic
982413496 4:155105837-155105859 TGGATGAAGCAGAGTGAAGCGGG + Intergenic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
983819403 4:172173868-172173890 TGGCTAAAACACAGTAAGCAGGG + Intronic
984010530 4:174366229-174366251 TGGCTGCAGGACAGTGAGGATGG + Intergenic
984111910 4:175627387-175627409 TGGCTGAGCAAGAATGAGCAAGG + Intergenic
984441370 4:179774582-179774604 TGCCTGAGGCAGAGTGGGGAAGG - Intergenic
984802774 4:183729953-183729975 TGTGGGGAGCAGAGTGAGCAAGG + Intergenic
985054006 4:186020320-186020342 TGGCTGAAGGAGAATGAGCCAGG + Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985984782 5:3505599-3505621 CGGCTGAAGCAGGCTGAGCTGGG + Intergenic
986253658 5:6083617-6083639 TGGCAGGAGCTGAGTGAGCCAGG - Intergenic
986261481 5:6151424-6151446 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986402517 5:7395182-7395204 TGACTGAAGCTGAGCGTGCAGGG + Intergenic
986688417 5:10294133-10294155 TGGCTGCAACAGAAAGAGCAAGG + Intronic
987302208 5:16606912-16606934 TGGCTGGGGCTGGGTGAGCAAGG - Intronic
988439704 5:31218890-31218912 TGACTGAAGCAGAGTGTGCTAGG - Intronic
988496588 5:31750812-31750834 TGGCTGGAGTGGAGTGAGTAGGG + Intronic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988642673 5:33058644-33058666 TGGCTAAATCAGAAGGAGCAAGG + Intergenic
988663826 5:33302978-33303000 TGACAGGAGGAGAGTGAGCATGG + Intergenic
988901854 5:35741451-35741473 TGTCTGGAGCAGAGTGAGCTAGG + Intronic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
988967504 5:36434001-36434023 TAGCTTGAGCAGAGTAAGCATGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
989789002 5:45369494-45369516 AGGCTGGGGCTGAGTGAGCAAGG - Intronic
990029983 5:51246678-51246700 CAGCTGAAGCAGAGAAAGCATGG + Intergenic
990282341 5:54264609-54264631 TGGCTGAAGCAGAAAGAGTAGGG - Intronic
991350534 5:65716253-65716275 TGGCTGAAGCCAAATGAGAAAGG + Intronic
991392397 5:66160496-66160518 TGGTTGAAGCATAGTGAGTGAGG + Intronic
991494981 5:67217838-67217860 TGGCTTAAGCAGGGAGAGCCAGG + Intergenic
991979013 5:72212345-72212367 TGGCTGGAGCAGAATGTGTAAGG - Intergenic
992146811 5:73858901-73858923 TGACTGGAGCAGAGGGAGTAAGG - Intronic
992388656 5:76310462-76310484 TGGCTGGAGCAGAATGACCAAGG + Intronic
992498865 5:77322056-77322078 TGGGTGAGGCAGGGTGAGCAGGG + Intronic
992763159 5:79969712-79969734 GGTCAGGAGCAGAGTGAGCAGGG - Intergenic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
994052688 5:95380610-95380632 TGGCTGGAGGAGAGTAAGCAAGG + Intergenic
994142076 5:96352864-96352886 TGGCAGCAGGAGAGAGAGCAAGG - Intergenic
994804363 5:104424703-104424725 TGCCTTGAGCTGAGTGAGCAGGG + Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995110252 5:108420989-108421011 TGGCTAGAGCAGAGTGACTAAGG + Intergenic
995821771 5:116242675-116242697 TGGCTGAAGCAGAAGTAGGAGGG - Intronic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996245816 5:121263058-121263080 TGCCAGCAGCAGTGTGAGCATGG + Intergenic
996381577 5:122867326-122867348 TGGCAGAAGCATTGTGTGCAGGG + Intronic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
996789277 5:127275320-127275342 GGGCTGAAGGAGAGTGAGTCAGG + Intergenic
997222773 5:132182705-132182727 TGACTGAAGCAGAGGGAGCTGGG + Intergenic
997267482 5:132503560-132503582 TGGCTGCAGCATGGTGGGCAAGG + Intergenic
997286185 5:132680390-132680412 TGGCTGGATCAGAGTGAGTGAGG + Intronic
997424056 5:133791049-133791071 TGGCTACAGCAGAGTGAGTGAGG - Intergenic
997459636 5:134043120-134043142 TGGCAGGAGAAGAGTGATCAAGG + Intergenic
997741700 5:136260549-136260571 GGGCTGAAACAGAGTGAGTGAGG + Intronic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
998368833 5:141648377-141648399 TGGCTGGAGTACTGTGAGCAAGG - Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998784654 5:145695769-145695791 TGAATGACCCAGAGTGAGCAAGG + Intronic
998882373 5:146656711-146656733 TGGCTGGAGAGGAGTGAGTAAGG + Intronic
999576840 5:152988297-152988319 TGACTGAGGCAGAGTGTGCAGGG + Intergenic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
999693807 5:154170843-154170865 TGGCTGAAGCTGAATGACCAGGG - Intronic
999793545 5:154966141-154966163 ATGCTGAAGCATAGTAAGCAAGG - Intronic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000166151 5:158650624-158650646 TGGCTGGAGAAGAATGAGCAGGG - Intergenic
1000186617 5:158864821-158864843 TGGCTGCAGCACAGTGAGCGAGG + Intronic
1000304759 5:159985049-159985071 TGGCTGAAGTGGAGTGAGGGAGG - Intergenic
1000448680 5:161357375-161357397 TGGCTGGAACAGAATGTGCAAGG + Intronic
1000963829 5:167631464-167631486 TGGCTGAAGCATAGGGAGTAAGG + Intronic
1000971830 5:167723316-167723338 TGACTGCACAAGAGTGAGCAAGG - Intronic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001164242 5:169349114-169349136 TGGCTGGAGCAAAGTGAGAGAGG - Intergenic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001751795 5:174137062-174137084 TGGCTGGAACTGAGTGAGCAAGG + Intronic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002122986 5:177020158-177020180 TGGCTGGAGCCCAGTGAACAAGG - Intronic
1003207541 6:4027005-4027027 TGGCTGGAGCAGGGTGACCGTGG + Intronic
1003396066 6:5752938-5752960 TGGGTGGGGCAGAGTCAGCACGG - Intronic
1004053739 6:12113438-12113460 AGGCTGAAGCGGAGTGAGTCAGG + Intronic
1004077922 6:12362257-12362279 TAGCTGAAGCAGAGGGAGCTGGG + Intergenic
1004774391 6:18826593-18826615 TAGCTGAAGCTGATTGAGTAAGG - Intergenic
1004956262 6:20731086-20731108 TGGCTGAAACAGAGTGAATGAGG + Intronic
1005423037 6:25672597-25672619 TGGCTGGAGCAGAGCAAGAAAGG + Intronic
1005648072 6:27861031-27861053 TGGCTGGAACAGAGGGAACAAGG - Intronic
1005969468 6:30749876-30749898 TGGCGGAGGCAGAATGGGCAGGG + Intergenic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006178350 6:32137713-32137735 TGAGTGGAGCAGAGTGAGCAAGG + Intergenic
1006390672 6:33756418-33756440 TGGCTGGAGCAGAGGAAGCCAGG + Intergenic
1006466820 6:34200536-34200558 TGGCTAGAGCAGAGTAAGCAAGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006823743 6:36918508-36918530 TGGCAGCAGCAGAGAGAACAGGG + Intronic
1006916086 6:37594681-37594703 TGGCTGAGGCAGGGTCAGCCTGG - Intergenic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007029514 6:38615467-38615489 TGGCTGGAGCAGAATGTGCCAGG - Intronic
1007238980 6:40411575-40411597 TGGCTGAAGCACAGAGTGCAGGG - Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007322186 6:41035332-41035354 GTTCTGAAGCAGAGTGAGCTTGG + Intronic
1007692431 6:43711401-43711423 TGGCTGGAGCAGAGGGACCGAGG + Intergenic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008291935 6:49726109-49726131 TAGCTGGAGTAGAGGGAGCATGG - Intergenic
1008430113 6:51406434-51406456 TGACTAAAGCAAAGTAAGCAAGG + Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008815170 6:55556491-55556513 TAGATGGAGAAGAGTGAGCAAGG + Intronic
1008983407 6:57512885-57512907 TGGCTGGTGCATGGTGAGCACGG - Intronic
1009565888 6:65310635-65310657 TGACTGTAGCAGAATGAGAAGGG - Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1009989772 6:70827496-70827518 TGGCTGTAGCATAGAGAGTATGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1012356324 6:98318566-98318588 TGGCTAGAGCTGAGTGAGCCTGG + Intergenic
1012384025 6:98656248-98656270 TGCCTGAAGCACTGTGAGAAAGG - Intergenic
1012398502 6:98825573-98825595 TTGCTGATGGAGAGGGAGCAGGG - Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012416196 6:99016690-99016712 TGGCTGAACTTGAATGAGCAAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012489369 6:99763756-99763778 TGGCTGGAGCATAGTGAGCTAGG + Intergenic
1012603695 6:101131099-101131121 TGGCTGGAGCAGAGTGACTGAGG + Intergenic
1013070399 6:106723946-106723968 TGGCTGGAGTAGAGTGAAGAGGG + Intergenic
1013372913 6:109485450-109485472 TGGCTGGAGCACAGTGAGTGAGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013635404 6:112024607-112024629 TGGCTGAAATGGAGTGAGAAAGG - Intergenic
1013965837 6:115954224-115954246 TGGCTGACGAAGACTGAGCAAGG + Intronic
1014002939 6:116385150-116385172 TGGCTGGAGCAGAGAGAGACTGG + Intronic
1014397907 6:120949307-120949329 TGGCTGGGGTAGACTGAGCAAGG - Intergenic
1014599490 6:123392076-123392098 TTGATGAAGCACAGTGAACAAGG - Intronic
1014814170 6:125917360-125917382 TGGCTGGAGAAGAGACAGCAAGG - Intronic
1015107372 6:129552663-129552685 TGGCTGAGGCAGCGTGAGTTGGG - Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015812921 6:137179132-137179154 TGGCTGGAGAGGAGGGAGCAAGG + Intergenic
1016580426 6:145623502-145623524 TGGCTAGAGCAGAGTGAGAGAGG + Intronic
1016788141 6:148036145-148036167 TGTCGGAGGCAGAGTGAGAAGGG + Intergenic
1017384049 6:153861936-153861958 TGGCAGCAGCAGGCTGAGCATGG - Intergenic
1017539771 6:155388747-155388769 TTGATGAAGCATGGTGAGCAGGG + Intergenic
1018333596 6:162760625-162760647 TGGCTGGAGGAAAGTGAGCCAGG + Intronic
1018896105 6:168018712-168018734 TAGCTGAAGGAGGATGAGCAGGG - Intronic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019487497 7:1296086-1296108 GGGCTGAGGCTGAGTGAGCAGGG + Intergenic
1020007109 7:4788908-4788930 TGCCTGCAGCAGCGTGGGCACGG - Exonic
1020432130 7:8125318-8125340 TGGCTGGAGCTGACTAAGCAAGG - Intronic
1020846374 7:13289588-13289610 TGGCTGAAGCAGGGTATGTAGGG - Intergenic
1020909608 7:14112047-14112069 TGGTTGAAACAAAGTGAGCAAGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021276186 7:18654515-18654537 GGGCTGAAGTAGATTGAGCAAGG + Intronic
1021804276 7:24339684-24339706 TGCCTGGTGCTGAGTGAGCACGG - Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022526139 7:31038538-31038560 TGGCTGGAGGACAGAGAGCAAGG - Intergenic
1022656962 7:32328514-32328536 TGTCTGGAGCACAGTGAACATGG - Intergenic
1022778425 7:33552943-33552965 TGGGTAAAGCAGAATGGGCAAGG - Intronic
1023138819 7:37080781-37080803 GGGCTGAAGCAGAGAGAACCAGG - Intronic
1023302566 7:38789467-38789489 TGGCTGCAGCACAGAGACCAAGG + Intronic
1023483764 7:40662504-40662526 TGGCAGAAGCACAGTGAACAAGG - Intronic
1023680698 7:42684489-42684511 AGGCTGAAGCAGAGTAAATAGGG + Intergenic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024325051 7:48102889-48102911 TGTCTGAAGCAGAGGGTGTAGGG + Intronic
1025249584 7:57343024-57343046 TGGCTGCAGCAGAATGAGTGAGG - Intergenic
1026290761 7:69003709-69003731 TGGCTGGAGCTTAGTGAGCCAGG - Intergenic
1026477157 7:70746702-70746724 TGGCTGAAGGAGAGGGAGAGGGG + Intronic
1027366292 7:77461872-77461894 CGGCTTAAGGAGAGTGAGCTGGG - Intergenic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1027798866 7:82726604-82726626 TGGCCACAGCAGAGTGAGCAAGG + Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1030109239 7:106012486-106012508 TGGCAGGAGGAGAGTGAACAAGG + Intronic
1030894650 7:115042844-115042866 TGGCTGGAGCAAGGTGAGCTAGG + Intergenic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1032088576 7:128896995-128897017 TGCCTGAGGCAGAGTGGGAAAGG - Intronic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1033204454 7:139405744-139405766 TGGATGAAGTAGAGAAAGCACGG + Exonic
1033562434 7:142545211-142545233 TGGCTGGAGCAGAGAGAGCCAGG - Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1033998541 7:147384143-147384165 TGGCTGAAACATGGTGACCAAGG + Intronic
1034446506 7:151116592-151116614 TGAGTGAAGCAGAGTAAGGATGG - Intronic
1034526620 7:151667783-151667805 TGGCTGGACCAGAGTGACCTCGG - Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034870567 7:154679559-154679581 TGGCTGTAGCAAAGGGGGCAGGG + Intronic
1035403746 7:158585979-158586001 AGGAGGAGGCAGAGTGAGCAAGG + Intronic
1035761993 8:2075331-2075353 TTGCTGGTGCTGAGTGAGCAAGG - Intronic
1036606321 8:10308684-10308706 TAACTGAAGCACAGTGAGCATGG - Intronic
1036849583 8:12192402-12192424 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1036870945 8:12434675-12434697 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1037269330 8:17108897-17108919 TGGTTGGTGCAGAGTGAGCTAGG - Intronic
1037274749 8:17165967-17165989 TGGCTGAAGTGTAGTGAGCAAGG + Intronic
1037431407 8:18817080-18817102 TGGCTGGAGAGGAGTGAGCAAGG + Intronic
1037616976 8:20528057-20528079 TGGCTAAAGCAAAGCCAGCAAGG - Intergenic
1037920910 8:22804843-22804865 TGGCTGCAGCAGGGTGGTCACGG - Intronic
1038387325 8:27161044-27161066 TGGCTGGAGCACAGGGTGCATGG - Intergenic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1038820854 8:30950851-30950873 TGGCTGGAGAAGAGTGACTAAGG + Intergenic
1039527106 8:38226661-38226683 TGGCTGAAGCATTATGGGCAGGG + Intronic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1039665130 8:39517681-39517703 TGGAGATAGCAGAGTGAGCAAGG + Intergenic
1039719892 8:40151893-40151915 TGGTCAGAGCAGAGTGAGCAGGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1040590802 8:48790283-48790305 TGACTGAAGGAGTCTGAGCAAGG - Intergenic
1040637336 8:49290497-49290519 TGGCTGAAGAAGACTTAACAAGG - Intergenic
1041804581 8:61836442-61836464 TGGCAGCAGTAGACTGAGCAGGG + Intergenic
1041891432 8:62873824-62873846 TGGCTAAAGCAGTGTTAACAGGG + Intronic
1042567218 8:70124233-70124255 TTGCTGAAGCCGAGACAGCAGGG + Intronic
1043242361 8:77951399-77951421 TGGCTGAAGTAGAGTCAGAGAGG + Intergenic
1043309640 8:78842528-78842550 TGGCTGAAGAAGAAAGATCAAGG + Intergenic
1043737879 8:83769403-83769425 TGGCTGCAGTAGAGGAAGCATGG - Intergenic
1044003892 8:86918192-86918214 TGGTTGTAGCATAGTTAGCACGG + Intronic
1044130534 8:88518143-88518165 TGGTTAGAACAGAGTGAGCAAGG - Intergenic
1044230627 8:89773446-89773468 TGGCTGGAATACAGTGAGCAAGG + Intronic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044693550 8:94901201-94901223 TGGCTGGAACGTAGTGAGCAAGG + Intronic
1044701418 8:94968571-94968593 TGCCTGGAGCTGAGTGAGCAAGG + Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045190543 8:99878368-99878390 TGGCTGAGGGTGAGTGATCAAGG - Intronic
1045888243 8:107124544-107124566 TGGCTGGTGCAGAATGAACATGG - Intergenic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1046635403 8:116669900-116669922 TGGTAGAAGCAGAGTGTGTAGGG - Intronic
1046823502 8:118661575-118661597 TGGCTGGAACAGAGAGAGTAAGG + Intergenic
1046841101 8:118858144-118858166 TGGCTAAAGCAGAGAGCACAGGG + Intergenic
1047050631 8:121107829-121107851 TGGCTGAAGCAAAATGATTAAGG - Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047463277 8:125088933-125088955 TGGCTGGAGCAGAGTCAGCTAGG + Intronic
1047618982 8:126587083-126587105 TGGCTGGAGAAGAGAGGGCAGGG + Intergenic
1047915845 8:129582978-129583000 TGGGAGGAGCACAGTGAGCAAGG + Intergenic
1048059088 8:130899034-130899056 TGGCTAGAGCATAGTGAGCAGGG - Intronic
1048962716 8:139593847-139593869 TGCCTGTTGCTGAGTGAGCATGG + Intergenic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049864072 8:144922299-144922321 TGGCAGCACCAGAGTGGGCAGGG + Intergenic
1050242479 9:3651575-3651597 TGGCAGAAGACGAGTGGGCAGGG - Intergenic
1050333150 9:4565501-4565523 TGGCTGCAGGAGAGAGAGCAAGG + Intronic
1050694845 9:8267147-8267169 TGGCTGAAACAGAATGTGAAAGG + Intergenic
1051196244 9:14565347-14565369 TGGCTGCAGCAGAATCACCAGGG + Intergenic
1051261425 9:15268974-15268996 TGGCTGGAGTCGAGTGAGTAAGG - Intronic
1051347150 9:16162520-16162542 TGGCTGGAGTGGAGAGAGCAAGG + Intergenic
1051463351 9:17348895-17348917 TGGCTGGAGTAGGGTGGGCATGG + Intronic
1051542203 9:18232167-18232189 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1051571759 9:18566713-18566735 TGACTGGAGCTAAGTGAGCAAGG + Intronic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1051836127 9:21340039-21340061 TGAGTGAAGCACAGTGAGTAGGG - Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052292032 9:26852975-26852997 AGGCAGGAGCAGAGAGAGCAAGG + Intronic
1052854825 9:33400839-33400861 TGGCTGGAGGAGGGAGAGCAGGG + Intronic
1052887182 9:33661127-33661149 TGACAGAGGAAGAGTGAGCAGGG + Intergenic
1052895357 9:33742540-33742562 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1053121892 9:35553704-35553726 TGGCTGGAGCACAGTGGGCCAGG + Intronic
1053318762 9:37076547-37076569 AGGCTGAAGCATTCTGAGCATGG + Intergenic
1053322955 9:37116582-37116604 AGGCTGAAGCATTCTGAGCATGG + Intergenic
1053634018 9:39976336-39976358 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1053682843 9:40497158-40497180 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1053771729 9:41487168-41487190 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1053932825 9:43125472-43125494 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054209869 9:62274361-62274383 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1054258995 9:62843623-62843645 TGGCAGGAGCAGAGCGAGCCTGG + Intergenic
1054280871 9:63127770-63127792 TGGCTGGAGGAGGGAGAGCAGGG - Intergenic
1054295943 9:63332658-63332680 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054315126 9:63574593-63574615 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1054393959 9:64637153-64637175 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054428608 9:65142365-65142387 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054501771 9:65879177-65879199 TGGCTGGAGGAGGGAGAGCAGGG - Intronic
1054749176 9:68886921-68886943 TGGCTGTAGCAGAGAGGGCAAGG - Intronic
1054870123 9:70041845-70041867 TGGCTAGAGAAGAGTAAGCAGGG + Intergenic
1055350601 9:75382870-75382892 TGGTTGAGACAGAGTGAGCAAGG + Intergenic
1056222501 9:84464221-84464243 TGGCTGGAGCAGAGGGAACCAGG - Intergenic
1056493107 9:87127263-87127285 TGGCTGGAGCAGAGTGAATGTGG - Intergenic
1056658662 9:88529053-88529075 TGGCTCAGGCAGGCTGAGCACGG + Intergenic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057500180 9:95590622-95590644 TGGCTGGAGCAGAGTAAACAAGG - Intergenic
1057567495 9:96178419-96178441 TCCCTGAAGCAAAGTCAGCATGG - Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057953755 9:99390933-99390955 GGGTTGCAGCTGAGTGAGCAAGG + Intergenic
1057971278 9:99560500-99560522 TGGCTGCAGCATAATGAGCTGGG + Intergenic
1058201667 9:102050012-102050034 TGCCTGAAGCACAGTGAGAAAGG - Intergenic
1058387876 9:104460180-104460202 TGCCTGGAGCTGAGTGAACAAGG + Intergenic
1058862245 9:109127723-109127745 GAGGTGAGGCAGAGTGAGCAGGG - Intergenic
1058888171 9:109338752-109338774 TGGCCTAATGAGAGTGAGCAGGG - Intergenic
1059189490 9:112310909-112310931 TGGCTGAAAGAGAATGAGCAAGG + Intronic
1059750207 9:117240493-117240515 TGACTGGAGCAGAGTAAGAAAGG + Intronic
1060008690 9:120024291-120024313 TGCCTGAAGAAAAGTGAGAAGGG - Intergenic
1060262414 9:122088057-122088079 GGACTGAAGGAGAGTGGGCAAGG + Intronic
1060290576 9:122299066-122299088 TGCCTGTAGCAGAGTGAGTGAGG + Intronic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060851260 9:126878498-126878520 TCACTGAAGGAGACTGAGCATGG + Intronic
1060857412 9:126925945-126925967 TGGCTAAAGCACTGAGAGCAAGG + Intronic
1060868817 9:127022613-127022635 TGGCTGGAGCAGAAGGAGCCTGG - Intronic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1061085754 9:128397255-128397277 TGGCTGGAGCGCAGTGAGGAAGG + Intergenic
1061350566 9:130061486-130061508 TGGCTGGAGCAGAGTGATCTAGG + Intronic
1062057036 9:134474131-134474153 TGACTGCAGCAGAGTGGGCTGGG + Intergenic
1186458184 X:9727364-9727386 TGACTATAGAAGAGTGAGCAAGG - Intronic
1186506860 X:10100614-10100636 TGGCTGGAGCAGGGTGAGTGGGG - Intronic
1186536530 X:10355773-10355795 TGGCTGGAGCAGAACGAACAAGG + Intergenic
1187265337 X:17726846-17726868 TGGATAAACCAGAGTGAACAAGG + Exonic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187572540 X:20519470-20519492 GGGCTGAAGTAGAGAGAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1189278618 X:39805200-39805222 TGGCTGGAGGGGAGGGAGCAAGG + Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1189712503 X:43827760-43827782 TGGCTGGACCAGGGTGAGCTGGG + Intronic
1189715500 X:43860794-43860816 TGGCTGTAGTAGAATGAGCAAGG - Intronic
1189952790 X:46249490-46249512 TAGATCAAGTAGAGTGAGCAAGG + Intergenic
1190172127 X:48119993-48120015 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190189664 X:48266746-48266768 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190196891 X:48327370-48327392 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190205949 X:48402755-48402777 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190286344 X:48963885-48963907 TGGGTGGAGGAGAGTGAGCTGGG - Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1190658426 X:52633250-52633272 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190659907 X:52644756-52644778 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190676824 X:52789588-52789610 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1191075144 X:56445032-56445054 TGCCAGCAGCAGAGGGAGCATGG + Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191141036 X:57117178-57117200 TGTCTGGAGCTGAGTGAACAAGG - Intergenic
1191142636 X:57132894-57132916 TGACTGGAGCTGAGTGAACAAGG - Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191631421 X:63325958-63325980 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1191871255 X:65747490-65747512 TGGCTGAAGCATAGTAAGCCAGG - Intergenic
1192055171 X:67766477-67766499 TCCCTGAGGCAGAGTGAGCAAGG - Intergenic
1192057073 X:67783931-67783953 TGGCTGTACCACAGAGAGCAAGG - Intergenic
1192273824 X:69610115-69610137 TGACTGGAGCAGAGTGAACAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1194566396 X:95494282-95494304 TGGCTGAAGCAGCTGGGGCACGG - Intergenic
1194643675 X:96432044-96432066 TGGCTGGAACATAGTGAGGAAGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195122048 X:101764660-101764682 TGGTTGAAGCACAGGGACCAAGG + Intergenic
1195419187 X:104654494-104654516 TGGCTGGAGCATAGGCAGCAAGG + Intronic
1195576637 X:106459135-106459157 TGACTGGAGCTGAGTGAGCAAGG - Intergenic
1195661252 X:107380888-107380910 TGATTGGAGCAGAGTAAGCAAGG + Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196377609 X:115051513-115051535 TTGCTGGGGCAGAGTAAGCAAGG + Intergenic
1196764645 X:119231877-119231899 TAGCTGTAGTAGAGTGACCAGGG + Intergenic
1196776773 X:119345276-119345298 TGGCTGAAGTGGAGTAAGCAAGG - Intergenic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1196940235 X:120768434-120768456 AGGCTGAAGCAGAGTGAATGAGG + Intergenic
1197631795 X:128869401-128869423 TGGCTGGACTATAGTGAGCAAGG + Intergenic
1197865506 X:131012494-131012516 TGGCTAAAGTACAGTGAACAAGG + Intergenic
1197881736 X:131173772-131173794 TGGCTAAAGCAGAGTGATTAAGG + Intergenic
1197891008 X:131270367-131270389 TGGCTGGAGCATAGTAAGCAAGG - Intergenic
1197916608 X:131542473-131542495 TGACTGGAGCAAAGTGAGCAAGG + Intergenic
1198433885 X:136596352-136596374 TGGCTGTAGCAGCATGAGTAAGG + Intergenic
1199021385 X:142882195-142882217 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1200230948 X:154443722-154443744 TGGAGGAAGCAGAGGGAGCGGGG + Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200251538 X:154556780-154556802 TGGCTACAGCCGAGTGACCAGGG - Intronic
1200259262 X:154603508-154603530 TGGCTGCATCAGCGTGAGCAAGG + Intergenic
1200266229 X:154647636-154647658 TGGCTACAGCCGAGTGACCAGGG + Intergenic
1200335581 X:155347837-155347859 TGGCTGGAGCTGAGTAAGCAAGG - Intergenic
1200350887 X:155493388-155493410 TGGCTGGAGCTGAGTAAGCAAGG + Intronic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic